Log In Sign up
The largest database of trusted experimental protocols
> Anatomy > Body Part > Basal Forebrain

Basal Forebrain

The Basal Forebrain is a complex brain region located at the base of the forebrain, playing a crucial role in various cognitive and behavioral processes.
It comprises structures such as the Septal Nuclei, Diagonal Band of Broca, Nucleus Basalis of Meynert, and the Substantia Innominata.
This region is involved in functions like attention, learning, memory, and sleep-wake regulation.
Researchers studying the Basal Forebrain often focus on understanding its neuroanatomy, neurochemistry, and its involvment in neurological and psychiatric disorders, such as Alzheimer's disease, Parkinson's disease, and schizophrenia.
Exploring the power of PubCompare.ai can help optimize Basal Forebrain research by locatiing the most reproducible and accurate protocols from literature, preprints, and patents using AI-driven comparisons, enhancing research accuracy and reproducibility.

Most cited protocols related to «Basal Forebrain»

1
Immunostaining of TDP-43 Lesions in Brain Regions
For this study, paraffin blocks of 14 brain regions that included the eight original regions, as well as six newly reported regions (basal forebrain, insular cortex, ventral striatum, substantia nigra, midbrain tectum and inferior olive) were sectioned and immunostained for TDP-43 (polyclonal antibody MC2085 that recognizes a peptide sequence in the 25-kDA C-terminal fragment[44 (link)] with a DAKO-Autostainer (DAKA-Cytomaton, Carpinteria, CA) with 3,3’-diaminobenzidine as the chromogen. A region was considered TDP-43 positive if there were any TDP-43 immunoreactive neuronal cytoplasmic inclusions, dystrophic neurites, or neuronal intranuclear inclusions identified at 400× magnification. These lesion types were chosen as all three lesion types have been identified in amyotrophic lateral sclerosis[4 (link),31 (link),38 (link)], frontotemporal lobar degeneration[4 (link),14 (link),22 (link),38 (link)] and Alzheimer’s disease[3 (link),5 (link),8 (link),19 (link),21 (link),23 (link),24 (link),28 (link),41 (link)], and are therefore considered to be abnormal. The definition of TDP-43 positivity used in this study is unchanged from that used to develop the original TDP-43 in Alzheimer’s disease staging scheme [23 (link)].
Josephs K.A., Murray M.E., Whitwell J.L., Tosakulwong N., Weigand S.D., Petrucelli L., Liesinger A.M., Petersen R.C., Parisi J.E, & Dickson D.W. (2016). Updated TDP-43 in Alzheimer’s disease staging scheme. Acta neuropathologica, 131(4), 571-585.
Publication 2016
Alzheimer's Disease Amyotrophic Lateral Sclerosis Anesthesia, Conduction azo rubin S Basal Forebrain Brain Cytoplasmic Inclusion Frontotemporal Lobar Degeneration Immunoglobulins Insula of Reil Neurites Neurons Nuclear Inclusion Olivary Nucleus Paraffin Peptide Fragments polypeptide C protein TDP-43, human Substantia Nigra Tectum Mesencephali Ventral Striatum
2
Postmortem Brain Diffusion Imaging

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2013
A Fibers Animals Autopsy Basal Forebrain Brain Brain Stem Connectome Corticospinal Tracts Diencephalon Diffusion ECHO protocol Fixatives Formaldehyde Homo sapiens Hypothalamus Mental Orientation Mesencephalon Nucleus, Cuneiform Pons Pulse Rate Reticular Formation of Midbrain Tegmentum Mesencephali Thalamus Tissues TNFSF11 protein, human Woman
3
Quantifying TDP-43 Pathology in Alzheimer's Disease
Amygdala blocks were sectioned and immunostained for TDP-43 (polyclonal
antibody MC2085 that recognizes a peptide sequence in the 25-kDa C-terminal
fragment[48 (link)]) with a DAKO-Autostainer
(DAKO-Cytomaton, Carpinteria, California) and 3, 3’-diaminobenzidine as
the chromogen. Sections were lightly counterstained with Hematoxylin. Amygdala
sections were screened (by DWD), to assess for the presence of TDP-43
immunoreactive neuronal cytoplasmic inclusions, dystrophic neurites, or neuronal
intranuclear inclusions (Figure 1). We
screened the amygdala as the amygdala has been shown to be the first region
affected in AD by TDP-43 pathology[19 (link)].
Any AD case not showing TDP-43 immunoreactivity in the amygdala was considered
TDP-negative (Figure 2a), while any AD case
showing any amount of TDP-43 immunoreactivity in the amygdala was considered
TDP-positive (Figure 2b–d). Hence,
amygdaloid positivity was all that was necessary to call an individual AD case
TDP-43 positive. For TDP-positive cases, we sectioned additional paraffin blocks
of the middle frontal, superior temporal, and inferior parietal cortices,
nucleus basalis, hippocampus, midbrain and medulla using the same protocol as
described above for the amygdala. The following 14 distinct brain regions per
case were reviewed simultaneously with a multi-headed microscope (by DWD and
KAJ) for TDP-43 immunoreactivity: amygdala, entorhinal cortex, subiculum,
hippocampal dentate fascia, occipitotemporal cortex, inferior temporal cortex,
basal forebrain, insula, ventral striatum, frontal lobe, basal ganglia,
substantia nigra, midbrain tegmentum, and inferior olive. A region was
considered positive if TDP-43 immunoreactive lesions were observed at
20× magnification screening the entire region, with subsequent
confirmation at 40× magnification. The number of cases with TDP-43
immunoreactivity for each of the 14 regions is shown in Figure 3.
To ensure antibody sensitivity, we additionally screened amygdala
sections from 10% of the TDP-negative cases using a different antibody
against phosphorylated TDP-43 peptide (1:5,000 rabbit polyclonal anti-human
phosphoserine 409/410). None of the cases that had initially screened negative
with the polyclonal antibody MC2085 showed TDP-43 immunoreactivity with the
phosphorylated antibody, ensuring excellent sensitivity of MC2085.
TDP-43 burden was assessed in the hippocampal dentate fascia using the
Aperio slide scanner and a customized color deconvolution algorithm enabling the
detection of any abnormal TDP-43 (Figure
4). The dentate fascia was selected for the burden analysis since the
dentate fascia has been demonstrated to be most strongly associated with memory
loss [36 ]. TDP-43 immunostained sections
of the posterior hippocampus at the level of the lateral geniculate were scanned
at ultra-resolution on the ScanScope XT (Aperio Technologies, Vista, CA). This
instrument permits scanning of the entire slide from which large areas of
interest can be annotated using ImageScope version 11.2 (Aperio Technologies,
Vista, CA). The method greatly increases the sampling frame compared to some
other image analysis systems that are limited to the field of view of the
microscope or require image tiling [38 (link)].
The entirety of the dentate fascia was assessed to quantitatively determine
TDP-43 immunohistochemical burden. To operationalize annotation of the dentate
fascia, the ruler tool was used to measure 125µm across the granule cell
layer to molecular layer to avoid quantification variability resulting from
tissue sectioning differences. Any dust or dirt particles or tissue folds were
excluded using the negative trace tool. Annotated layers were analyzed in
Spectrum version 11.2 (Aperio Technologies, Vista, CA) using a custom-designed
color deconvolution algorithm, as previously described [22 (link)]. After applying the color deconvolution algorithm, each
high resolution image was reviewed independently by two investigators (MM
& AL) in order to ensure that only abnormal TDP-43 was being measured.
Cases where the algorithm was unable to separate abnormal TDP-43 from normal
nuclear TDP-43, were removed from further analysis of TDP-43 burden (n=20).
TDP-43 burden was then expressed as the area of immunoreactive pixels to the
total area of the annotated region.
Josephs K.A., Whitwell J.L., Weigand S.D., Murray M.E., Tosakulwong N., Liesinger A.M., Petrucelli L., Senjem M.L., Knopman D.S., Boeve B.F., Ivnik R.J., Smith G.E., Jack CR J.r., Parisi J.E., Petersen R.C, & Dickson D.W. (2014). TDP-43 is a key player in the clinical features associated with Alzheimer’s disease. Acta neuropathologica, 127(6), 811-824.
Publication 2014
Amygdaloid Body azo rubin S Basal Forebrain Basal Ganglia Basal Nucleus of Meynert Brain Cortex, Cerebral Cytoplasmic Granules Cytoplasmic Inclusion Entorhinal Area Fascia Gyrus, Dentate Hematoxylin Hypersensitivity Immunoglobulins Inclusion Bodies Insula of Reil Lobe, Frontal Medulla Oblongata Mesencephalon Microscopy Neurites Neurons Olivary Nucleus Paraffin Parietal Cortex, Inferior Peptides polypeptide C protein TDP-43, human Rabbits Reading Frames Seahorses Subiculum Substantia Nigra Tegmentum Mesencephali Temporal Lobe Tissues Ventral Striatum
4
Mapping Basal Forebrain Cholinergic System in MNI Space
The BFCS map was processed as shown in Fig. 1. Most parts of the magnocellular nuclei of the BFCS are located in the substantia innominata, ventral to the anterior commisure. The ventral pallidum and parts of the nucleus accumbens are located in the rostral substantia innominata, The caudal parts of the substantia innominata are occupied by the extended amygdala. We used the Mesulam nomenclature for subregions of the BFCS [6 (link), 43 (link)]. The nuclei of the BFCS and their subregions were identified from the digital images of the histological sections and manually transferred into the corresponding slices of the MRI scan of the dehydrated brain. The MRI scan of the dehydrated brain was then transformed into the space of the postmortem in cranio scan using an initial 12-parameter affine transformation followed by a high-dimensional nonlinear registration [44 (link)] implemented in SPM8 software (Wellcome Trust Center for Neuroimaging). Next, the postmortem in cranio MRI was transferred into MNI standard space using the high-dimensional DARTEL (Diffeomorphic Anatomic Registration using Exponentiated Lie algebra) registration method [45 (link)]. The linear and non-linear transformations from alcohol through in cranio to MNI space were combined to spatially transform the basal forebrain mask into the MNI standard space. We used this map (i) to relate the voxel-wise group effects in local GM reduction to the anatomical position of the BFCS nuclei in MNI space and (ii) to automatically extract individual GM volumes for each BFCS subregion.
Kilimann I., Grothe M., Heinsen H., Alho E.J., Grinberg L., Amaro E J.r., dos Santos G.A., da Silva R.E., Mitchell A.J., Frisoni G.B., Bokde A.L., Fellgiebel A., Filippi M., Hampel H., Klöppel S, & Teipel S.J. (2014). Subregional Basal Forebrain Atrophy in Alzheimer's Disease: A Multicenter Study. Journal of Alzheimer's disease : JAD, 40(3), 687-700.
Publication 2014
Amygdaloid Body Autopsy Basal Forebrain Brain Cell Nucleus Ethanol MRI Scans Nucleus Accumbens Radionuclide Imaging Substantia Innominata Ventral Pallidum
5
Individualized Mouse Brain Atlases
In order to create individualized atlases, a first step is to define and segment the individual anatomical structures from the MRM images of the mouse brain. The segmentation procedure we used was essentially similar to that described previously (Ma et al., 2005 (link)) with the exception that the first in vivo reference brain was segmented semi-automatically using our existing in vitro C57BL/6J mouse brain atlas (http://www.bnl.gov/ctn/mouse). The in vitro reference image was first registered with the in vivo image to be segmented (referred to as ‘target’ image) using linear and non-linear transformations [using both RVIEW (Studholme et al., 1996 (link)) and AIR_5.2.5 software packages (Woods et al., 1998 (link))]. The same transformation parameters were subsequently applied to bring the atlas of the in vitro brain into registration with the target in vivo brain hereby producing a pilot segmentation of the target image. Due to registration errors and especially due to inherent morphological differences between in vitro and in vivo mouse brains (Figure 6), the initial pilot segmentation did not match perfectly with the true structure boundaries in the in vivo image. Therefore the automatic segmentation result necessitated further smoothing and refinement which was done semi-automatically using a commercial 3D visualization and modeling software package (Amira 3.1, TGS, San Diego, CA).
The first segmented in vivo brain image was subsequently used as the new reference template to segment all other in vivo images since it registered better with the remaining in vivo group than the original in vitro reference brain. By repeating the above described processes a total of 12 in vivo mouse brain images were segmented. Each of the segmented in vivo data sets serves as an individualized atlas with 20 outlined brain structures which included: neocortex, hippocampus, amygdala, olfactory bulbs, basal forebrain and septum, caudate-putamen, globus pallidus, thalamus, hypothalamus, central gray, superior colliculi, inferior colliculi, the rest of the midbrain, cerebellum, the rest of the brainstem (i.e. pons and medulla), corpus callosum/external capsule, internal capsule, anterior commissure, fimbria, and ventricles. Quantitative structural information such as the averaged volumes and surface areas of each of the 20 structures were also extracted.
Ma Y., Smith D., Hof P.R., Foerster B., Hamilton S., Blackband S.J., Yu M, & Benveniste H. (2008). In Vivo 3D Digital Atlas Database of the Adult C57BL/6J Mouse Brain by Magnetic Resonance Microscopy. Frontiers in Neuroanatomy, 2, 1.
Publication 2008
Amygdaloid Body Basal Forebrain Brain Brain Stem Cerebellum Corpus Callosum External Capsule Fimbria of Hippocampus Globus Pallidus Heart Ventricle Hypothalamus Inferior Colliculus Internal Capsule Medulla Oblongata Mesencephalon Mice, Inbred C57BL Mice, Laboratory Neocortex Neostriatum Olfactory Bulb Pons Seahorses Tectum, Optic Thalamus

Most recents protocols related to «Basal Forebrain»

1
Viral Induction of Cholinergic Neuron Expression
Following behavioral testing, one cohort of the Chat::Cre+ transgenic rats (N = 4 males, N = 4 females) were injected with an adeno‐associated viral vector (AAV) into the basal forebrain (BF) to induce enhanced yellow fluorescent protein (EYFP) expression in cholinergic neurons. Rats were anesthetized with isoflurane (5% for induction, 2.5% for maintenance, E‐Z Systems Palmer, PA) in oxygen, placed in a Kopf stereotaxic device (David Kopf Instruments, Tujunga CA), and body temperature was maintained using a homeothermic blanket (Harvard Apparatus, Holliston, MA). After administration of a local anesthetic (2% carbocaine, s.c.) at the incision site, the basal forebrain was targeted by drilling two holes through the skull using the following coordinates measured from Bregma with skull flat: A/P‐0.8, L/M+/− 2.4, DV ‐8.6‐8.8.46 Rats were injected bilaterally with 2 μl of rAAV5/Ef1a‐DIO‐EYFP (UNC Viral Vector Core; LOT AV4310L) using a 33‐gauge needle on a Neuros Hamilton syringe at a rate of 0.2 μl/min using a motorized injector (Stoelting QSI Stereotaxic injector Wood Dale, IL). Following injections, the viral vector was allowed to diffuse for 10 min before the needle was withdrawn. Nalbuphine (2 mg/kg, s.c.) was administered postoperatively for pain management, the diet was supplemented with bacon softies (Bio‐serve, Frenchtown, NJ) to maintain postoperative weight, and topical nitrofurazone powder (NFZ puffer, Neogen Corporation) was used for prevention of infection at the incision site. Animals were allowed 3 weeks of recovery prior to perfusion and euthanasia to determine the number of BF cholinergic neurons expressing eYFP using immunofluorescence for choline acetyltransferase (ChAT; described below).
Tryon S.C., Sakamoto I.M., Kaigler K.F., Gee G., Turner J., Bartley K., Fadel J.R, & Wilson M.A. (2023). ChAT::Cre transgenic rats show sex‐dependent altered fear behaviors, ultrasonic vocalizations and cholinergic marker expression. Genes, Brain, and Behavior, 22(1), e12837.
Publication 2023
Adeno-Associated Virus Aftercare Animals BACON protocol Basal Forebrain Body Temperature Carbocaine Choline O-Acetyltransferase Cholinergic Neurons Cloning Vectors Cranium Diet Euthanasia Females Immunofluorescence Infection Isoflurane Local Anesthesia Males Management, Pain Medical Devices Nalbuphine Needles Nitrofurazone Oxygen Perfusion Powder Proteins Pufferfish Rats, Transgenic Rattus Syringes
2
Cholinergic Marker Immunolabeling in Rat Brain
For analysis of cholinergic markers, rats were deeply anesthetized (5% isoflurane) followed by intracardiac perfusion with clearing solution (0.1 M phosphate buffer, 0.5 mM EDTA, 0.05% NaNO2) followed by ice cold 0.1 M phosphate buffer (PB, pH 7.4) containing 4% paraformaldehyde. Brains were removed and placed in 4% paraformaldehyde (0.1 M PB, pH 7.4) to postfix at 4°C. Coronal sections containing the basal forebrain and the amygdala plus hippocampus were cut at 50 μm on a vibratome (VT1000S, Leica, Nussloch, Germany) and stored at 4°C in 0.1 M phosphate buffer until staining. For longer term storage, sections were transferred to Anti‐freezing solution (30% Sucrose in 0.1 M phosphate buffer with 30% ethylene glycol), then stored at −20°C.
Immunofluorescence labeling for ChAT and VAChT used methods described in Tryon et al., (2022).47 For ChAT immunolabeling, sections were washed three times in Tris buffer (TBS) for 10 min, blocked in TBS containing 0.5% Triton X‐100 and 10% normal donkey serum for 30 min at room temperature, washed in TBS then incubated with goat polyclonal anti‐choline acetyltransferase antibodies (1:1000; Millipore Cat# AB144P, RRID:AB_2079751;used previously in47) in TBS containing 0.5% Triton X‐100 and 2% normal donkey serum for 2 days at room temperature. Sections were then incubated in donkey‐anti goat conjugated to Alexa Fluor 647 (1:400; Jackson ImmunoResearch Labs Cat# 705‐605‐147, RRID:AB_2340437) in TBS with 0.5% Triton X‐100 and 2% normal donkey serum for 3 h at room temperature. To detect labeling of vesicular acetylcholine transporter (VAChT), separate sections were washed three times in TBS then blocked for 30 min at room temperature in TBS containing 0.5% Triton X‐100 and 10% normal donkey serum, after which they were washed three times in TBS. Sections were incubated in TBS containing goat anti‐vesicular acetylcholine transporter antibodies (1:1000; Millipore Cat# ABN100, RRID:AB_2630394), 0.5% Triton X‐100 and 2% normal donkey serum overnight at room temperature. Sections were washed three times in TBS then incubated in TBS containing donkey‐anti goat conjugated to Alexa Fluor 555 (1:500; Molecular Probes Cat# A‐21432, RRID:AB_141788), 0.5% Triton X‐100 and 2% normal donkey serum. Sections labeled for ChAT were coverslipped in Vectashield Vibrance Antifade Mounting Media (Vector Laboratories Cat#H‐1700, Burlingame, CA) and sections labeled for VAChT were coverslipped in Prolong Gold Antifade Mountant (Thermo Fisher Scientific, Waltham, MA) and stored at 4°C until imaging.
Coronal sections including the BF, BLA and hippocampus were also stained for acetylcholinesterase (ACHE) activity. As described previously, sections were incubated in a solution of 0.2 M Tris maleate buffer (pH 5.7), 0.1 M sodium citrate, 0.03 M cupric sulfate, 5 mM potassium ferricyanide, and 1.7 mM acetylthiocholine iodide for ~60 min at room temperature followed by a 70% ethanol rinse and coverslipping.48, 49
Tryon S.C., Sakamoto I.M., Kaigler K.F., Gee G., Turner J., Bartley K., Fadel J.R, & Wilson M.A. (2023). ChAT::Cre transgenic rats show sex‐dependent altered fear behaviors, ultrasonic vocalizations and cholinergic marker expression. Genes, Brain, and Behavior, 22(1), e12837.
Publication 2023
Acetylcholinesterase Acetylcholine Transporters, Vesicular acetylthiocholine iodide Alexa Fluor 555 Alexa Fluor 647 Amygdaloid Body Anti-Antibodies Basal Forebrain Brain Buffers Choline O-Acetyltransferase Cholinergic Agents Cloning Vectors Cold Temperature Edetic Acid Equus asinus Ethanol Fluorescent Antibody Technique Glycol, Ethylene Goat Gold Isoflurane maleate Molecular Probes paraform Perfusion Phosphates potassium ferricyanide Rattus Seahorses Serum Sodium Citrate Sucrose Sulfate, Copper Triton X-100 Tromethamine
3
Quantitative Analysis of ChAT Transcripts
For assessment of 82-kDa ChAT transcript, total RNA was extracted from basal forebrain using Aurum Total RNA Fatty and Fibrous Tissue Kit (BioRad). Subsequently, cDNA was prepared using iScript gDNA Clear cDNA Synthesis Kit according to the manufacturer’s instructions. Quantitative PCR was performed on a BioRad CFX Connect System using SsoAdvanced Universal SYBR Green Supermix (BioRad) and primers specific for the ChAT M-transcript (forward: CAACGAGGACGAGCGTTTG, reverse: GGTTGGTGGAGTCTTTCACGAG, amplicon size:101 bp). For each group and genotype, four male and four female mice were used. Samples were run in triplicate and average Ct was used to calculate ΔCt and subsequently ΔΔCt for fold change analysis. GAPDH was used as a reference gene and statistical analysis was performed based on ΔCt values.
PCR arrays probing aging pathways (84 genes, 5 reference genes and 7 controls) were performed on 3- and 18-month old mice with an n = 3 mice/sex/genotype/age. Cerebral cortex tissues were homogenized using a hand-held homogenizer and total RNA extracted using the RNeasy Plus Mini Kit (Qiagen, 74134). To synthesize cDNA, the RT2 First Strand Kit (Qiagen, 330404) and RNase-Free DNase kit (Qiagen, 79254) were used to eliminate genomic DNA contamination. PCR reactions were performed using RT2 SYBR Green qPCR master mix (Qiagen, 330503) and RT2 Profiler PCR Array Kit for Aging (PAMM-178Z) according to manufacturer’s instructions on a BioRad CFX Connect System. Analysis of gene expression data was performed using Qiagen’s online platform (RT2 Profiler PCR Arrays & Assays Data Analysis software (https://geneglobe.qiagen.com/ca/analyze). All genes were normalized to a minimum of three reference genes. Data showing at least a twofold change with a p-value ≤ 0.05 were considered significant.
AlQot H.E, & Rylett R.J. (2023). A novel transgenic mouse model expressing primate-specific nuclear choline acetyltransferase: insights into potential cholinergic vulnerability. Scientific Reports, 13, 3037.
Publication 2023
Anabolism ARID1A protein, human Basal Forebrain Biological Assay Cortex, Cerebral Deoxyribonuclease I DNA, Complementary DNA Contamination Endoribonucleases Females Fibrosis GAPDH protein, human Gene Expression Profiling Genes Genome Genotype Males Mice, Laboratory Oligonucleotide Primers SYBR Green I Tissues
4
MRI Protocol for Pediatric Brain Imaging
For all MR image acquisition, children under 4 years of age were scanned during natural and non-sedated sleep and older children were imaged whilst watching a movie or other video. Our imaging protocol included relaxometry, multi-shell diffusion, resting-state connectivity, and magnetic resonance spectroscopy acquisitions in addition to the anatomical data. As a result, depending on child compliance (sleeping and/or motion), high quality anatomical data were not collected or available for every child at every scan time-point. Following data acquisition, scans were inspected to ensure there were no motion-related artifacts and image blurring and ghosting. T1-weighted anatomical data were acquired on a 3T Siemens Trio scanner with a 12-channel head RF array. T1-weighted magnetization-prepared rapid acquisition gradient echo anatomical data were acquired with an isotropic voxel volume of 1.2×1.2×1.2mm3 , resampled to 0.9×0.9×0.9mm3 . Sequence specific parameters were: TE = 6.9 ms; TR = 16 ms; inversion preparation time = 950 ms; flip angle = 15 degrees; BW = 450 Hz/Pixel. The acquisition matrix and field of view were varied according to child head size in order to maintain a constant voxel volume and spatial resolution across all ages41 (link). Using a multistep registration procedure42 (link), a series of age-specific anatomical T1-weighted templates were created corresponding to 3, 6, 9, 12, 15, 18, 21, 24, 30, 36, 42, 48, 60, 72, 84, 96 and 108-month ages. At least 10 females and 10 males were included in each template. An overall study template was then created from these age templates, which was aligned to the MNI152 template43 (link). Each child’s anatomical T1-weighted image was transformed into MNI space by first aligning to their age-appropriate template and then applying the pre-computed transformation to MNI space, with the calculated individual forward and reverse transformations saved and used for the volumetric analysis described below. All template creation and image alignment were performed using a 3D nonlinear approach44 (link) with cross-correlation and mutual information cost functions. We then applied the Desikan-Killiany-Tourville (DKT) cortical labeling protocol, FreeSurfer’s wmparc and aseg non-cortical (plus white matter) labels through Mindboggle45 (link),46 (link), resulting in volumetric output from 96 brain regions. Five regions with very small volumes were excluded: left inferior lateral ventricle, left vessel, right inferior lateral ventricle, left basal forebrain, and right basal forebrain.
Zhou Y., Müller H.G., Zhu C., Chen Y., Wang J.L., O’Muircheartaigh J., Bruchhage M, & Deoni S. (2023). Network evolution of regional brain volumes in young children reflects neurocognitive scores and mother’s education. Scientific Reports, 13, 2984.
Publication 2023
Basal Forebrain Blood Vessel Brain Child Cortex, Cerebral Diffusion ECHO protocol Females Head Inversion, Chromosome Left Ventricles Magnetic Resonance Spectroscopy Males Radionuclide Imaging TRIO protein, human Ventricles, Right White Matter
5
PET-based Neuroinflammation Quantification Methodology
Figure 1 provides a schematic overview of the PET data processing pipeline. Data were first be reconstructed into shorter images (<5‐min) to facilitate any required realignment to correct for motion. After the images were motion‐corrected, SUV images were calculated based on injection activity and patient weight. SUV images were then registered to the patient's corresponding MR image using ANTs rigid transformation algorithm (Avants et al., 2011 (link)). Participant‐specific MR images were used for region‐of‐interest (ROI) segmentation using the AssemblyNet segmentation framework (Coupé et al., 2020 (link)). ROIs included for regional SUV quantification were the frontal, occipital, and temporal whole‐cortex ROIs, and further granular segmentation of the accumbens, amygdala, basal forebrain, brainstem, caudate, cerebellum (used as reference), cingulate, entorhinal, hippocampus, insula, pallidum, parahippocampus, putamen, thalamus, ventral DC, ventricle, and cortical white matter. Given the spatial resolution of PET imaging overall, the use of larger, more generalized ROIs is better‐suited for quantification of PET uptake/binding. Reconstructed PET full width at half maximum (FWHM) image resolution is ~4 mm isotropic, and many of the granular parcellations composing the entire AssemblyNet ROIs are in the order of a few cm3, increasing probability of spillover and partial volume effects that may lead to the inaccurate quantification of these smaller ROIs. Furthermore, since this was a proof‐of‐concept study, in the absence of pre‐existing data, we first hypothesized microglial activation would be dispersed across the whole brain given the systemic nature of cancer survivors' symptomatology. Thus, any choice of specific granular regions (outlined above) was based on elevated binding evident across other neurological diseases (discussed further in Section 4). A whole‐brain analysis was also conducted. SUV maps were generated by normalizing voxel‐wise SUV to the cerebellum, a previously published pseudo‐reference region (Lyoo et al., 2015 (link)). TSPO PET studies examining mild cognitive impairment, stroke, and Alzheimer's disease patients have used the cerebellum as reference because this region has shown to be relatively unaffected by disease pathology such as neuroinflammation, and spared the effects of brain lesion, diaschisis and/or neurodegeneration (Braak & Braak, 1991 (link); Gerhard et al., 2005 (link); Gulyas et al., 2012 (link); Lyoo et al., 2015 (link); Mattiace et al., 1990 (link); Morris et al., 2018 (link); Price et al., 2006 (link); Wood, 2003 ), making it a clinically meaningful reference region for this type of study. Many studies with [11C]‐PBR28 utilize dynamic scans and carry out kinetic modeling using an input function derived from collection of serial arterial blood samples. Arterial cannulation is invasive and complicates measurement. Kinetic modeling with arterial blood sampling generally leads to high variability because of the difficulty of the method. Several studies have shown that simpler non‐invasive approaches utilizing SUV or SUVR may be sensitive to changes in TSPO levels (Lyoo et al., 2015 (link)). In the proposed study, we found no significant difference in TSPO genotype between the two groups investigated (cancer survivors vs. matched healthy controls), confirming the rigor of our findings using SUVR.
Schoenberg P.L., Song A.K., Mohr E.M., Rogers B.P., Peterson T.E, & Murphy B.A. (2023). Increased microglia activation in late non‐central nervous system cancer survivors links to chronic systemic symptomatology. Human Brain Mapping, 44(17), 6001-6019.
Publication 2023
Alzheimer's Disease Amygdaloid Body Ants Arteries Basal Forebrain Brain Brain Stem BZRP protein, human Cancer Survivors Cannulation Cerebellum Cerebral Ventricles Cerebrovascular Accident Cognitive Impairments, Mild Cortex, Cerebral Diaschisis Genotype Globus Pallidus Insula of Reil Kinetics Microglia Microtubule-Associated Proteins Muscle Rigidity Nerve Degeneration Nervous System Disorder Pathologic Processes Patients Putamen Radionuclide Imaging Seahorses Specimen Collections, Blood Temporal Lobe Thalamus White Matter

Top products related to «Basal Forebrain»

1
Goat anti chat by Merck Group
Sourced in United States
Goat anti-ChAT is a polyclonal antibody raised in goats against the choline acetyltransferase (ChAT) protein. ChAT is an enzyme responsible for the synthesis of the neurotransmitter acetylcholine. This antibody can be used to detect and quantify the presence of ChAT in various biological samples and can be a useful tool for research on cholinergic neurons and neurotransmission.
2
Nickel enhanced diaminobenzidine by Merck Group
Sourced in United States
Nickel-enhanced diaminobenzidine is a chemical reagent used in immunohistochemistry and other biological applications. It is a modified version of the diaminobenzidine (DAB) stain, with the addition of nickel to enhance the color contrast of the reaction product.
3
Rabbit anti trka by Merck Group
Sourced in Canada
Rabbit anti-TrkA is a primary antibody that specifically binds to the TrkA receptor, a receptor tyrosine kinase involved in neuronal signaling. It is commonly used in research applications for the detection and analysis of TrkA expression in various biological samples.
4
Mouse anti p75ntr by Merck Group
Mouse anti-p75NTR is a laboratory reagent used for the detection and analysis of the p75 neurotrophin receptor (p75NTR) protein in various biological samples. p75NTR is a transmembrane receptor that plays a role in neuronal survival, differentiation, and death. This antibody can be used in techniques such as Western blotting, immunohistochemistry, and flow cytometry to study the expression and localization of p75NTR in cells and tissues.
5
Ds riz scope by Nikon
Sourced in United States
The DS-RiZ scope is a digital imaging microscope designed for laboratory use. It features a high-resolution camera sensor and advanced optics that provide clear, detailed images of microscopic specimens. The core function of the DS-RiZ is to enable precise observation and documentation of samples for scientific and research applications.
6
Nis elements ar46 by Nikon
Sourced in United States
NIS Elements AR46 is a software package designed for image acquisition, processing, and analysis in microscopy applications. It provides a comprehensive platform for managing and analyzing digital images acquired from a variety of microscope systems.
7
Vectastain abc kit by Vector Laboratories
Sourced in United States, Canada, United Kingdom, Germany, Japan, France
The Vectastain ABC kit is a product by Vector Laboratories that is used for the detection of specific target antigens in tissue or cell samples. The kit includes reagents necessary for the avidin-biotin complex (ABC) method of immunohistochemistry. The core function of the Vectastain ABC kit is to provide a reliable and sensitive tool for the visualization of target molecules within a sample.
8
Mouse anti brdu by Merck Group
Sourced in United States
The Mouse anti-BrdU is a laboratory reagent used to detect the incorporation of the synthetic nucleoside bromodeoxyuridine (BrdU) into cellular DNA during DNA synthesis. It is a primary antibody that specifically binds to BrdU, allowing the visualization and quantification of cell proliferation through various immunodetection techniques.
9
Normal serum by MP Biomedicals
Sourced in United States
Normal serum is a laboratory reagent used as a control substance in various biochemical and immunological analyses. It serves as a reference standard to validate the accuracy and reliability of test results. Normal serum is typically derived from pooled human or animal sources and undergoes rigorous quality control measures to ensure consistent composition and performance.
10
Biotinylated secondary antibody by Vector Laboratories
Sourced in United States, United Kingdom, Germany, Canada, Italy, Norway
Biotinylated secondary antibody is a laboratory reagent used in various immunoassay techniques. It serves as a detection tool, binding to the primary antibody to amplify the signal and enhance the visualization of target molecules.

More about "Basal Forebrain"

The Basal Forebrain is a complex brain region located at the base of the forebrain, playing a crucial role in various cognitive and behavioral processes.
It comprises structures such as the Septal Nuclei, Diagonal Band of Broca, Nucleus Basalis of Meynert, and the Substantia Innominata.
This region is involved in functions like attention, learning, memory, and sleep-wake regulation.
Researchers studying the Basal Forebrain often focus on understanding its neuroanatomy, neurochemistry, and its involvement in neurological and psychiatric disorders, such as Alzheimer's disease, Parkinson's disease, and schizophrenia.
Exploring the power of PubCompare.ai can help optimize Basal Forebrain research by locating the most reproducible and accurate protocols from literature, preprints, and patents using AI-driven comparisons, enhancing research accuracy and reproducibility.
Key techniques used in Basal Forebrain research include Goat anti-ChAT (a marker for cholinergic neurons), Nickel-enhanced diaminobenzidine (for visualization of immunohistochemical staining), Rabbit anti-TrkA and Mouse anti-p75NTR (for studying neurotrophic factor signaling), and the DS-RiZ scope and NIS Elements AR46 software for imaging and analysis.
The Vectastain ABC kit and Mouse anti-BrdU can be used for proliferation studies, while Normal serum and Biotinylated secondary antibody are common reagents in immunohistochemistry protocols.
By incorporating these techniques and resources, researchers can gain deeper insights into the structure, function, and pathologies associated with the Basal Forebrain, ultimately advancing our understanding of this critical brain region and its role in cognition and neurological disorders.
PubCompare.ai can be a valuable tool in this endeavor, helping to identify the most reliable and effective protocols from the scientific literature.