Log In Sign up
The largest database of trusted experimental protocols
> Anatomy > Body Part > Head Kidney

Head Kidney

The head kidney, also known as the pronephros, is a vital organ found in the early developmental stages of vertebrates.
It serves as a precursor to the definitive kidney and plays a crucial role in the excretory and endocrine systems.
The head kidney is responsible for filtration, osmoregulation, and the production of hormones that regulate various physiological processes.
Its study is essential for understanding the evolution and development of the urinary system in vertebrates.
However, research in this field can be challenging due to the complexity of protocols and the need for accurate, reproducible findings.
PubCompare.ai offers an AI-driven solution to optimize head kidney research by enabling researchers to locate, analyze, and compare protocols from literature, pre-prints, and patents.
This tool can help identify the most reliable and effective protocols, accelerating discoveries and unlocking new insights in the field of head kidney studies.

Most cited protocols related to «Head Kidney»

1
Cytogenetic Analysis of H. obliquidens
We analyzed ninety-six specimens of H. obliquidens (46 males, 33 females and 17 of undetermined sex) obtained from the aquarium trade in Botucatu, SP, Brazil (Table 1). The animal experiments were performed with the approval of the appropriate ethics committee of UNESP - São Paulo State University. Metaphase chromosomes were obtained from cells of the anterior kidney following in vivo treatment with colchicine at 0.025% (1 ml/100 g of body weight) according to the air-drying method [59 ]. Heterochromatin was identified by C-banding [60 (link)], and the nucleolus organizer regions (NORs) were visualized by silver nitrate staining [61 (link)]. Chromosomes were classified as meta/submetacentric (m/sm) and subtelo/acrocentric (st/a), and were organized by decreasing order of size in the karyotype. Meiotic cells from testes were obtained as described by Kligerman and Bloom [62 ].
Poletto A.B., Ferreira I.A, & Martins C. (2010). The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies. BMC Genetics, 11, 1.
Full text: Click here
Publication 2010
Body Weight Cells Chromosomes Colchicine Ethics Committees Females Germ Cells Head Kidney Heterochromatin Karyotype Males Metaphase Nucleolus Organizer Region Testis
2
Viral RNA Quantification in CMS Outbreaks
Reverse transcription quantitative PCR (RT-qPCR) for quantification of viral PRV RNA in CMS field samples was performed as described earlier [14 (link)] using the minor groove binding (MGB) assay targeting the L1 genomic fragment. PRV RNA in head kidney and heart from 21 fish from four outbreaks of CMS was quantified and compared to assumed healthy farmed fish.
Samples from challenged fish and controls were obtained from 'Challenge group 1' described in a previous publication [10 (link)]. Briefly, 100 unvaccinated wild strain Atlantic salmon were intraperitoneally (i.p.) injected with 200 μl supernatant of tissue homogenate mix from six CMS diagnosed fish. Samples of heart, head kidney, spleen and liver were taken from 5 fish every third week 0 to 36 wpc (weeks post challenge), and directly frozen at -80°C. Total RNA was isolated using the RNeasy Mini Kit (QIAGEN AB). Each PRV RT-qPCR run contained 100 ng RNA in a volume of 12.5 μl and the PCR protocol for detection of PRV described in Palacios et al. [14 (link)] was used. Head kidney samples were also screened for the presence of IPNV (Infectious Pancreatic Necrosis Virus), SPDV (Salmon Pancreas Disease Virus) and nodavirus by RT-qPCR. The fish cultivation and research facilities were located in an area geographically separated from the endemic area of CMS in Norway.
A real-time PCR assay was designed for the totivirus found in the 454 sequence database. A protocol identical to the one described above was used with forward primer TTCCAAACAATTCGAGAAGCG, reverse primer ACCTGCCATTTTCCCCTCTT and the MGB probe CCGGGTAAAGTATTTGCGTC (all written in 5'-3' direction; Applied Biosystems, Life Technologies Corporation, Carlsbad, California, USA). The assay was used qualitatively to test both a panel of CMS outbreaks, control samples and fish from the experimental transmission.
Løvoll M., Wiik-Nielsen J., Grove S., Wiik-Nielsen C.R., Kristoffersen A.B., Faller R., Poppe T., Jung J., Pedamallu C.S., Nederbragt A.J., Meyerson M., Rimstad E, & Tengs T. (2010). A novel totivirus and piscine reovirus (PRV) in Atlantic salmon (Salmo salar) with cardiomyopathy syndrome (CMS). Virology Journal, 7, 309.
Full text: Click here
Publication 2010
Biological Assay Disease Outbreaks Fishes Freezing Genome Head Kidney Heart Infectious pancreatic necrosis virus Liver Oligonucleotide Primers Real-Time Polymerase Chain Reaction Reverse Transcription RNA, Viral Salmon pancreas disease virus Salmo salar Spleen Strains Tissues Totivirus Transmission, Communicable Disease
3
Viral Diagnostic Discriminator for Farmed Salmon
Samples of dying farmed salmon were made available from the Fisheries and Ocean Canada regulatory farm audit program. These samples are collected to monitor background losses in production populations, to detect ongoing or recent health events within the industry, and to ensure reporting compliance with OIE (World Organization of Animal Health) listed diseases. Farm audit samples are collected on randomized BC farms, with one to six fresh silver (recently dead) fish sampled per farm audit in 2011–13. At the time of collection, clinical and environmental data are noted, and tissue samples are taken for histopathology, bacterial and viral culture and molecular analysis. Veterinary diagnostics were conducted on these samples prior to our application of the VDD, and were based largely on histopathology and clinical data. Our team had already conducted quantitative molecular analyses of 45 infectious agents known or suspected to cause disease in salmon on cDNA/DNA from combined tissues (heart, liver, head and anterior kidney, gill, pyloric caeca, spleen), so the backdrop of known infectious agents was determined for each sample. The VDD biomarkers were applied on this same cDNA from 240 farmed Atlantic salmon and 68 farmed Chinook salmon collected from 2011 to 2013 (Table 1C). We utilized these data to assess the ability of the VDD to discriminate fish experiencing viral- versus bacterial- or parasite-induced diseases based on tissue pools.
Miller K.M., Günther O.P., Li S., Kaukinen K.H, & Ming T.J. (2017). Molecular indices of viral disease development in wild migrating salmon. Conservation Physiology, 5(1), cox036.
Full text: Click here
Publication 2017
Animals Bacteria Biological Markers Cecum Diagnosis DNA, Complementary Fishes Gills Head Head Kidney Heart Infection Liver Oncorhynchus tshawytscha Parasitic Diseases Population Group Pylorus Salmo salar Silver Spleen Tissues
4
Pathogen-Specific Immunoglobulin Binding Assay
To assess whether infected and survivor fish had generated pathogen-specific immunoglobulins, we measured the capacity of IgT, IgM and IgD from serum, gill mucus or tissue (gill, spleen and head kidney) explant supernatants to bind to Ich using a pull-down assay previously described by us9 (link). In short, parasites (∼100 tomonts) were preincubated with a solution of 0.5% BSA in PBS (pH 7.2) for 2 h at 4 °C. Thereafter, parasites were incubated with diluted gill mucus or serum or tissue (gill, head kidney and spleen) explant supernatants from infected, survivor or control fish for 2 h at 4 °C in a 300 μl volume. Dilutions were made with PBS containing 0.5% BSA (pH 7.2). After incubation, the tomonts were washed with PBS, and bound proteins were eluted with Laemmli Sample Buffer (Bio-Rad) and boiled for 5 min at 95 °C. The eluted material was resolved on 4–15% SDS–PAGE Ready Gel under non-reducing conditions, and the presence of IgT, IgM or IgD was detected by western blotting using the anti-trout IgT, IgM or IgD antibodies as described above. Original images of the western blot analyses are shown in Supplementary Fig. 11.
Xu Z., Takizawa F., Parra D., Gómez D., von Gersdorff Jørgensen L., LaPatra S.E, & Sunyer J.O. (2016). Mucosal immunoglobulins at respiratory surfaces mark an ancient association that predates the emergence of tetrapods. Nature Communications, 7, 10728.
Full text: Click here
Publication 2016
Antibodies Biological Assay Fishes Gills Head Kidney Immunoglobulins Laemmli buffer Mucus Parasites Pathogenicity Proteins SDS-PAGE Serum Spleen Survivors Technique, Dilution Tissues Trout Western Blot
5
Comprehensive Survey of Teleost MHCI Genes
A mixture of annotated and un-annotated MHCI sequences were identified using Ensembl’s Biomart and the GO/IPR term for class I (GO: 0042613/ IPR001039) supplemented with various blastN and TblastN searches of Ensembl and NCBI databases using evolutionary diverged as well as species-specific sequences. It should be noted that the analysed genomic databases from cavefish (Astyanax mexicanus, AstMex102), zebrafish (Danio rerio ZV9), medaka (Oryzias latipes, Medaka1), platyfish (Xiphophorus maculatus, Xipmac4.4.2), tilapia (Oreochromis niloticus, Orenil 1.0), stickleback (Gasterosteus aculatus, BROAD S1), fugu (Takifugu rubripes, Fugu4.0) and tetraodon (Tetraodon nigroviridis, Tetraodon8.0), Atlantic salmon (Salmo salar, AGKD00000000.3), Atlantic cod (Gadus morhua, NCBI GadMor_May2010) and spotted gar (Lepisosteus oculatus, Ensembl LepOcu1) each represent one or a limited number of animals so more genes or other alleles may exist in other haplotypes/ animals. Potential genomic assembly errors would also influence our analyses. For Atlantic salmon, we supplemented the 12 known Atlantic salmon MHCI genes [29 (link)] with blastN and TblastN searches using preliminary salmon genome sequences available at either cGRASP [85 ] or NCBI [86 ]. Open reading frames were predicted using GenScan [87 (link)], Fgenesh [88 (link)] and Augustus [89 (link)] and/or by aligning with expressed sequences using Spidey [90 (link)]. Some smaller pseudogene remnants that did not contribute to evolutionary understanding were neglected. Expressed match was either identified through TblastN search against EST resources using MHCI alpha 3 domains or when this approach was negative expressed match was sought using the entire coding sequence in GenBank nucleotide (cDNA) and subsequently available TSA/SRA resources. The transcriptome (TSA/SRA) accession numbers used are as follows: tetraodon (Brain: SRX191169), fugu (Testis: SRX363280, gills: SRX363279, liver: SRX362038, various organs: SRX189142, SRX188889 and SRX188888), Atlantic cod (eggs: SRX148753, brain: SRX148752, head kidney: SRX148751, liver: SRX148750, hind gut: SRX148749, gonad: SRX148748, spleen: SRX148740), stickleback (brain: SRX146601), cavefish (surface fish: SRX212200, Pachon cavefish: SRX212201) and African lungfish SRX152529. The Z lineage sequence identified in spotted gar (Lepisosteus oculatus) derive from individual brain transcriptome reads (SRX543528) assembled using the CAP3 [91 ] program. The sturgeon Z lineage alpha 1 domain sequence is assembled from near identical genomic reads primarily from the sturgeon species Acipenser persicus (SRA dataset ERX145719; ERR169830.1125422.1) with a 14 bp gap filled using a Acipenser baerii sequence (SRA dataset ERX145721; ERR169832.3958173.2). The sturgeon alpha 2 domain sequence is assembled from the near identical sequences primarily from Acipenser persicus (SRA dataset ERX145719; ERR169830.5438448.1, ERR169830.5438448.2, and ERR169830.5083693.2), with a 10 bp gap filled using a Acipenser gueldenstaedtii sequence (SRA dataset ERX145720 sequence ERR169831.3185933.1). Three dimensional structures were aligned against the HLA-A2 structure using the Swiss PDB-viewer [92 (link),93 ].
Grimholt U., Tsukamoto K., Azuma T., Leong J., Koop B.F, & Dijkstra J.M. (2015). A comprehensive analysis of teleost MHC class I sequences. BMC Evolutionary Biology, 15, 32.
Full text: Click here
Publication 2015
Alleles Animals Biological Evolution Brain DNA, Complementary Eggs Fishes Gadus morhua Genes Genome Gills Gonads Haplotypes Head Kidney HLA-A2 Antigen Liver Negroid Races Open Reading Frames Oreochromis niloticus Oryzias latipes Oryziinae Platyfish Pseudogenes Salmo salar Spleen Sticklebacks Takifugu Takifugu rubripes Testis Tilapia Transcriptome Xiphophorus Zebrafish

Most recents protocols related to «Head Kidney»

1
Nodavirus Challenge in Asian Seabass
Healthy Asian seabass juveniles (6-8 g) were divided into two groups (n=20/group) for the nodavirus challenge. Each group of fish were kept in 200L of 30 ± 1°C UV-irradiated seawater recirculation tanks equipped with a standard biofiltration system and aeration. Experimental fish were exposed to a 12:12 light and dark photoperiod cycle throughout the challenge. The challenge group was immersed in PBS containing 107 TCID50/ml of RGNNV (19 (link)) for 15 minutes. The control group was immersed in PBS alone. Control and challenged animals were sacrificed (n=6/group) at 24 h and 48 h post-treatment and the spleen, gill, skin, head kidney and intestine tissue of individual fish were collected for RNA extraction. As described above, the expression profiles of ASB IgT mRNA in different tissues were amplified with IgT primers and normalized against 18S RNA gene. IgT fold change was quantitated using the 2- ΔΔCT method. All experiments were conducted in triplicate. On day 14, gill and intestine tissues of infected and control fish were harvested for determination of total IgT and NNV-specific IgT and IgM. The intestine was opened longitudinally and rinsed with PBS three times to remove the faeces. Gill arches were excised and rinsed with PBS three times. The gill and intestine were resuspended in 200 ul of PBS and subsequently lysed using a tissue homogenizer. Tissue lysates were spun down at 10000 rpm for 10 min before the collection of supernatants for IgT ELISA.
Chan J., Carmen L.C., Lee S.Q, & Prabakaran M. (2023). Identification and characterization of immunoglobulin tau (IgT) in Asian Seabass (Lates calcarifer) and mucosal immune response to nervous necrosis virus. Frontiers in Immunology, 14, 1146387.
Full text: Click here
Publication 2023
Animals Asian Persons Enzyme-Linked Immunosorbent Assay Feces Fishes Genes Gills Head Kidney Intestines Light Oligonucleotide Primers RNA, Messenger RNA, Ribosomal, 18S Serranidae Skin Spleen Tissues
2
Cloning and Characterization of Seabass IgT
Healthy Asian seabass were euthanized with an overdose of Tricaine methane-sulfonate (MS-222) and the head kidney, gills and intestine were harvested and homogenized immediately in TRIzol reagent (Invitrogen, Carlsbad, CA, USA) for RNA extraction. Total RNA was isolated in accordance with the manufacturer’s instructions. The concentrations of RNA were adjusted to 2 µg and reverse transcribed to cDNA using AMV Reverse Transcriptase according to the manufacturer’s instructions (Promega). IgT primers (Table S1) were designed based on IgT heavy chain conserved regions obtained through BLAST alignment of IgT amino acid sequences of Dicentrarchus labrax (Accession Number KM410929), Oncorhynchus mykiss (Accession number AY870263), Sparus aurata (Accession Number KX599200), Siniperca chuatsi (DQ16660) and Larimichthys crocea (Accession Number MW450786) retrieved from NCBI GenBank. The full-length cDNA sequence was amplified and ligated into pJET 1.2 CloneJET PCR cloning kit (Thermo Fisher Scientific, Waltham, MA, USA). Following transformation into competent Escherichia coli (E. coli) XL1-Blue cells, positive clones were screened by ampicillin selection, colony PCR and sequenced.
Chan J., Carmen L.C., Lee S.Q, & Prabakaran M. (2023). Identification and characterization of immunoglobulin tau (IgT) in Asian Seabass (Lates calcarifer) and mucosal immune response to nervous necrosis virus. Frontiers in Immunology, 14, 1146387.
Full text: Click here
Publication 2023
Amino Acid Sequence Ampicillin Asian Persons Cells Clone Cells Dicentrarchus DNA, Complementary Drug Overdose Escherichia coli Gills Head Kidney Intestines methanesulfonate MS-222 Oligonucleotide Primers Oncorhynchus mykiss Promega RNA-Directed DNA Polymerase Serranidae Sparus aurata tricaine trizol
3
Quantifying LEAP Expression in Rainbow Trout
Four healthy rainbow trout and grass carp were anesthetized with MS222 (1:10000), then the blood was removed from the body by cardiac perfusion using phosphate-buffered saline (PBS; pH 7.4; Gibco). The head kidney, spleen, gut, gill, skin, liver, heart, and muscle were collected, and the total RNA was extracted using the TRIzol Reagent (Takara). The cDNA was synthesized using the PrimeScript™ RT Reagent Kit contains gDNA Eraser (Takara). The mRNA expression levels of LEAPs were detected by quantitative real-time PCR (qPCR) using the CFX Connect™ Real-Time System (Bio-Rad). The primers used are listed in Table 2. The reaction mixture (20 μl) contained 1 μl cDNA, 10 μl SsoAdvanced™ SYBR Green Supermix (Bio-Rad), 1 μl forward primer (10 μM each) and 1 μl reverse primer (10 μM each). The amplification program was as follows: 95°C for 5 min, 45 cycles of amplification (95°C for 5 s and 60°C for 30 s), and then 65°C for 5 s. The tissue expression levels of LEAPs were determined using 2−ΔCt method with β-actin as the internal reference.
Liu X., Hu Y.Z., Pan Y.R., Liu J., Jiang Y.B., Zhang Y.A, & Zhang X.J. (2023). Comparative study on antibacterial characteristics of the multiple liver expressed antimicrobial peptides (LEAPs) in teleost fish. Frontiers in Immunology, 14, 1128138.
Full text: Click here
Publication 2023
Actins BLOOD DNA, Complementary Gills Grass Carp Head Kidney Heart Human Body Liver Muscle Tissue Oligonucleotide Primers Oncorhynchus mykiss Perfusion Phosphates Real-Time Polymerase Chain Reaction RNA, Messenger Saline Solution Skin Spleen SYBR Green I Tissues trizol
4
Isolation of Tilapia Leukocytes

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2023
Acceleration Cells Centrifugation Centrifugation, Density Gradient Deceleration Head Kidney Leukocytes Lymphocyte Nylons Percoll Spleen Tilapia Tissues
5
Nile Tilapia Transcriptome Analysis

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2023
Actins BLOOD DNA, Complementary Gene Expression Genes Gills Head Kidney Intestines Kidney Liver Oligonucleotide Primers Oreochromis niloticus Reverse Transcription RNA, Messenger Spleen trizol

Top products related to «Head Kidney»

1
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
2
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
3
Ms 222 by Merck Group
Sourced in United States, Germany, Spain, China, United Kingdom, Sao Tome and Principe, France, Denmark, Italy, Canada, Japan, Macao, Belgium, Switzerland, Sweden, Australia
MS-222 is a chemical compound commonly used as a fish anesthetic in research and aquaculture settings. It is a white, crystalline powder that can be dissolved in water to create a sedative solution for fish. The primary function of MS-222 is to temporarily immobilize fish, allowing for safe handling, examination, or other procedures to be performed. This product is widely used in the scientific community to facilitate the study and care of various fish species.
4
Rnalater by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, Japan, Lithuania, Italy, Australia, Canada, Denmark, China, New Zealand, Spain, Belgium, France, Sweden, Switzerland, Brazil, Austria, Ireland, India, Netherlands, Portugal, Jamaica
RNAlater is a RNA stabilization solution developed by Thermo Fisher Scientific. It is designed to protect RNA from degradation during sample collection, storage, and transportation. RNAlater stabilizes the RNA in tissues and cells, allowing for efficient RNA extraction and analysis.
5
Trizol by Thermo Fisher Scientific
Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Spain, Australia, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines
TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.
6
Percoll by GE Healthcare
Sourced in United States, Sweden, United Kingdom, Germany, Canada, Japan, Denmark, Switzerland, Italy, Australia, Spain, Norway, Belgium, Macao
Percoll is a colloidal silica-based medium used for cell separation and gradient centrifugation. It is designed to provide a density gradient for the isolation and purification of cells, organelles, and other biological particles.
7
L 15 medium by Thermo Fisher Scientific
Sourced in United States, China, Belgium, United Kingdom, Germany, Netherlands
L-15 medium is a cell culture medium designed for the optimal growth and maintenance of various cell types. It provides a balanced formulation of amino acids, vitamins, salts, and other essential nutrients required for cell proliferation and viability. The medium is intended for use in a wide range of cell culture applications, such as routine cell line maintenance, transfection studies, and other in vitro experiments.
8
Leibovitz s l 15 medium by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Italy, France, Canada, Switzerland, Japan, Australia, Spain
Leibovitz's L-15 medium is a cell culture medium formulated by John Leibovitz. It is designed to support the growth and maintenance of various cell types in an atmosphere without added carbon dioxide. The medium provides the necessary nutrients and osmotic environment for cell proliferation and survival.
9
Poly 1 c by Merck Group
Sourced in United States, Germany, United Kingdom, France, China, Switzerland, Canada, Sao Tome and Principe, Israel, Japan, Italy, Spain
Poly(I:C) is a synthetic double-stranded RNA (dsRNA) molecule that mimics the structure of viral RNA. It is used as a research tool in various applications, such as the study of innate immune responses and the development of antiviral therapies. Poly(I:C) can activate specific cellular pathways and signaling cascades, making it a valuable reagent for in vitro and in vivo experiments.
10
Penicillin by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, France, Canada, Japan, Australia, Switzerland, Italy, Israel, Belgium, Austria, Spain, Brazil, Netherlands, Gabon, Denmark, Poland, Ireland, New Zealand, Sweden, Argentina, India, Macao, Uruguay, Portugal, Holy See (Vatican City State), Czechia, Singapore, Panama, Thailand, Moldova, Republic of, Finland, Morocco
Penicillin is a type of antibiotic used in laboratory settings. It is a broad-spectrum antimicrobial agent effective against a variety of bacteria. Penicillin functions by disrupting the bacterial cell wall, leading to cell death.

More about "Head Kidney"

Discover the vital role of the head kidney, also known as the pronephros, in vertebrate development and physiology.
This essential organ serves as a precursor to the definitive kidney and plays a crucial part in the excretory and endocrine systems.
Its filtration, osmoregulation, and hormone production functions are essential for understanding the evolution and growth of the urinary system.
Researchers studying the head kidney face complex protocols and the need for accurate, reproducible findings.
PubCompare.ai offers an AI-driven solution to optimize this research by enabling you to locate, analyze, and compare protocols from literature, pre-prints, and patents.
Leverage this tool to identify the most reliable and effective protocols, accelerating your discoveries and unlocking new insights.
Enhance your head kidney studies with essential research tools and reagents like TRIzol for RNA extraction, FBS for cell culture, MS-222 for anesthesia, RNAlater for sample preservation, Percoll for cell separation, and L-15 medium (also known as Leibovitz's L-15 medium) for cell culture.
Explore the use of immune modulators like Poly(I:C) and maintain cell health with antibiotics like Penicillin.
By combining the power of PubCompare.ai with these essential research tools, you can unlock new breakthroughs in the field of head kidney studies.