Log In Sign up
The largest database of trusted experimental protocols
> Anatomy > Body Part > Muscle, Gastrocnemius

Muscle, Gastrocnemius

The muscle, gastrocnemius, is a large, powerful muscle located in the back of the lower leg.
It is primarily responsible for plantar flexion of the ankle joint, allowing for efficient locomotion and propulsion.
The gastrocnemius is composed of two heads, the medial and lateral, which originate from the posterior aspect of the femur and insert on the calcaneus via the Achilles tendon.
This muscle plays a crucial role in activities such as walking, running, and jumping, making it a key target for muscle and exercise research.
Understanding the anatomy, function, and biomechanics of the gastrocnmeius muscle can help optimize physical performance and prevent musculoskeletal injuries.

Most cited protocols related to «Muscle, Gastrocnemius»

1
Ultrastructural Analysis of Sciatic Nerve, Spinal Cord, and Muscle in TWI Mice
Postnatal day 30 (P30) TWI mice and their WT littermates (5 for each experimental group processed in 5 different experimental sessions, every TWI with its WT littermate) and one P15 TWI mouse versus its WT littermate were perfused with a fixative solution (4% paraformaldehyde and 0.1%–1%–2.5% glutaraldehyde in phosphate buffer, pH 7.4). Sciatic nerves, spinal cords and gastrocnemius muscles were dissected and post-fixed for 4 hours at room temperature in the same fixative solution.
Spinal cords were dissected in the lumbar region, isolating four 1-mm-thick sections in the lumbar enlargement region and the gastrocnemius muscles were cut in small portions, approximately 1 mm3 in volume. Sciatic nerves were processed without further sectioning.
The selected tissues were further treated for epoxy resin embedding as previously described43 . Briefly, the samples were deeper fixed in 2–2.5% glutaraldehyde in cacodylate buffer (0.1 M, pH 7.4). After rinsing, specimens were post-fixed with osmium tetroxide (1%)-potassium ferricyanide (1%) in cacodylate buffer, rinsed again, en bloc stained with 3% uranyl acetate in ethanol, dehydrated and embedded in epoxy resin, that was baked for 48 h at 60 °C. Thin sections were obtained with an ultramicrotome (UC7, Leica Microsystems, Vienna, Austria) and collected on G300Cu grids (EMS). Finally, sections were examined with a Zeiss LIBRA 120 plus transmission electron microscope equipped with an in-column omega filter.
Cappello V., Marchetti L., Parlanti P., Landi S., Tonazzini I., Cecchini M., Piazza V, & Gemmi M. (2016). Ultrastructural Characterization of the Lower Motor System in a Mouse Model of Krabbe Disease. Scientific Reports, 6, 1.
Full text: Click here
Publication 2016
Buffers Cacodylate Epoxy Resins Ethanol Fixatives Glutaral Hypertrophy Lumbar Region Mice, House Microtomy Muscle, Gastrocnemius Osmium Tetroxide paraform Phosphates potassium ferricyanide Sciatic Nerve Spinal Cord Tissues Transmission Electron Microscopy Ultramicrotomy uranyl acetate
2
Musculoskeletal Modeling for Gait Analysis

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2011
Acceleration Adult Biceps Femoris Cadaver Cerebral Palsy Child Epistropheus Femur Foot Generic Drugs Gomphosis Gravitation Gravity Head Hip Joint Joints Joints, Ankle Knee Joint Muscle, Gastrocnemius Muscle Tissue Pelvis Plant Roots Quadriceps Femoris Rectus Femoris Semimembranosus Tibia Torso Vastus Intermedius Vastus Lateralis Vastus Medialis Vertebrae, Lumbar
3
Humanized Mouse Model for HIV Study
AAV2/8 was produced by transient transfection and purification from culture supernatant by PEG precipitation and cesium chloride ultracentrifugation. Virus was quantified by qPCR against CMV sequences and functionally validated in vitro to confirm gene expression prior to use in vivo. Mice were given single injections with purified vector in the gastrocnemius muscle. Antibody concentration in the serum was determined using an ELISA specific for either total human IgG or human IgG against HIV-gp120. Humanized mice expressing antibodies were produced by adoptive transfer of expanded huPBMCs into mice previously transduced with AAV vectors. HIV challenge was carried out via IP or IV injection and blood was sampled weekly to determine the ratio of CD4 to CD8 cells by flow cytometry.
Balazs A.B., Chen J., Hong C.M., Rao D.S., Yang L, & Baltimore D. (2011). Antibody-based Protection Against HIV Infection by Vectored ImmunoProphylaxis. Nature, 481(7379), 81-84.
Publication 2011
Adoptive Transfer Antibodies BLOOD CD8-Positive T-Lymphocytes cesium chloride Cloning Vectors Enzyme-Linked Immunosorbent Assay Flow Cytometry Gene Expression HIV Envelope Protein gp120 Homo sapiens Immunoglobulins Mus Muscle, Gastrocnemius Serum Transfection Transients Ultracentrifugation Virus
4
Humanized Mouse Model for HIV Study
AAV2/8 was produced by transient transfection and purification from culture supernatant by PEG precipitation and cesium chloride ultracentrifugation. Virus was quantified by qPCR against CMV sequences and functionally validated in vitro to confirm gene expression prior to use in vivo. Mice were given single injections with purified vector in the gastrocnemius muscle. Antibody concentration in the serum was determined using an ELISA specific for either total human IgG or human IgG against HIV-gp120. Humanized mice expressing antibodies were produced by adoptive transfer of expanded huPBMCs into mice previously transduced with AAV vectors. HIV challenge was carried out via IP or IV injection and blood was sampled weekly to determine the ratio of CD4 to CD8 cells by flow cytometry.
Balazs A.B., Chen J., Hong C.M., Rao D.S., Yang L, & Baltimore D. (2011). Antibody-based Protection Against HIV Infection by Vectored ImmunoProphylaxis. Nature, 481(7379), 81-84.
Publication 2011
Adoptive Transfer Antibodies BLOOD CD8-Positive T-Lymphocytes cesium chloride Cloning Vectors Enzyme-Linked Immunosorbent Assay Flow Cytometry Gene Expression HIV Envelope Protein gp120 Homo sapiens Immunoglobulins Mus Muscle, Gastrocnemius Serum Transfection Transients Ultracentrifugation Virus
5
Ultrasound Assessment of Lower Limb Muscles
An ultrasound test was performed on 4 lower extremity muscles: rectus femoris (RF), biceps femoris (BF), tibialis anterior (TA), and medial gastrocnemius (MG) using a LOGIQ e ultrasound-imaging device (GE Healthcare UK Ltd., Chalfont, Buckinghamshire, England). The dominant leg was tested. Participants were examined while resting supine on an examining table. Ultrasound Brightness mode (B-mode) with musculoskeletal scanning preset and a multi-frequency linear transducer (8-12 MHz) with 12.7 × 47.1mm footprint were used. The beam width of the transducer was approximately 2.0mm at its narrowest point. Gain and transducer frequency were adjusted to 58-dB and 8 MHz, respectively. Scanning depth was set to 4 cm with an apparent spatial resolution of 80 μm/pixel. The scanning depth was only increased when testing participants with greater subcutaneous fat to allow for capturing enough muscle area. Time gain compensation was adjusted to neutral position. Focus number and area were increased to maximum and kept consistent across all participants to adjust for differences in muscle size among participants. Other ultrasound settings were unchanged from the preset.
Before starting the ultrasound study, the upper and lower leg length of each participant was measured from the superior lateral aspect of the patella to the anterior superior iliac spine and from the inferior lateral aspect of the patella to the calcaneus, respectively. Marks were made on the anterior and posterior parts of the 1/3 and 1/4 of upper and lower leg length, measured from the patella. The purpose of the marks was to ensure that the scanning locations between ultrasound and MRI as well as between participants were consistent. A generous amount of ultrasound gel was applied to avoid excessive pressure on the skin. Each scan involved a 16-second ultrasound clip on 1 of the marks, and each muscle was scanned twice (both 1/3 and 1/4 marks). A total of 8 scans were obtained from each participant. Each ultrasound clip was reviewed, and 1 frame with the best focus was chosen and saved into a JPEG image for analysis. Muscle EI was determined by gray-scale analysis using ImageJ16 . A muscle of interest was circled manually while avoiding surrounding fascia and bone. The mean voxel intensity of the selected muscle region was obtained from each measurement, and an average of 3 measurements was calculated. Subcutaneous fat thickness, muscle thickness, and area of the muscle of interest were also recorded. Images were analyzed by 2 investigators to test for the inter-rater reliability.
Young H.J., Jenkins N.T., Zhao Q, & McCully K.K. (2015). Measurement of Intramuscular Fat by Muscle Echo Intensity. Muscle & nerve, 52(6), 963-971.
Publication 2015
Biceps Femoris Bones Calcaneus Clip Fascia Ilium Leg Lower Extremity Medical Devices Muscle, Gastrocnemius Muscle Tissue Patella Pressure Radionuclide Imaging Reading Frames Rectus Femoris Skin Subcutaneous Fat Tibial Muscle, Anterior Transducers Ultrasonics Vertebral Column

Most recents protocols related to «Muscle, Gastrocnemius»

1
Targeted siRNA Delivery for Muscle Atrophy
Not available on PMC !

Example 24

For groups 1-12, see study design in FIG. 32, the 21mer Atrogin-1 guide strand was designed. The sequence (5′ to 3′) of the guide/antisense strand was UCGUAGUUAAAUCUUCUGGUU (SEQ ID NO: 14237). The guide and fully complementary RNA passenger strands were assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Base, sugar and phosphate modifications that are well described in the field of RNAi were used to optimize the potency of the duplex and reduce immunogenicity. Purified single strands were duplexed to get the double stranded siRNA described in figure A. The passenger strand contained two conjugation handles, a C6-NH2 at the 5′ end and a C6-SH at the 3′ end. Both conjugation handles were connected to siRNA passenger strand via phosphodiester-inverted abasic-phosphodiester linkers. Because the free thiol was not being used for conjugation, it was end capped with N-ethylmaleimide.

For groups 13-18 see study design in FIG. 32, a 21mer negative control siRNA sequence (scramble) (published by Burke et al. (2014) Pharm. Res., 31(12):3445-60) with 19 bases of complementarity and 3′ dinucleotide overhangs was used. The sequence (5′ to 3′) of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 14228). The same base, sugar and phosphate modifications that were used for the active MSTN siRNA duplex were used in the negative control siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH2 at the 5′ end and a C6-SH at the 3′ end. Both conjugation handles were connected to siRNA passenger strand via phosphodiester-inverted abasic-phosphodiester linker. Because the free thiol was not being used for conjugation, it was end capped with N-ethylmaleimide.

Antibody siRNA Conjugate Synthesis Using Bis-Maleimide (BisMal) Linker

Step 1: Antibody Reduction with TCEP

Antibody was buffer exchanged with 25 mM borate buffer (pH 8) with 1 mM DTPA and made up to 10 mg/ml concentration. To this solution, 4 equivalents of TCEP in the same borate buffer were added and incubated for 2 hours at 37° C. The resultant reaction mixture was combined with a solution of BisMal-siRNA (1.25 equivalents) in pH 6.0 10 mM acetate buffer at RT and kept at 4° C. overnight. Analysis of the reaction mixture by analytical SAX column chromatography showed antibody siRNA conjugate along with unreacted antibody and siRNA. The reaction mixture was treated with 10 EQ of N-ethylmaleimide (in DMSO at 10 mg/mL) to cap any remaining free cysteine residues.

Step 2: Purification

The crude reaction mixture was purified by AKTA Pure FPLC using anion exchange chromatography (SAX) method-1. Fractions containing DAR1 and DAR2 antibody-siRNA conjugates were isolated, concentrated and buffer exchanged with pH 7.4 PBS.

Anion Exchange Chromatography Method (SAX)-1.

Column: Tosoh Bioscience, TSKGel SuperQ-5PW, 21.5 mm ID×15 cm, 13 um

Solvent A: 20 mM TRIS buffer, pH 8.0; Solvent B: 20 mM TRIS, 1.5 M NaCl, pH 8.0; Flow Rate: 6.0 ml/min

Gradient:

a.% A% BColumn Volume
b.10001
c.81190.5
d.505013
e .40600.5
f.01000.5
g.10002

Anion Exchange Chromatography (SAX) Method-2

Column: Thermo Scientific, ProPac™ SAX-10, Bio LC™, 4×250 mm

Solvent A: 80% 10 mM TRIS pH 8, 20% ethanol; Solvent B: 80% 10 mM TRIS pH 8, 20% ethanol, 1.5 M NaCl; Flow Rate: 0.75 ml/min

Gradient:

a.Time% A% B
b.0.09010
c.3.009010
d.11.004060
e.14.004060
f.15.002080
g.16.009010
h.20.009010

Step-3: Analysis of the Purified Conjugate

The purity of the conjugate was assessed by analytical HPLC using anion exchange chromatography method-2 (Table 22).

TABLE 22
SAX retention% purity
Conjugatetime (min)(by peak area)
TfR1-Atrogin-1 DAR19.299
TfR1-Scramble DAR18.993

In Vivo Study Design

The conjugates were assessed for their ability to mediate mRNA downregulation of Atrogin-1 in muscle (gastroc) in the presence and absence of muscle atrophy, in an in vivo experiment (C57BL6 mice). Mice were dosed via intravenous (iv) injection with PBS vehicle control and the indicated ASCs and doses, see FIG. 32. Seven days post conjugate delivery, for groups 3, 6, 9, 12, and 15, muscle atrophy was induced by the daily administration via intraperitoneal injection (10 mg/kg) of dexamethasone for 3 days. For the control groups 2, 5, 8, 11, and 14 (no induction of muscle atrophy) PBS was administered by the daily intraperitoneal injection. Groups 1, 4, 7, 10, and 13 were harvested at day 7 to establish the baseline measurements of mRNA expression and muscle weighted, prior to induction of muscle atrophy. At three days post-atrophy induction (or 10 days post conjugate delivery), gastrocnemius (gastroc) muscle tissues were harvested, weighed and snap-frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in the methods section. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ΔCt) is calculated and then further normalized relative to the PBS control group by taking a second difference (ΔΔCt).

Quantitation of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in the methods section. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem-loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Results

The data are summarized in FIG. 33-FIG. 35. The Atrogin-1 siRNA guide strands were able to mediate downregulation of the target gene in gastroc muscle when conjugated to an anti-TfR mAb targeting the transferrin receptor, see FIG. 33. Increasing the dose from 3 to 9 mg/kg reduced atrophy-induced Atrogin-1 mRNA levels 2-3 fold. The maximal KD achievable with this siRNA was 80% and a tissue concentration of 40 nM was needed to achieve maximal KD in atrophic muscles. This highlights the conjugate delivery approach is able to change disease induce mRNA expression levels of Atrogin-1 (see FIG. 34), by increasing the increasing the dose. FIG. 35 highlights that mRNA down regulation is mediated by RISC loading of the Atrogin-1 guide strands and is concentration dependent.

Conclusions

In this example, it was demonstrated that a TfR1-Atrogin-1 conjugates, after in vivo delivery, mediated specific down regulation of the target gene in gastroc muscle in a dose dependent manner. After induction of atrophy the conjugate was able to mediate disease induce mRNA expression levels of Atrogin-1 at the higher doses. Higher RISC loading of the Atrogin-1 guide strand correlated with increased mRNA downregulation.

US11872287B2. Compositions and methods of treating muscle atrophy and myotonic dystrophy (2024-01-16). Avidity Biosciences, Inc. [US]. Inventors: Andrew John Geall [US], Venkata Doppalapudi [US], David Sai-Ho Chu [US], Michael Caramian Cochran [US], Michael Hood [US], Beatrice Diana Darimont [US], Rob Burke [US], Yunyu Shi [US], Gulin Erdogan Marelius [US], Barbora Malecova [US].
Full text: Click here
Patent 2024
Acetate Anions Antibody Formation Antigens Atrophy Biological Assay Borates Buffers Carbohydrates Chromatography Complementary RNA Complement System Proteins Cysteine Dexamethasone Dinucleoside Phosphates DNA, Complementary Down-Regulation Ethanol Ethylmaleimide Freezing Genes Genes, Housekeeping High-Performance Liquid Chromatographies Immunoglobulins Injections, Intraperitoneal maleimide MicroRNAs Mus Muscle, Gastrocnemius Muscle Tissue Muscular Atrophy Nitrogen Obstetric Delivery Oligonucleotide Primers Pentetic Acid Phosphates Plasma PPIB protein, human Prospective Payment Assessment Commission Real-Time Polymerase Chain Reaction Retention (Psychology) Reverse Transcription RNA, Messenger RNA, Small Interfering RNA-Induced Silencing Complex RNA Interference Sodium Chloride Solvents Stem, Plant STS protein, human Sulfhydryl Compounds Sulfoxide, Dimethyl TFRC protein, human Tissues Transferrin tris(2-carboxyethyl)phosphine Tromethamine
2
Hindlimb Suspension-Induced Muscle Atrophy
At the end of the experimental period, rats were anesthetized with pentobarbital sodium, and blood was immediately collected through cardiac puncture. Rats were euthanized, and the soleus muscles were excised, weighed, and used for ex vivo collection of muscle EVs (right) or dissected, weighed, frozen in liquid nitrogen, and stored at − 80 °C for later biochemical analyses (left). For immunohistochemistry (IHC) analyses, the soleus muscles were covered in Tissue-Tek optimal cutting temperature compound (Sakura Finetek, Torrance, CA, USA), frozen in liquid nitrogen-cooled isopentane, and stored at − 80 °C. The soleus muscles were used in these experiments because in rats, the soleus, which is almost exclusively type I, is especially susceptible to hindlimb suspension-induced muscle atrophy [25 (link), 26 (link)]. Furthermore, the smaller size of the soleus limits issues of oxygen diffusion during ex vivo muscle assessments [27 (link)]. The gastrocnemius muscles were used for single-cell RNA sequencing (scRNA-seq) as described in [28 (link)]. The serum was isolated by allowing blood to clot at room temperature for 30 min before centrifugation for 10 min at 2000g at 4 °C. The serum supernatant was collected and stored at − 80 °C until analysis. The number of animals used in each experiment is listed in the figure legends.
Ismaeel A., Van Pelt D.W., Hettinger Z.R., Fu X., Richards C.I., Butterfield T.A., Petrocelli J.J., Vechetti I.J., Confides A.L., Drummond M.J, & Dupont-Versteegden E.E. (2023). Extracellular vesicle distribution and localization in skeletal muscle at rest and following disuse atrophy. Skeletal Muscle, 13, 6.
Full text: Click here
Publication 2023
Animals BLOOD Centrifugation Clotrimazole Diffusion Freezing Heart Immunohistochemistry isopentane Muscle, Gastrocnemius Muscle Tissue Muscular Atrophy Nitrogen Oxygen Pentobarbital Sodium Punctures Rattus norvegicus Serum Single-Cell RNA-Seq Soleus Muscle Tissues
3
Single-Cell RNA-Seq of Rat Skeletal Muscle
Cell isolations were performed as previously described in mice [37 (link)] and modified slightly for rats [28 (link)]. Briefly, the gastrocnemius muscles from WB and HS male rats were excised and placed in muscle dissociation media (MDM) (Hams F-10 (Gibco, USA), 10% Horse Serum (Thermo Fisher), 1% penicillin/streptomycin (Gibco), 800 U/ml Collagenase II (Gibco)), and minced using sterilized surgical equipment. The muscle homogenate was then incubated in MDM for 1 h at 37 °C with gentle agitation. Following incubation, samples underwent further incubation in 1000 U/ml Collagenase II (Gibco) and 11 U/ml dispase (Gibco) for 30 min at 37 °C. The single-cell suspension was passed through an 18-gauge needle approximately 10 times prior to 0.2-μm filtration. Single cells were incubated in propidium iodide to identify dying/dead cells for removal via fluorescence-activated cell sorting (Sony Biotechnology, USA). Single-cell suspensions from each group were added to a Chromium Controller (10X Genomics, USA) using the Single Cell 3’ Reagent Kit per manufacturer’s instructions and sequenced on an Illumina HiSeq platform (Novogene, USA), yielding 200 million reads/sample.
Ismaeel A., Van Pelt D.W., Hettinger Z.R., Fu X., Richards C.I., Butterfield T.A., Petrocelli J.J., Vechetti I.J., Confides A.L., Drummond M.J, & Dupont-Versteegden E.E. (2023). Extracellular vesicle distribution and localization in skeletal muscle at rest and following disuse atrophy. Skeletal Muscle, 13, 6.
Full text: Click here
Publication 2023
ATF7IP protein, human Cell Separation Chromium Collagenase dispase Equus caballus Filtration Males Mus Muscle, Gastrocnemius Muscle Tissue Needles Penicillins Propidium Iodide Rattus norvegicus Serum Streptomycin Surgical Equipment Type II Mucolipidosis
4
Muscle Stiffness in Marathon Runners
Data were tested for normality using the Shapiro–Wilk test and homogeneity of variance (Levene’s test). Descriptive statistics included the mean, SD, and SE. To compare the mean values of the examined variables, repeated measures of one-way ANOVA were used. The independent variable is the time needed to complete the marathon run, whereas the dependent variables were muscle stiffness (MFT, MBS, and HR). After a significant main or interaction effect was established, the data were evaluated with a post-hoc Fisher’s LSD test. The level of statistical significance was set at p = 0.05. Additionally, Cohen’s d was calculated, and the effect sizes were determined: 0.35 for small effect size, 0.35 and 0.65 for medium effect size, and 0.65 for large effect size (Cohen, 1988 ). The relationship between the variables was determined using Pearson’s product–moment correlation. Statistical power was set to be >0.90 at p = 0.05. All statistical analyses were made using the STATISTICA ver. 13.1 (StatSoft. Inc., United States) software package.
Reliability between trials (within-session) for one of the selected muscles (two series of 10 single measurements) of each group was tested using the intraclass correlation coefficient (ICC) model. Domholdt classification scales (Carter et al., 2011 ) for interpreting ICCs were used: very high = 1.00–0.90; high = 0.89–0.70; moderate = 0.69–0.50; and low = 0.49–0.26. ICCs were found for the rectus femoris (ICC, 0.82), biceps femoris (ICC, 0.86), tibialis anterior (ICC, 0.91), and gastrocnemius (ICC, 0.85). The high reliability of the coefficients indicated that the tests resulted in inconsistent measurements of muscle stiffness among the Marathon runners.
Mackala K., Mroczek D., Chmura P., Konefał M., Pawlik D., Ochman B., Chmura J., Paleczny B., Seredyński R., Wyciszkiewicz M., Nowicka-Czudak A., Łopusiewicz W., Adamiec D., Wiecha S., Ponikowski P, & Ponikowska B. (2023). Impact of marathon performance on muscles stiffness in runners over 50 years old. Frontiers in Psychology, 14, 1069774.
Full text: Click here
Publication 2023
Biceps Femoris inecalcitol Marathon composite resin Muscle, Gastrocnemius Muscle Tissue neuro-oncological ventral antigen 2, human Rectus Femoris Tibial Muscle, Anterior
5
Marathon-induced Muscle Stiffness Dynamics
The first muscle stiffness sample was collected on the day before the marathon. The quadriceps muscle of the thigh and the triceps muscle of the calf were measured. All measurements were performed in a designated room. Rigidity measurements were taken at rest the day before the marathon. Subsequent measurements were made 1–2 h before the start and just after the end of the marathon run. All tests were performed by the same trained person to operate the MYOTON device.
The participants were prone on their backs or their stomachs on a unique bed, and they rested for 10 min before muscle stiffness measurements were taken. Testing sites on each muscle were located using a tape measure and marked using a skin-safe pen (Figure 1). A pillow was placed under the head, and a unique roller pillow was placed under the lower leg to aid relaxation. One series of three single Myoton measurements of each muscle group (12 points) were measured separately for the left and right legs. In addition, for a better understanding of the problem, the functionality of the lower limb was also determined - the dominant and non-dominant leg. The dominant leg for a particular runner was determined based on the information provided by the marathoner in the questionnaire.
The reliability between trials (within session) of the one selected muscles (two series of 10 single measurements) of each group was tested using intraclass correlation coefficient (ICC) model. Domholdt (1993) classification scales for interpreting ICCs was used: very high =1.00–0.90; high = 0.89–0.70; moderate = 0.69–0.50; low = 0.49–0.26. This indicated that Rectus femoris reach (ICC = 0.82) and Gastrocnemius (ICC = 0.85). The high reliability coefficient indicated that applied tests represent consistent measurement of muscle stiffness data among the runners.
Mackala K., Mroczek D., Chmura P., Konefał M., Pawlik D., Ochman B., Chmura J., Paleczny B., Seredyński R., Wyciszkiewicz M., Nowicka-Czudak A., Łopusiewicz W., Adamiec D., Wiecha S., Ponikowski P, & Ponikowska B. (2023). Impact of marathon performance on muscles stiffness in runners over 50 years old. Frontiers in Psychology, 14, 1069774.
Full text: Click here
Publication 2023
Head inecalcitol Lower Extremity Marathon composite resin Medical Devices Muscle, Gastrocnemius Muscle Rigidity Muscle Tissue Quadriceps Femoris Rectus Femoris Skin Stomach

Top products related to «Muscle, Gastrocnemius»

1
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
2
Trizol by Thermo Fisher Scientific
Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines
TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.
3
Rneasy mini kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway
The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.
4
High capacity cdna reverse transcription kit by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Japan, Lithuania, France, Italy, China, Spain, Canada, Switzerland, Poland, Australia, Belgium, Denmark, Sweden, Hungary, Austria, Ireland, Netherlands, Brazil, Macao, Israel, Singapore, Egypt, Morocco, Palestine, State of, Slovakia
The High-Capacity cDNA Reverse Transcription Kit is a laboratory tool used to convert RNA into complementary DNA (cDNA) molecules. It provides a reliable and efficient method for performing reverse transcription, a fundamental step in various molecular biology applications.
5
Pierce bca protein assay kit by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, Australia, Switzerland, France, Italy, Canada, Spain, Japan, Belgium, Sweden, Lithuania, Austria, Denmark, Poland, Ireland, Portugal, Finland, Czechia, Norway, Macao, India, Singapore
The Pierce BCA Protein Assay Kit is a colorimetric-based method for the quantification of total protein in a sample. It utilizes the bicinchoninic acid (BCA) reaction, where proteins reduce Cu2+ to Cu+ in an alkaline environment, and the resulting purple-colored reaction is measured spectrophotometrically.
6
Rneasy fibrous tissue mini kit by Qiagen
Sourced in Germany, United States, Spain, Netherlands, Japan, Switzerland, United Kingdom, France, Australia, Canada
The RNeasy Fibrous Tissue Mini Kit is a tool designed for the isolation and purification of total RNA from fibrous tissue samples. The kit utilizes a silica-membrane technology to ensure efficient RNA extraction and purification, allowing for high-quality RNA suitable for various downstream applications.
7
Cryostat by Leica
Sourced in Germany, United States, Japan, United Kingdom, France, Australia, Canada, Denmark, Italy, Singapore, Switzerland, Israel
The Cryostat is a specialized piece of laboratory equipment used for the sectioning of frozen tissue samples. It maintains a controlled low-temperature environment, enabling the precise and consistent cutting of delicate specimens for microscopic analysis and examination.
8
Protease inhibitor cocktail by Merck Group
Sourced in United States, Germany, China, United Kingdom, Italy, Japan, Sao Tome and Principe, France, Canada, Macao, Switzerland, Spain, Australia, Israel, Hungary, Ireland, Denmark, Brazil, Poland, India, Mexico, Senegal, Netherlands, Singapore
The Protease Inhibitor Cocktail is a laboratory product designed to inhibit the activity of proteases, which are enzymes that can degrade proteins. It is a combination of various chemical compounds that work to prevent the breakdown of proteins in biological samples, allowing for more accurate analysis and preservation of protein integrity.
9
C57bl 6j mice by Jackson ImmunoResearch
Sourced in United States, Montenegro, Japan, Canada, United Kingdom, Germany, Macao, Switzerland, China
C57BL/6J mice are a widely used inbred mouse strain. They are a commonly used model organism in biomedical research.
10
Nanodrop by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, China, France, Japan, Canada, Italy, Belgium, Australia, Denmark, Spain, Sweden, India, Finland, Switzerland, Poland, Austria, Brazil, Singapore, Portugal, Macao, Netherlands, Taiwan, Province of China, Ireland, Lithuania
The NanoDrop is a spectrophotometer designed for the quantification and analysis of small volume samples. It measures the absorbance of a sample and provides accurate results for DNA, RNA, and protein concentration measurements.

More about "Muscle, Gastrocnemius"

The gastrocnemius is a critical lower leg muscle essential for efficient locomotion and physical performance.
Also known as the calf muscle, it is composed of two heads, the medial and lateral, which originate from the posterior femur and insert on the calcaneus via the Achilles tendon.
This powerhouse muscle is primarily responsible for plantar flexion of the ankle joint, enabling activities like walking, running, and jumping.
Understanding the anatomy, function, and biomechanics of the gastrocnemius can help optimize physical training and prevent musculoskeletal injuries.
Researchers studying this muscle may utilize techniques like TRIzol reagent or the RNeasy Mini Kit for RNA extraction, the High-Capacity cDNA Reverse Transcription Kit for gene expression analysis, and the Pierce BCA Protein Assay Kit for protein quantification.
The RNeasy Fibrous Tissue Mini Kit is particularly useful for extracting RNA from the gastrocnemius, a dense muscle tissue.
Cryostat sectioning and protease inhibitor cocktails can also be employed to preserve and analyze muscle samples.
Animal models, such as C57BL/6J mice, are often used to investigate gastrocnemius muscle biology and physiology.
Researchers can leverage the NanoDrop spectrophotometer to assess the quantity and purity of extracted nucleic acids.
By combining these specialized techniques with a deep understanding of the gastrocnemius, scientists can uncover new insights and optimize physical performance and rehabilitation strategies.