Log In Sign up
The largest database of trusted experimental protocols
> Anatomy > Body Part > Oviducts

Oviducts

Oviducts are the tubes that connect the ovaries to the uterus in female mammals.
They play a crucial role in the reproductive process, transporting the ova (eggs) from the ovaries to the uterus.
Oviducts also provide an environment for fertilization and early embryonic development.
Understanding the structure and function of oviducts is essential for researchers studying female reproductive biology, infertility, and assisted reproductive technologies.
PubCompare.ai's AI-driven protocol optimization can help identify the best techniques and products for oviduct research, ensuring accurate and efficient studies.

Most cited protocols related to «Oviducts»

1
CRISPR-Cas9 Genome Editing in Mice

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2013
2',5'-oligoadenylate Amino Acids Anemia, Diamond-Blackfan, 2 Animals Blastocyst Cytoplasm Donors Embryo Females Males Mice, House Mice, Inbred ICR Mothers Oviducts RNA, Messenger Strains Tissue Donors Uterus Zygote
2
Ovulation Assessment in Mice
After the stage of the estrous cycle was determined, each mouse was paired with one CByB6F1/J male and the following morning the presence or absence of a vaginal plug was noted and each mouse was euthanized by cervical dislocation. The contents of the oviducts were flushed using M2 media into a petri dish to look for oocytes as evidence that ovulation had occurred.
Byers S.L., Wiles M.V., Dunn S.L, & Taft R.A. (2012). Mouse Estrous Cycle Identification Tool and Images. PLoS ONE, 7(4), e35538.
Full text: Click here
Publication 2012
Estrous Cycle Hyperostosis, Diffuse Idiopathic Skeletal Joint Dislocations Males Mice, House Neck Oviducts Ovulation Ovum Vagina
3
Transgenic Mice Generation via CRISPR
B6D2F1 female mice were superovulated and mated with B6D2F1 males, and fertilized eggs were collected from the oviduct. The pronuclear stage eggs were injected with pX330 plasmids, hCas9 mRNA, and sgRNAs at indicated concentrations. The eggs were cultivated in kSOM overnight then transferred into the oviducts of pseudopregnant ICR females.
Mashiko D., Fujihara Y., Satouh Y., Miyata H., Isotani A, & Ikawa M. (2013). Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Scientific Reports, 3, 3355.
Publication 2013
Eggs Fallopian Tubes Females Males Mice, House Oviducts Plasmids RNA, Messenger Zygote
4
CRISPR-Mediated Genetic Modification in Mice

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2013
2',5'-oligoadenylate Amino Acids Anemia, Diamond-Blackfan, 2 Animals Blastocyst Cloning Vectors Cytoplasm Donors Embryo Females Males Mice, House Mice, Inbred ICR Mothers Oviducts Plasmids RNA, Messenger Strains Uterus XXX syndrome Zygote
5
CRISPR/Cas9 Knock-in and Mutation Analysis
The Cas9 mRNA and gRNAs targeting Fgf10 or H2b-mCherry were introduced into eggs collected from B6D2F1 females by electroporation at E0.5 as described above. For the HDR-mediated knock-in study, 400 ng/μl ssODN was introduced together with 200 ng/μl Cas9 mRNA and 100 ng/μl gRNA. The sequence of the ssODN was as follows: H2b-mCherry (5’- AGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAATTCATAACTTCGTATAGCATACATTATACGAAGTTATCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCC -3’). The surviving 2-cell-stage embryos were transferred to the oviducts of pseudopregnant females on the day of the vaginal plug. The mice were dissected at E15-16 (Fgf10) or E9 (H2b-mCherry), and the embryos were collected.
To investigate CRISPR/Cas9-mediated mutation in the Fgf10 or H2b-mCherry gene, the genomes were prepared from the yolk sac of the embryos. The genomic regions flanking the gRNA target were amplified by PCR using specific primers: Fgf10 Fwd (5’-CAGCAGGTCTTACCCTTCCA-3’) and Rev (5’-TACAGGGGTTGGGGACATAA-3’), H2b-mCherry Fwd (5’-GAGGGCACTAAGGCAGTCAC-3’) or Fwd2 (5’-AAGGGCGAGGAGGATAACAT-3’) and Rev (5’-CCCATGGTCTTCTTCTGCAT-3’). The PCR amplicons of Fgf10 or H2b-mCherry were cloned into the pMD20 (Takara Bio Inc., Shiga, Japan) vector. Ten plasmids from each embryo were isolated, and the genomic region was sequenced. Sequencing was performed using the BigDye terminator Cycle Sequencing Kit ver. 3.1 and ABI 3500 Genetic Analyzer (Applied Biosystems, Foster City, CA).
Hashimoto M, & Takemoto T. (2015). Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific Reports, 5, 11315.
Full text: Click here
Publication 2015
Cells Cloning Vectors Clustered Regularly Interspaced Short Palindromic Repeats Eggs Electroporation Embryo Females FGF10 protein, human Genes Genome Mice, House Mutation Oligonucleotide Primers Oviducts Plasmids Reproduction RNA, Messenger Vagina Yolk Sac

Most recents protocols related to «Oviducts»

1
Oocyte Collection and In Vitro Fertilization
For oocyte collection, 4-week-old naïve C57Bl/6N females were superovulated by intraperitoneal injection of 5 IU pregnant mare serum gonadotropin (Asuka Animal Health, Tokyo, Japan), followed by 5 IU human chorionic gonadotropin (hCG; Mochida Pharmaceutical, Tokyo, Japan) 48 h later. Fifteen hours after hCG injection, the animals were sacrificed and their oviducts removed. The cumulus-oocyte complexes were collected in drops of HTF medium containing approximately 7 × 105 cells/mL sperm from 12-week-old mice from control or VPA groups. In vitro fertilization was performed by co-incubating oocytes with sperm in HTF medium drops for 4 h at 37.5°C in an atmosphere of 5% CO2 in humidified air. After incubation, the oocytes were washed by gentle pipetting in potassium simplex optimized medium [26 (link)] using a glass pipette. The oocytes were transferred to new potassium simplex optimized medium drops and incubated for 72 h at 37.5°C in 5% CO2 in humidified air. After incubation, morphologically normal morular embryos were selected and collected.
Sakai K., Hara K, & Tanemura K. (2023). Testicular histone hyperacetylation in mice by valproic acid administration affects the next generation by changes in sperm DNA methylation. PLOS ONE, 18(3), e0282898.
Full text: Click here
Publication 2023
Animals Atmosphere Embryo Females Fertilization in Vitro Human Chorionic Gonadotropin Morula Mus Oocyte Retrieval Oocytes Oviducts Pharmaceutical Preparations Potassium Pregnant Mare Serum Gonadotropins Sperm
2
Fulmar Reproductive Age Categorization
Most fulmars in our sample set were
fledglings that hatched approximately 50–60 days prior to sampling
(53.8%). Birds of this age class were not able to fly during sampling
and were confirmed as fledglings by the development state of their
gonads (for males: small black testes; for females: small smooth ovaries
without follicles), large bursa of Fabricius, and generally thick
layers of subcutaneous fat.37 ,38 All females other
than fledglings had gonads with follicles. While the oviducts of most
females did not show any traces of former breeding, stretch markings
in the surrounding tissues indicated former breeding activities in
two females.37 Testes of older immature
(i.e., individuals before the first breeding attempt) and adult males
(individuals from breeding age on) cannot be distinguished by color,
size, or shape outside the breeding season.37 All nonfledgling males in our sample set had bright, oval testes
(average length × width = 29 mm ± 3 se). Because we lack
sufficient information to distinguish between males before and after
first breeding attempt, and to divide our sample set into two groups
with similar sample sizes, we used the following age categories: “fledglings”
and older fulmars or “nonfledglings” (which include
all fulmars with fully developed gonads and may represent a mix of
adults that did raise a chick in 2020, adults that skipped or failed
breeding in 2020 and immatures). For the distribution of ages and
sexes in our sample set, see Table 1.
Tulatz F., Gabrielsen G.W., Bourgeon S., Herzke D., Krapp R., Langset M., Neumann S., Lippold A, & Collard F. (2023). Implications of Regurgitative Feeding on Plastic Loads in Northern Fulmars (Fulmarus glacialis): A Study from Svalbard. Environmental Science & Technology, 57(9), 3562-3570.
Full text: Click here
Publication 2023
Adult Aves Bursa of Fabricius Females Gonads Hair Follicle Males Oviducts Subcutaneous Fat Testis Tissues
3
Preimplantation Embryo Development in Mice
Mice were pathogen-free, and bred and maintained in the animal care facility at KU Leuven. Animals had access to food (ssniff® R/M-H) and water (HCl-acidified water (pH 2.5-3) and were group-housed in ventilated cages under controlled temperature (22 ± 2 °C) and humidity (45–70%) with a 14 h light, 10 h dark light cycle. To obtain preimplantation embryos, CD-1 female mice were superovulated (SO) by intraperitoneal injection of 150 μL pregnant mare’s serum (PMS) gonadotropin, followed by injection of 150 μL human chorionic gonadotropin (hCG) 48 h later. SO females were then mated with male mice. For β-CATENIN quantification, E3.5 and E4.5 embryos were flushed from dissected uteri with EmbryoMax® M2 Medium (Sigma). Embryos were washed with PBS and fixed in 4% paraformaldehyde (PFA). For ex vivo embryo culture and treatment, E2.5 embryos were flushed from dissected oviducts using EmbryoMax® M2 Medium. E2.5 embryos were treated with 100 ng/mL DKK1 and 10 μM iCRT3 diluted in EmbryoMax® KSOM Medium and cultured in cell culture dish (Nunc™ Cell-Culture Treated Multidishes, Thermo Fisher Scientific) at 37 °C in incubator supplied with 5% CO2. Blastocysts (E2.5 + 48H) were stopped and fixed in 4% PFA for further molecular analysis (see Immunofluorescence staining section).
Athanasouli P., Balli M., De Jaime-Soguero A., Boel A., Papanikolaou S., van der Veer B.K., Janiszewski A., Vanhessche T., Francis A., El Laithy Y., Nigro A.L., Aulicino F., Koh K.P., Pasque V., Cosma M.P., Verfaillie C., Zwijsen A., Heindryckx B., Nikolaou C, & Lluis F. (2023). The Wnt/TCF7L1 transcriptional repressor axis drives primitive endoderm formation by antagonizing naive and formative pluripotency. Nature Communications, 14, 1210.
Full text: Click here
Publication 2023
Animals Blastocyst Cell Culture Techniques CTNNB1 protein, human Embryo Females Food Human Chorionic Gonadotropin Humidity Hyperostosis, Diffuse Idiopathic Skeletal Immunofluorescence Light Males Mus Oviducts paraform Pathogenicity Pregnant Mare Serum Gonadotropins Uterus
4
Superovulation and Pronuclear Embryo Collection
Crlj:ICR females aged 9–13 weeks were induced superovulation by intraperitoneal injection of 10 IU/body pregnant mare serum gonadotropin (PMSG; ASKA Animal Health Co., Ltd., Tokyo, Japan), followed by intraperitoneal injection of 10 IU/body human chorionic gonadotropin (hCG; ASKA Animal Health Co., Ltd.) 48 h later. These females were then mated overnight with Crlj:ICR males aged > 10 weeks. The presence of vaginal plugs in the females confirmed that mating had occurred. Pronuclear stage embryos were collected by flushing the oviducts with PB1 medium30 (link) on the day after the mating. These embryos were then cultured to a two-cell stage in a fresh KSOM medium31 (link) at 37 °C in an atmosphere containing 5% CO2 and 95% air. Pronuclear embryos produced from Crlj:ICR females and C57BL/6 J males were vitrified for subsequent genome editing.
Wake Y., Endo M., Tsunoda S., Tawara H., Abe H., Nakagawa Y, & Kaneko T. (2023). Successful induction of pseudopregnancy using sonic vibration in mice. Scientific Reports, 13, 3604.
Full text: Click here
Publication 2023
Animals Atmosphere Cultured Cells Embryo Females Human Body Human Chorionic Gonadotropin Injections, Intraperitoneal Males Oviducts Pregnant Mare Serum Gonadotropins Vagina
5
Embryo Transfer and Pseudopregnancy Mice
The two-cell embryos were transferred into the oviducts of females with pseudopregnancy that were stimulated the day before embryo transfer or mated with vasectomized males. Pronuclear, two-cell, or genome-edited pronuclear embryos were transferred into the oviducts of females with pseudopregnancy that were stimulated on the day of embryo transfer. Females were anesthetized using the mixture of medetomidine, midazolam, and butorphanol during operation. The number of implantation sites and offspring were counted after euthanasia by cervical dislocation at 18 days following gestation.
Wake Y., Endo M., Tsunoda S., Tawara H., Abe H., Nakagawa Y, & Kaneko T. (2023). Successful induction of pseudopregnancy using sonic vibration in mice. Scientific Reports, 13, 3604.
Full text: Click here
Publication 2023
Butorphanol Cells Embryo Euthanasia Females Genome Joint Dislocations Males Medetomidine Midazolam Neck Oviducts Ovum Implantation Pregnancy Pseudocyesis Transfers, Embryo

Top products related to «Oviducts»

1
Hyaluronidase by Merck Group
Sourced in United States, Germany, Switzerland, United Kingdom, Japan, China, Italy, France, Macao, Israel, Australia, Sao Tome and Principe, Canada, Spain, Netherlands, Czechia
Hyaluronidase is an enzyme used in laboratory settings. It functions by breaking down hyaluronic acid, a component of the extracellular matrix.
2
M2 medium by Merck Group
Sourced in United States, Germany, United Kingdom, France, Japan
M2 medium is a cell culture media formulation designed for the maintenance and cultivation of mouse embryos. It provides the necessary nutrients and growth factors to support the development and growth of mouse embryos in an in vitro environment.
3
Human chorionic gonadotropin (hcg) by Merck Group
Sourced in United States, Switzerland, Germany, China, United Kingdom, Canada, Israel, Macao, Sao Tome and Principe, Japan
The HCG (Human Chorionic Gonadotropin) is a laboratory equipment product by Merck Group. It is a hormone typically used in various diagnostic and research applications. The core function of HCG is to detect and measure the levels of this hormone in biological samples.
4
M16 medium by Merck Group
Sourced in United States
M16 medium is a culture medium used for the isolation and cultivation of microorganisms. It provides the necessary nutrients and growth factors for the growth and maintenance of microbial cultures in a laboratory setting.
5
Human chorionic gonadotropin (hcg) by Aska Pharmaceutical
Sourced in Japan
HCG is a laboratory equipment used for the detection and measurement of human chorionic gonadotropin, a hormone produced during pregnancy. It is a key tool in clinical diagnostics and research applications.
6
Bovine serum albumin (bsa) by Merck Group
Sourced in United States, Germany, United Kingdom, China, Italy, Japan, France, Sao Tome and Principe, Canada, Macao, Spain, Switzerland, Australia, India, Israel, Belgium, Poland, Sweden, Denmark, Ireland, Hungary, Netherlands, Czechia, Brazil, Austria, Singapore, Portugal, Panama, Chile, Senegal, Morocco, Slovenia, New Zealand, Finland, Thailand, Uruguay, Argentina, Saudi Arabia, Romania, Greece, Mexico
Bovine serum albumin (BSA) is a common laboratory reagent derived from bovine blood plasma. It is a protein that serves as a stabilizer and blocking agent in various biochemical and immunological applications. BSA is widely used to maintain the activity and solubility of enzymes, proteins, and other biomolecules in experimental settings.
7
Ksom medium by Merck Group
Sourced in United States, United Kingdom, Germany
KSOM medium is a synthetic culture medium designed for the in vitro culture of mammalian embryos. It provides a defined and optimized environment for the growth and development of early-stage embryos.
8
Mineral oil by Merck Group
Sourced in United States, Germany, Italy, United Kingdom, France, Israel, Sao Tome and Principe, Japan, Belgium, Macao, Poland
Mineral oil is a clear, odorless, and colorless liquid derived from petroleum. It is commonly used as a lubricant, solvent, and base for various personal care and pharmaceutical products.
9
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
10
Pregnant mare serum gonadotropin by Merck Group
Sourced in United States
Pregnant mare serum gonadotropin is a hormone extracted from the serum of pregnant mares. It is a laboratory reagent used in various biological and scientific applications.

More about "Oviducts"

The oviducts, also known as fallopian tubes, are a crucial part of the female reproductive system.
These tubes connect the ovaries to the uterus, providing a pathway for the ova (eggs) to travel during the ovulation process.
The oviducts play a vital role in the fertilization and early development of the embryo.
Understanding the structure and function of the oviducts is essential for researchers studying female reproductive biology, infertility, and assisted reproductive technologies (ART).
Optimizing protocols and techniques for oviduct research is crucial to ensure accurate and efficient studies.
Factors such as the composition of the culture media, the presence of enzymes like hyaluronidase, and the use of hormones like human chorionic gonadotropin (hCG) and pregnant mare serum gonadotropin (PMSG) can significantly impact the performance and outcomes of oviduct-related experiments.
Researchers may also utilize media like M2, M16, and KSOM, as well as additives like bovine serum albumin (BSA) and mineral oil, to create the optimal environment for oviduct and embryo studies.
PubCompare.ai's AI-driven protocol optimization can help researchers identify the best techniques and products for their oviduct research, ensuring they can conduct accurate and efficient studies.
By comparing protocols from literature, preprints, and patents, the platform can assist researchers in locating the most effective methods and materials, ultimately enhancing the quality and reliability of their findings.