Log In Sign up
The largest database of trusted experimental protocols
> Anatomy > Body Part > Vertebral Column

Vertebral Column

The vertebral column, also known as the spine or backbone, is a central structural component of the human body.
It consists of a series of interconnected vertebrae that provide support, flexibility, and protection for the spinal cord.
This complex system plays a crucial role in facilitating movement, transmitting forces, and safeguarding the delicate nervous system.
Ongoing research into the vertebral column explores advancements in areas such as biomechanics, spinal injuries, degenerative conditions, and surgical interventions.
By leveraging the power of data-driven comparisons, scientists can identify optimal solutions to enhance the understanding and treatment of vertebral column-related isssues, improving patient outcomes and advancing the field of musculoskeletal health.

Most cited protocols related to «Vertebral Column»

1
Molecular Dynamics Protocol for Biomolecular Simulations
Initial helical conformations were defined as all amino acids having (φ, ψ)=(−60°, −40°). Initial extended conformations were defined as all (φ, ψ)=(180°, 180°). Native conformations, as appropriate, were defined for each system as below. Explicit solvation was achieved with truncated octahedra of TIP3P water16 with a minimum 8.0 Å buffer between solute atoms and box boundary. All structures were built via the LEaP module of Ambertools. Except where otherwise indicated, equilibration was performed with a weak-coupling (Berendsen) thermostat33 and barostat targeted to 1 bar with isotropic position scaling as follows. With 100 kcal mol−1 Å−2 positional restraints on protein heavy atoms, structures were minimized for up to 10000 cycles and then heated at constant volume from 100 K to 300 K over 100 ps, followed by another 100 ps at 300 K. The pressure was equilibrated for 100 ps and then 250 ps with time constants of 100 fs and then 500 fs on coupling of pressure and temperature to 1 bar and 300 K, and 100 kcal mol−1 Å−2 and then 10 kcal mol−1 Å−2 Cartesian positional restraints on protein heavy atoms. The system was again minimized, with 10 kcal mol−1 Å−2 force constant Cartesian restraints on only the protein main chain N, Cα, and C for up to 10000 cycles. Three 100 ps simulations with temperature and pressure time constants of 500 fs were performed, with backbone restraints of 10 kcal mol−1 Å−2, 1 kcal mol−1 Å−2, and then 0.1 kcal mol−1 Å−2. Finally, the system was simulated unrestrained with pressure and temperature time constants of 1 ps for 500 ps with a 2 fs time step, removing center-of-mass translation and rotation every picosecond.
SHAKE34 was performed on all bonds including hydrogen with the AMBER default tolerance of 10−5 Å for NVT and 10−6 Å for NVE. Non-bonded interactions were calculated directly up to 8 Å. Beyond 8 Å, electrostatic interactions were treated with cubic spline switching and the particle-mesh Ewald approximation35 in explicit solvent, with direct sum tolerances of 10−5 for NVT or 10−6 for NVE. A continuum model correction for energy and pressure was applied to long-range van der Waals interactions. The production timesteps were 2 fs for NVT and 1 fs for NVE.
Maier J.A., Martinez C., Kasavajhala K., Wickstrom L., Hauser K.E, & Simmerling C. (2015). ff14SB: Improving the accuracy of protein side chain and backbone parameters from ff99SB. Journal of chemical theory and computation, 11(8), 3696-3713.
Publication 2015
Amber Amino Acids Buffers Cuboid Bone Debility Electrostatics Helix (Snails) Hydrogen-5 Immune Tolerance nucleoprotein, Measles virus Pressure Proteins Solvents Vertebral Column
2
Evaluating Protein Structure Prediction Accuracy
The predicted structure is compared to the true structure from the PDB in terms of lDDT metric34 (link), as this metric reports the domain accuracy without requiring a domain segmentation of chain structures. The distances are either computed between all heavy atoms (lDDT) or only the Cα atoms to measure the backbone accuracy (lDDT-Cα). As lDDT-Cα only focuses on the Cα atoms, it does not include the penalty for structural violations and clashes. Domain accuracies in CASP are reported as GDT33 (link) and the TM-score27 (link) is used as a full chain global superposition metric.
We also report accuracies using the r.m.s.d.95 (Cα r.m.s.d. at 95% coverage). We perform five iterations of (1) a least-squares alignment of the predicted structure and the PDB structure on the currently chosen Cα atoms (using all Cα atoms in the first iteration); (2) selecting the 95% of Cα atoms with the lowest alignment error. The r.m.s.d. of the atoms chosen for the final iterations is the r.m.s.d.95. This metric is more robust to apparent errors that can originate from crystal structure artefacts, although in some cases the removed 5% of residues will contain genuine modelling errors.
Jumper J., Evans R., Pritzel A., Green T., Figurnov M., Ronneberger O., Tunyasuvunakool K., Bates R., Žídek A., Potapenko A., Bridgland A., Meyer C., Kohl S.A., Ballard A.J., Cowie A., Romera-Paredes B., Nikolov S., Jain R., Adler J., Back T., Petersen S., Reiman D., Clancy E., Zielinski M., Steinegger M., Pacholska M., Berghammer T., Bodenstein S., Silver D., Vinyals O., Senior A.W., Kavukcuoglu K., Kohli P, & Hassabis D. (2021). Highly accurate protein structure prediction with AlphaFold. Nature, 596(7873), 583-589.
Publication 2021
Vertebral Column
3
Molecular Dynamics Simulations of Proteins
MD simulations of hen egg white lysozyme (HEWL), bovine pancreatic trypsin inhibitor (BPTI), ubiquitin (Ubq), and the B3 domain of Protein G (GB3) were performed using Desmond version 2.1.0.1 and the Amber ff99SB or the modified Amber ff99SB-ILDN force fields. The TIP3P water model20 was used for simulations of HEWL, Ubq, and GB3, and the TIP4P-Ew water model21 (link) was used for simulations of BPTI. Simulation parameters were the same as in the simulations of small helical peptides, apart from the fact that a 643 PME grid was used for HEWL and a 483 grid was used for BPTI, Ubq, and GB3. Simulations of HEWL, BPTI, Ubq, and GB3 were initiated from PDB22 (link) entries 6LYT, 5PTI, 1UBQ, and 1P7E solvated in cubic water boxes containing 10,594, 4215, 6080, and 5156 water molecules, respectively. The net charge of the proteins was neutralized with sodium or chloride ions. Each system was initially subject to energy minimization, followed by 1.2 ns of MD simulation in the NPT ensemble during which the temperature was increased linearly from 10 to 300 K, and position restraints on the backbone atoms were annealed from 1.0 to 0.0 kcal mol−1 Å−1. After this initial relaxation, each system was simulated for 6 ns in the NPT ensemble. The frame of this simulation with the volume closest to the average volume was selected as the starting conformation for a production run of 1.2 μs in the NVT ensemble. The trajectories obtained from the NVT runs were used for subsequent data analysis.
Lindorff-Larsen K., Piana S., Palmo K., Maragakis P., Klepeis J.L., Dror R.O, & Shaw D.E. (2010). Improved side-chain torsion potentials for the Amber ff99SB protein force field. Proteins, 78(8), 1950-1958.
Publication 2010
Amber Aprotinin Chlorides Cuboid Bone Helix (Snails) hen egg lysozyme Ions Peptides Protein Domain Proteins Reading Frames Sodium Ubiquitin Vertebral Column
4
Expanding the TALOS Protein Structure Database
The original TALOS protein structure database of 20 proteins (Cornilescu et al. 1999 (link)) in recent years has been upgraded to include 78 proteins, and this database is used in post-2003 release versions of the program. The current work utilizes the further expanded database of 200 proteins, originally developed for the SPARTA chemical shift prediction program (Shen and Bax 2007 (link)). This database, extracted from the BMRB, contains proteins with nearly complete backbone NMR chemical shifts (δ15N, δ13C′, δ13Cα, δ13Cβ, δ1Hα and δ1HN) as well as PDB coordinates from high-resolution X-ray structures. Details regarding the preparation of the database, including calibration of reference frequencies, etc, have been described previously (Shen and Bax 2007 (link)). For the current application, if the database entry contains two or less assigned chemical shifts for any given residue, these chemical shift entries are removed. For residues with incomplete sets of chemical shifts (less than six for non-Gly residues, less than five for Gly), a standard TALOS database search (Cornilescu et al. 1999 (link)) was performed to find the average (secondary) chemical shifts for the atoms of the center residues of the best 10 matched triplets. These predicted secondary chemical shifts were then assigned to the atom(s) with missing experimental chemical shifts of this residue. Therefore, after this adjustment the database contains residues with either complete 15N, 13C′, 13Cα, 13Cβ, 1Hα and 1HN chemical shifts, or no chemical shift values at all.
In order to study relations between NMR chemical shifts and backbone torsion angles, a three-state backbone “φ/ψ distribution” code is assigned to each residue: [1 0 0] (Alpha or “A”; −160<φ<0 and −70< ψ<60), [0 0 1] (Left-handed helix, here referred to as positive-φ or “P”; 0<φ<160 and −60< ψ<95), and [0 1 0] (Beta or “B”, comprising all others, including some residues with positive φ angles outside the P region). These regions are depicted in Figure 1A. For each residue in the database, a field was added to indicate the DSSP secondary structure (Kabsch and Sander 1983 (link)), determined from the X-ray coordinates, and further regrouped into three states: H (Helix; DSSP classification of H or G), E (Extended strand; E or B) and L (Loop; comprising DSSP classifications I, S, T and C).
Shen Y., Delaglio F., Cornilescu G, & Bax A. (2009). TALOS+: A hybrid method for predicting protein backbone torsion angles from NMR chemical shifts. Journal of biomolecular NMR, 44(4), 213-223.
Publication 2009
Helix (Snails) Proteins Radiography Triplets Vertebral Column
5
Protein Structural Alignment Using SS and TM-Score
Three kinds of quickly identified initial alignments are exploited. The first type of initial alignment is obtained by aligning the secondary structures (SSs) of two proteins using dynamic programming (DP) (19 (link)). The element of the score matrix is assigned to be 1 or 0 depending on whether or not the SS elements of aligned residues are identical. Here, a penalty of −1 for gap-opening works the best. For a given residue, an SS state (α, β or coil) is assigned based on the Cα coordinates of five neighboring residues, i.e. ith residue is assigned as α(β) when
|dj,j+k−λkα(β)|<δα(β), (j=i−2,i−1,i; k=2,3,4)
is satisfied for all dj,j+k that denotes the Cα distance between the jth and (j + k)th residues; otherwise, it is assigned to be a coil. The final assignment is further smoothed by merging and removing singlet SS states. We note that the set of eight parameters are optimized based on 100 non-homologous training proteins by maximizing the SS assignment similarity to the DSSP definition (20 (link)), which defines protein SS elements on the basis of hydrogen bond patterns and requires the full set of backbone atomic coordinates. The optimized parameters are λ2α=5.45Å , λ3α=5.18Å , λ4α=6.37Å , δα = 2.1 Å, λ2β=6.1Å , λ3β=10.4Å , λ4β=13Å , δβ = 1.42 Å. Using Equation 1, we achieve an average Q3 accuracy of 85% with respect to the DSSP assignment for the representative 1489 non-homologous test protein set used in Ref. (8 (link)).
The second type of initial alignment is based on the gapless matching of two structures. As in SAL (18 (link)), for the smaller of the two compared proteins, we perform gapless threading against the larger structure, but rather than use RMSD as the comparison metric as was done in SAL, now the alignment with the best TM-score is selected.
The third initial alignment is also obtained by DP using a gap-opening penalty of −1, but the score matrix is a half/half combination of the SS score matrix and the distance score matrix selected in the second initial alignment.
Zhang Y, & Skolnick J. (2005). TM-align: a protein structure alignment algorithm based on the TM-score. Nucleic Acids Research, 33(7), 2302-2309.
Publication 2005
Hydrogen Bonds Proteins SET protein, human Vertebral Column

Most recents protocols related to «Vertebral Column»

1
Molecular Modeling of ALK Inhibitor Compound 6
Not available on PMC !

Example 13

Molecular modeling study based upon the co-crystal structure of ALK with Alectinib (PDB: 3AOX) (Sakamoto, H. et al., Cancer Cell 2011, 19, 679) was performed to assess the structure-activity relationship of inhibition of ALK and/or ALK mutants by the compounds of the present application. The modeling showed that Compound 6 makes the same backbone hinge contact as Alectinib, however, Compound 6 forms two additional hydrogen bond interactions between the guanidine moiety of R1120 and the carbonyl group of the dimethyl acetamide group (FIG. 1A). Furthermore, in the G1202R mutant, Compound 6 forms an additional hydrogen bond interaction between the guanidine moiety of R1202 and the nitrogen of the pyrazole ring (FIG. 1B). The modeling study predicted that the methylene spacer between the pyrazole ring and the dimethylacetamide moiety is preferable for the carbonyl amide of Compound 6 to interact with the guanidine moiety of R1120.

US11858897B2. Substituted 6,11-dihydro-5H-benzo[b]carbazoles as inhibitors of ALK and SRPK (2024-01-02). DANA-FARBER CANCER INSTITUTE, INC. [US]. Inventors: John Hatcher [US], Nathanael S. Gray [US], Hwangeun Choi [KR], Pasi Janne [US], Tinghu Zhang [US].
Patent 2024
alectinib Amides carbene Cells dimethylacetamide Guanidine Hydrogen-6 Hydrogen Bonds Malignant Neoplasms Nitrogen Psychological Inhibition pyrazole Vertebral Column
2
Let7a-5p miRNA Inhibits STAT3 Signaling in Multiple Myeloma
Not available on PMC !

Example 6

Human multiple myeloma cancer cells are known to undergo increased cell division through IL-6-triggered STAT3 signaling. Numerous studies have shown that let7a-5p miRNA (SEQ ID NO:2) inhibits the activity of Signal Transducer and Activator of Transcription 3 (STAT3). Human multiple myeloma cells MM.1S were incubated for 48 hrs daily with 10 μg/ml polymer-modified let7a-5p miRNA as indicated and expression of the STAT3 target gene, oncogenic Bcl-xL gene, was analyzed by RT-PCR. As shown in FIG. 12B, incubation with PS polymer-modified let7a-5p miRNA inhibited expression of Bcl-xL gene.

US11857633B2. Phosphorothioate-conjugated miRNAs and methods of using the same (2024-01-02). City of Hope [US]. Inventors: Andreas Herrmann [US], Hua Yu [US].
Patent 2024
Cells Division, Cell Gene Expression Genes Homo sapiens Malignant Neoplasms MicroRNAs Multiple Myeloma Oncogenes Polymers Reverse Transcriptase Polymerase Chain Reaction STAT3 Protein Sugar Phosphates Vertebral Column
3
Synthesis and Characterization of Oligochitosan Guanidine
Not available on PMC !

EXAMPLE 1

OCG was synthesized and the average molecular weight of OCG was confirmed by both gel permeation chromatography (GPC) and proton nuclear magnetic resonance (H NMR) spectroscopy (FIG. 1), indicating that the number of CG repeating unit is ˜7. The pKa of OCG was determined as ˜5 (FIG. 2), indicating that the OCG backbone is neutral in the physiological condition while the two chain end groups (i.e., secondary amine and guanidine, FIG. 3) are positively charged. Nonhemolytic OCG showed no indication of decreased cell viability of a murine macrophage (i.e., J774) and a human liver carcinoma cell line (i.e., Hep G2) up to 200 μg/mL (FIG. 4).

US11857521B1. Anti-mycobacterial drugs (2024-01-02). None [US], None [US]. Inventors: Joong Ho Moon [US], Michelle Miranda [US].
Patent 2024
Amines Cell Lines Cell Survival Cytotoxin Gel Chromatography Guanidine Hepatocellular Carcinomas Homo sapiens Macrophage Magnetic Resonance Imaging Mus physiology Protons Spectroscopy, Nuclear Magnetic Resonance Vertebral Column
4
Expression and Purification of Polymerase Variants
Not available on PMC !

Example 1

Expression strain generation. The TdT mouse gene may be generated from the pET28 plasmid described in [Boulé et al., 1998, Mol. Biotechnol. 10, 199-208]. For example, the gene may be amplified by using the following primers:

T7-pro:
(SEQ ID No. 33)
TAATACGACTCACTATAGGG
T7-ter:
(SEQ ID No. 34)
GCTAGTTATTGCTCAGCGG
through standard molecular biology techniques. The sequence is then cloned into plasmid pET32 backbone to give the new pCTdT plasmid. After sequencing pCTdT is transformed into commercial E. coli cells, BL21 (DE3, from Novagen). Growing colonies on plate with kanamycin are isolated and named Ec-CTdT.Polymerase variants generation. The pCTdT vector is used as starting vector. Specific primers comprising one or several point mutations have been generated from Agilent online software (http://www.genomics.agilent.com:80/primerDesignProgram.jsp). The commercially available kit QuickChange II (Agilent) may be used to generate the desired modified polymerase comprising the targeted mutations. Experimental procedure follows the supplier's protocol. After generation of the different vectors, each of them is sequenced. Vectors with the correct sequence are transformed in E. coli producer strains. Clones able to grow on kanamycin LB-agar plates are isolated.

Expression. The Ec-CTdT and Ec-DSi or Ec-DSi′ strains may be used for inoculating 250 mL erlens with 50 mL of LB media supplemented with appropriate amount of kanamycin. After overnight growth at 37° C., appropriate volumes of these pre-cultures are used to inoculate 5 L erlens with 2 L LB media with kanamycin. The initial OD for the 5 L cultures is chosen to be 0.01. The erlens are put at 37° C. under strong agitation and the OD of the different cultures are regularly checked. After reaching an OD comprised between 0.6 and 0.9 each erlen is supplemented by the addition of 1 mL of 1M IPTG (Isopropyl β-D-1-thiogalactopyranoside, Sigma). The erlens are put back to agitation under a controlled temperature of 37° C. After overnight expression, the cells are harvested in several pellets. Pellets expressing the same variants are pooled and stored at −20° C., eventually for several months.

Extraction. Previously prepared pellets are thawed in 30 to 37° C. water bath. Once fully thawed, pellets are resuspended in lysis buffer composed of 50 mM tris-HCL (Sigma) pH 7.5, 150 mM NaCl (Sigma), 0.5 mM mercaptoethanol (Sigma), 5% glycerol (Sigma), 20 mM imidazole (Sigma) and 1 tab for 100 mL of protease cocktail inhibitor (Thermofisher). Careful resuspension is carried out in order to avoid premature lysis and remaining of aggregates. Resuspended cells are lysed through several cycles of French press, until full color homogeneity is obtained. Usual pressure used is 14,000 psi. Lysate is then centrifuged for 1 h to 1h30 at 10,000 rpm. Centrifugate is pass through a 0.2 μm filter to remove any debris before column purification.

Purification. A one-step affinity procedure is used to purify the produced and extracted polymerase enzymes. A Ni-NTA affinity column (GE Healthcare) is used to bind the polymerases. Initially the column has been washed and equilibrated with 15 column volumes of 50 mM tris-HCL (Sigma) pH 7.5, 150 mM NaCl (Sigma) and 20 mM imidazole (Sigma). Polymerases are bound to the column after equilibration. Then a washing buffer, composed of 50 mM tris-HCL (Sigma) pH 7.5, 500 mM NaCl (Sigma) and 20 mM imidazole (Sigma), is applied to the column for 15 column volumes. After wash the polymerases are eluted with 50 mM tris-HCL (Sigma) pH 7.5, 500 mM NaCl (Sigma) and 0.5M imidazole (Sigma). Fractions corresponding to the highest concentration of polymerases of interest are collected and pooled in a single sample. The pooled fractions are dialyzed against the dialysis buffer (20 mM Tris-HCl, pH 6.8, 200 mM Na Cl, 50 mM MgOAc, 100 mM [NH4]2SO4). The dialysate is subsequently concentrated with the help of concentration filters (Amicon Ultra-30, Merk Millipore). Concentrated enzyme is distributed in small aliquots, 50% glycerol final is added, and those aliquots are then frozen at −20° C. and stored for long term. 5 μL of various fraction of the purified enzymes are analyzed in SDS-PAGE gels.

US11859217B2. Terminal deoxynucleotidyl transferase variants and uses thereof (2024-01-02). DNA Script [FR]. Inventors: Elise Champion [FR], Jéröme Loc'h [FR], Mikhael Soskine [FR], Elodie Sune [FR].
Patent 2024
2-Mercaptoethanol Agar Bath Buffers Cells Clone Cells Cloning Vectors Dialysis Dialysis Solutions Enzymes Escherichia coli Freezing Gels Genes Glycerin imidazole Isopropyl Thiogalactoside Kanamycin Mus Mutagenesis, Site-Directed Oligonucleotide Primers Pellets, Drug Plasmids Point Mutation Premature Birth Pressure SDS-PAGE SERPINA1 protein, human Sodium Chloride Tromethamine Vertebral Column
5
Enhancing miRNA Cellular Internalization
Not available on PMC !

Example 4

miRNAs with naturally occurring sequences were fused covalently to a phosphorothioated single-stranded abasic sugar-phosphate backbone (PS) 20meric polymer to facilitate cellular internalization targeting intracellular molecular targets. A non-phosphorothioated, phosphodiester single-stranded abasic sugar-phosphate backbone polymer (PO) extension of the miRNAs was employed as a non-internalizing control.

Applicants modified naturally occurring miRNAs, for example, let7a-5p (SEQ ID NO:2) by attaching a phosphorothioated single-stranded abasic sugar-phosphate backbone (PS) 20meric polymer to the 3′ end of the miRNAs via a chemical linker (FIG. 11A). Applicants designed the modification based on that phosphorothioated ssDNA oligo enables successful intracellular delivery, but bases (nucleic acids) may not be required to facilitate intracellular delivery of the conjugate and thus may be excluded. FIG. 11B schematically shows the abasic sugar-phosphate module (referred as “D”) lacking a base (a nucleic acid) in comparison to basic “spacers.” Applicants used an alkyl chain harboring a fluorophore as a linker to track the conjugate molecule.

US11857633B2. Phosphorothioate-conjugated miRNAs and methods of using the same (2024-01-02). City of Hope [US]. Inventors: Andreas Herrmann [US], Hua Yu [US].
Patent 2024
Acids Cell Nucleus Cells DNA, Single-Stranded MicroRNAs Nucleic Acids Obstetric Delivery Oligonucleotides Phosphates Polymers Protoplasm Sugar Phosphates Vertebral Column

Top products related to «Vertebral Column»

1
Lipofectamine 2000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
2
Fd rapid golgistain kit by FD NeuroTechnologies
Sourced in United States
The FD Rapid GolgiStain Kit is a laboratory tool designed for the rapid and efficient staining of neuronal morphology in biological samples. It utilizes a modified Golgi staining technique to selectively visualize the intricate structures of individual neurons within a given tissue.
3
Lipofectamine 3000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, Japan, United Kingdom, France, Canada, Italy, Australia, Switzerland, Denmark, Spain, Singapore, Belgium, Lithuania, Israel, Sweden, Austria, Moldova, Republic of, Greece, Azerbaijan, Finland
Lipofectamine 3000 is a transfection reagent used for the efficient delivery of nucleic acids, such as plasmid DNA, siRNA, and mRNA, into a variety of mammalian cell types. It facilitates the entry of these molecules into the cells, enabling their expression or silencing.
4
Polybrene by Merck Group
Sourced in United States, Germany, China, Sao Tome and Principe, United Kingdom, Macao, Canada, France, Japan, Switzerland, Italy, Australia, Netherlands, Morocco, Israel, Ireland, Belgium, Denmark, Norway
Polybrene is a cationic polymer used as a transfection reagent in cell biology research. It facilitates the introduction of genetic material into cells by enhancing the efficiency of DNA or RNA uptake.
5
T4 dna ligase by New England Biolabs
Sourced in United States, China, United Kingdom, Germany, Japan, France, Canada, Morocco, Switzerland, Australia
T4 DNA ligase is an enzyme that catalyzes the formation of phosphodiester bonds between adjacent 3'-hydroxyl and 5'-phosphate termini in DNA. It is commonly used in molecular biology for the joining of DNA fragments.
6
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
7
Magnetom skyra by Siemens
Sourced in Germany, United States
The MAGNETOM Skyra is a magnetic resonance imaging (MRI) system developed by Siemens. It is designed to provide high-quality imaging for various medical applications. The MAGNETOM Skyra utilizes advanced technology to generate detailed images of the body's internal structures without the use of ionizing radiation.
8
Pspax2 by Addgene
Sourced in United States, Switzerland, China, Japan, Germany, United Kingdom, France, Canada
PsPAX2 is a packaging plasmid used for the production of lentiviral particles. It contains the necessary genes for lentiviral packaging, but does not contain the viral genome. PsPAX2 is commonly used in lentiviral production workflows.
9
Geneart by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, France, Italy, New Zealand
The GeneArt is a laboratory equipment product designed for genetic engineering and molecular biology applications. It provides tools and functionalities for DNA synthesis, assembly, and modification. The core function of the GeneArt is to enable researchers and scientists to create and manipulate genetic constructs for various experimental and research purposes.
10
Dulbecco modified eagle medium (dmem) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.

More about "Vertebral Column"

Exploring the Vertebral Column: A Comprehensive Overview

The vertebral column, also known as the spine or backbone, is a central structural component of the human body.
This complex system of interconnected vertebrae plays a crucial role in facilitating movement, transmitting forces, and safeguarding the delicate nervous system.
Ongoing research into the vertebral column explores advancements in areas such as biomechanics, spinal injuries, degenerative conditions, and surgical interventions.
Synonyms and Related Terms:
The vertebral column is also referred to as the spinal column or rachis.
Other related terms include the cervical, thoracic, lumbar, sacral, and coccygeal regions of the spine, as well as conditions like scoliosis, kyphosis, and lordosis.
Key Subtopics:
Biomechanics of the Vertebral Column: Understanding the complex interplay of vertebrae, discs, and ligaments that enable spinal flexibility, load-bearing, and stability.
Spinal Injuries and Trauma: Investigating the causes, effects, and treatment options for injuries like herniated discs, fractures, and spinal cord damage.
Degenerative Conditions: Exploring the pathogenesis and management of age-related conditions affecting the vertebral column, such as osteoarthritis and intervertebral disc degeneration.
Surgical Interventions: Advancements in minimally invasive procedures, implants, and fusion techniques to address vertebral column-related issues and improve patient outcomes.
Tools and Techniques:
Lipofectamine 2000 and Lipofectamine 3000 are transfection reagents that can be used to study gene expression and signaling pathways in vertebral column-related cells and tissues.
The FD Rapid GolgiStain Kit is a histological technique that allows for the visualization of neuronal structures within the spinal cord.
Polybrene and T4 DNA ligase are commonly used in viral transduction and gene cloning experiments, which can contribute to our understanding of vertebral column development and disease.
FBS (Fetal Bovine Serum) is a essential supplement for cell culture media, enabling the growth and maintenance of vertebral column-derived cells in the laboratory.
The MAGNETOM Skyra is a high-field MRI scanner that can provide detailed imaging of the vertebral column, aiding in the diagnosis and monitoring of various spinal conditions.
PsPAX2 and GeneArt are tools used for lentiviral vector production and gene synthesis, respectively, which can be leveraged in vertebral column-related research.
DMEM (Dulbecco's Modified Eagle Medium) is a common cell culture medium used to support the growth and study of vertebral column-derived cell lines.
By leveraging the power of data-driven comparisons, scientists can identify optimal solutions to enhance the understanding and treatment of vertebral column-related issues, improving patient outcomes and advancing the field of musculoskeletal health.
OtherTerms: spine, backbone, rachis, cervical, thoracic, lumbar, sacral, coccygeal, scoliosis, kyphosis, lordosis, biomechanics, spinal injuries, degenerative conditions, surgical interventions, Lipofectamine, FD Rapid GolgiStain Kit, Polybrene, T4 DNA ligase, FBS, MAGNETOM Skyra, PsPAX2, GeneArt, DMEM