Log In Sign up
The largest database of trusted experimental protocols
> Anatomy > Body Space or Junction > Transverse Sinuses

Transverse Sinuses

Transverse Sinuses: The pair of venouse channels located in the posterior cranial fossa that recieve blood from the superior petrosl and occipital sinuse.
These sinuses continue as the sigmoid sinuse and ultimately drain into the internal jugular veins.
Optimizing research protocols and enhancing reproducibility for studies involving the transverse sinuses can be streamlined using AI-driven solutions like PubCompare.ai, which help identify best practices from the literature, preprints, and patents.

Most cited protocols related to «Transverse Sinuses»

1
Abdominal Compartment Syndrome Rat Model
In deeply anesthetized rats (intraperitoneal (ip) injected 40 mg/kg thiopental (Rotexmedica, Germany) and 10 mg/kg diazepam (Apaurin; Krka, Slovenia)), we induced abdominal compartment syndrome by intraperitoneal insufflation of ordinary air controlled by a manual and digital manometer with a data logger connected to a computer (DD890, Dostmann Electronic GmbH, Germany) and maintained high abdominal pressure at 25 mmHg for 120 min before sacrifice, with a pressure measurement interval of 1 s. High abdominal pressure at 25, 30, 40, or 50 mmHg was maintained until sacrifice at 60 min (25 mmHg), 30 min (30 mmHg, 40 mmHg), or 15 min (50 mmHg). Rats received BPC 157 (10 µg or 10 ng/kg subcutaneously) or saline (5 ml) at 10 min abdominal compartment syndrome-time. Alternatively, using esketamine anesthesia (40 mg/kg esketamine (Rotexmedica, Germany) and 10 mg/kg diazepam (Apaurin; Krka, Slovenia) intraperitoneally), we induced abdominal compartment syndrome as described before and maintained high abdominal pressure at 25 mmHg for 120 min before sacrifice. Medication (BPC 157 (10 µg or 10 ng/kg sc) or saline (5 ml)) was given after 10 min of high abdominal pressure.
Recordings of brain swelling were performed in rats before sacrifice after complete calvariectomy was performed (Gojkovic et al., 2021a (link); Knezevic et al., 2021a (link); Knezevic et al., 2021a (link); Knezevic et al., 2021b (link)). Briefly, six burr holes were drilled in three horizontal lines, all of them medially to the superior temporal lines and temporalis muscle attachments. The two rostral burr holes were placed just basal from the posterior interocular line, the two basal burr holes were placed just rostral to the lambdoid suture (and transverse sinuses) on both sides, respectively, and the two middle burr holes were placed in line between the basal and rostral burr holes.
Rats were laparatomized before sacrifice for the corresponding presentation of the peripheral vessels (azygos vein, superior mesenteric vein, portal vein, inferior caval vein, and abdominal aorta). The recording was performed with a camera attached to a VMS-004 Discovery Deluxe USB microscope (Veho, United States) at the end of the experiment and assessed as before (Gojkovic et al., 2021a (link); Knezevic et al., 2021a (link); Knezevic et al., 2021a (link); Knezevic et al., 2021b (link); Strbe et al., 2021 (link)).
Tepes M., Gojkovic S., Krezic I., Zizek H., Vranes H., Madzar Z., Santak G., Batelja L., Milavic M., Sikiric S., Kocman I., Simonji K., Samara M., Knezevic M., Barisic I., Lovric E., Strbe S., Kokot A., Sjekavica I., Kolak T., Skrtic A., Seiwerth S., Boban Blagaic A, & Sikiric P. (2021). Stable Gastric Pentadecapeptide BPC 157 Therapy for Primary Abdominal Compartment Syndrome in Rats. Frontiers in Pharmacology, 12, 718147.
Full text: Click here
Publication 2021
Abdomen Abdominal Compartment Syndrome Aortas, Abdominal Apaurin Blood Vessel BPC 157 Cerebral Edema Dental Anesthesia Diazepam Esketamine Fingers Insufflation Manometry Microscopy Pharmaceutical Preparations Pressure Rattus Saline Solution Sutures Temporal Muscle Thiopental Transverse Sinuses Trephining Vein, Mesenteric Veins Veins, Azygos Veins, Portal Vena Cavas, Inferior
2
Microinjection and Electroporation in Rat Brainstem
As previously described (Guo et al., 2006 (link)), rats were anesthetized with 2–3% isoflurane in a gas mixture of 30% O2 balanced with nitrogen and placed in a Kopf stereotaxic instrument (Kopf Instruments, Tujunga, CA, USA). A midline incision was made after infiltration of lidocaine (2%) into the skin. A midline opening was made in the skull with a dental drill to insert a microinjection needle into the target site. The RVM is termed for collective structures that consist of the midline nucleus raphe magnus (NRM) and the adjacent gigantocellular reticular nucleus alpha part (NGCα). The coordinates for the NRM were as follows:10.5 mm caudal to bregma, midline and 9.0 mm ventral to the surface of the cerebellum (Paxinos and Watson, 2005 ). To avoidpenetration of the transverse sinus, the incisor bar was setat 4.7 mm below the horizontal plane passing through the interaural line. Animals were subsequently maintained at ~1% halothane. Microinjections were performed by delivering drug solutions slowly over a 10 min period using a 0.5 μl Hamilton syringewith a 32 gauge needle. For gene transfer, SuresilencingTM shRNA plasmids for Rat Tph-2 were used to design the enclosed shRNA (Tph-2: TCAACATGCTCCATATTGAAT) or scrambled control (negative control Tph-2: ggaatctcattcgatgcatac) and contained the GFP gene (SuperArray, Frederick, MD, USA). Each vector (0.5 μg/0.5 μl) was injected into the RVM. The injection needle was left in placefor at least 15 min before being slowly withdrawn. A pair of Teflon coated silver positive and negative electrodes were placed around the microinjection sites rostrocaudally. For transfer of negatively charged plasmid into RVM neurons, seven square wave electric pulses (50 ms, 40 V, 1 Hz; model 2100; A-M Systems, Carlsborg, WA, USA) were delivered. The wound was closed and animals returned to their cages after they recovered from anesthesia. In some experiments, control or Tph-2 shRNA plasmids was injected to the RVM and then followed by placing electrodes without electroporation. In addition, some groups of animals at 3 d after gene transfer were subjected to injection of the human recombinant brain-derived neurotrophic factor (BDNF, 100 fmol, Amgen, Thousand Oaks, CA) (Guo et al., 2006 (link)), the μ-opioid receptor agonist [D-Ala2, NMePhe4, Gly-ol5] enkephalin (DAMGO, 40 or 100 pmol/0.5μl), Sigma, St Louis, MO, USA) (Hurley et al., 2003 ), or the κ-opioid receptor (KOR) agonist trans-(±)-3,4-Dichloro-N-methyl-N-[2-(1-pyrrolidinylcyclohexyl] benzeneacetamide hydrochloride (U50488, 5 or 20 nmol/0.5 μl, Sigma, St Louis, MO, USA) (Hirata et al., 2000 (link)) or N-methyl-N-((5R,7S,8S)-7-(1-pyrrolidinyl)-1-oxaspiro(4.5)dec-8-yl)benzeneacetamide (U69593, 0.1, 0.5 or 3 nmol/0.5 μl) (Pan et al., 1997 (link); Ackley et al., 2001 (link)). BDNF, DAMO and U50488 were dissolved in ACFS. U69593 was dissolved in 10% (w/v) 2-hydroxy-b-cyclodextrin, Sigma, St Louis, MO, USA). The control rats underwent identicalprocedures with injection of the same volume (0.5 μl) of the vehicles. All wound margins were covered with a local anestheticointment (Nupercainal; Rugby Laboratories), the wound was closed, and animals returned to their cages after they recovered from anesthesia.
Wei F., Dubner R., Zou S., Ren K., Bai G., Wei D, & Guo W. (2010). Molecular Depletion of Descending Serotonin Unmasks Its Novel Facilitatory Role in the Development of Persistent Pain. The Journal of Neuroscience, 30(25), 8624-8636.
Publication 2010
Anesthesia Animals brain-derived neurotrophic factor, human Cell Nucleus Cerebellum Cleft Palate, Cardiac Defect, Genital Anomalies, and Ectrodactyly Cloning Vectors Cranium Cyclodextrins Dental Health Services Drill Electricity Electroporation Therapy Enkephalin, Ala(2)-MePhe(4)-Gly(5)- Enkephalins Genes Gene Transfer, Horizontal Halothane Incisor Isoflurane Lidocaine Microinjections Needles Neurons Nitrogen Nucleus Raphe Magnus Nupercainal Opioid Receptor Pharmaceutical Solutions Plasmids Pulses Quercus Rattus Receptors, Opioid, mu Short Hairpin RNA Silver Skin Teflon Transverse Sinuses U-50488 Wounds
3
Extracranial BoNT-A Injections and Meningeal Nociceptor Responses
Male Sprague-Dawley rats weighing 150–170 g were briefly anesthetized (2% isoflurane) and injected with BoNT-A (onabotulinumtoxinA; final dose = 5 units) using two different injection paradigms. In the first paradigm, four injections of BoNT-A (each containing 1.25 units diluted in 5 μl saline) were made along the lambdoid (two injection sites) and sagittal (two injection sites) sutures (Figure 1(a)). In the second paradigm, eight BoNT-A injections (each containing 0.625 units) were made: two along the sagittal suture, two in the temporalis muscle and four in the trapezius muscle (Figure 1(b)). All injections were given at the animal facility between 1 p.m. and 4 p.m. Seven days later, injected rats (by now weighing 250–300 g—housed in a specific pathogen-free facility equipped with solid bottom cages of 1800 cm2 of floor space and hardwood chip bedding; kept at 12 hours light/dark cycle, 22–26℃, and inspected twice daily for signs of stress or discomfort) were anesthetized with urethane (1.8 g/kg intraperitoneally (i.p.)) and prepared for single-unit recording of C- and Aδ-meningeal nociceptors. All electrophysiological experiments were carried out between 9 a.m. and 6 p.m. in a room especially fitted for electrophysiological recording in deeply anesthetized rats. To test for effects of extracranial injections of BoNT-A on responses of meningeal nociceptors to stimulation of their intracranial (dural) receptive fields, testing determined mechanical response threshold and responses to topical application of the TRPV1 agonist capsaicin and the TRPA1 agonist MO. For comparisons, similar experiments were carried out in 47 naïve and 25 sham rats (i.e. rats in which recordings were made seven days after they were anesthetized with 2% isoflurane and injected with vehicle at the same sites as the muscle-plus-suture group). As the results from the two control groups were very similar (e.g. scatterplots in Figure 2(b) and (c)) and not statistically different, they were combined for statistical comparisons.

Injection paradigm. (a) The suture paradigm consisted of four injections of BoNT-A, each containing 1.25 units, along the superior sagittal and transverse sinuses. (b) The suture-plus-muscle paradigm consisted of eight injections of BoNT-A, each containing 0.625 units. As depicted by the red dots, four injections were made in the clavicotrapezius muscle, two in the temporalis muscle, and two along the superior sagittal suture. BoNT-A: onabotulinumtoxinA.

Mechanical threshold for activation of C- and Aδ-meningeal nociceptors from their dural receptive fields are not affected by extracranial BoNT-A injections. (a) Mechanical response threshold of three different C-type meningeal nociceptors recorded in control rat (top), and in rats treated seven days earlier with BoNT-A injections into the sutures (middle) or the suture plus muscles (bottom). Boxed inset in each plot shows the shock artifact, the spike waveform, and the response latency. (b), (c) Mechanical thresholds for all C-units (b) and Aδ-units (c), shown as scattergraphs (top) and boxplots (bottom). Blue, control rats; red, suture-injected rats; green, suture-plus-muscle injected rats. In the scatterplots for the control rats, the filled and open circles represent values recorded in naïve and saline-injected rats, respectively. Boxplots illustrate median (thick horizontal line), interquartile range (25th–75th percentile; lower and upper box boundaries) and observations below and above the 25th and 75th percentile (whiskers) of the mechanical response threshold. Note that mechanical threshold values represent the smallest mechanical force capable of activating the neurons (i.e. innocuous force). BoNT-A: onabotulinumtoxinA.

Zhang X., Strassman A.M., Novack V., Brin M.F, & Burstein R. (2016). Extracranial injections of botulinum neurotoxin type A inhibit intracranial meningeal nociceptors’ responses to stimulation of TRPV1 and TRPA1 channels: Are we getting closer to solving this puzzle?. Cephalalgia, 36(9), 875-886.
Publication 2016
Animals Capsaicin DNA Chips incobotulinumtoxinA Isoflurane Males Meninges Muscle Tissue Neurons Nociceptors onabotulinum toxin A Rats, Sprague-Dawley Rattus norvegicus Saline Solution Shock Specific Pathogen Free Sutures Temporal Muscle Transverse Sinuses Trapezius Muscle Urethane Vascular Access Ports Vibrissae
4
Tracing SPON Projections to IC in Rats
Thirteen female albino rats (body weight 190–210 g) with clean ear canals and no sign of middle ear infection were used in this study. These specimens were also used for the study of SPON projections to the IC described in a previous article (Saldaña et al., 2009 (link)). All animals were cared for and used in compliance with European Union regulations concerning the use of animals in biomedical research, and the experimental procedures were approved and supervised by the Animal Care and Use Committee of the University of Salamanca. For surgical procedures, including the transcardial perfusion of fixatives, all animals were deeply anesthetized with a mixture of ketamine HCl (80 mg/kg body weight) and xylazine (6 mg/kg body weight) administered intramuscularly. Animal suffering was minimized by monitoring the depth of anesthesia often, carefully attending to physiological cues such as rate and depth of respiration and reflex activity. Supplemental doses of anesthetics were given as needed to maintain deep anesthesia throughout all procedures.
Glass micropipettes loaded with the neuroanatomical tracer biotinylated dextran amine (BDA, 10,000 MW, Molecular Probes, Eugene, OR, USA; 10% in 0.1 M sodium phosphate buffer, pH 7.4) were lowered into the SPON of deeply anesthetized rats using stereotaxic coordinates (Paxinos and Watson, 2007 ). To avoid damage to the prominent transverse sinus, the pipettes were lowered into the brain via a dorsocaudal to ventrorostral approach, so that their trajectory formed a 16° angle with the coronal plane. The tracer was delivered by iontophoresis using a pulsed 5 μA DC positive current (7 s on/7 s off) for 5–15 min. The current was then stopped and the pipette left in place for an additional 15–20 min prior to withdrawal in order to minimize leakage of the tracer along the injection tract.
Following 7–10 days survival, the rats were anesthetized deeply and their brains fixed by transcardial perfusion of buffered 4% formaldehyde (prepared from freshly depolymerized paraformaldehyde) and 0.1% glutaraldehyde. After cryoprotection in 30% sucrose in phosphate buffer, the brains were cut coronally on a freezing microtome at a thickness of 40 μm. To visualize the tracer, the sections were first processed by the avidin–biotin–peroxidase complex procedure following the manufacturer's specifications (ABC, Vectastain, Vector Labs, Burlingame, CA, USA), and then by standard histochemistry for peroxidase, with or without heavy-metal intensification (Vetter et al., 1993 (link)). For cytoarchitectural reference, every fourth section was counterstained with cresyl violet.
Sections were photographed at high resolution using a Zeiss Axioskop 40 microscope equipped with a Zeiss AxioCam MRc 5 digital camera and 2.5× (NA 0.075), 5× (NA 0.15), 10× (NA 0.30), 20× (NA 0.50), and 40× (NA 0.75) plan semi-apochromatic objective lenses. Image brightness and contrast were adjusted with Adobe Photoshop software (Adobe Systems Incorporated, San Jose, CA, USA), and the illustrations were arranged into plates using Canvas software (ACD Systems of America, Inc., Miami, FL, USA).
To generate the drawings of Figure 2, the sections were first photographed at high resolution with the 5× objective lens. At this magnification, several micrographs were needed to photograph every section. These photographs were then arranged and fitted using Adobe Photoshop software to create a large mosaic image of the section. The resulting digital image was imported into Canvas software. To increase the resolution of the final image, a new layer was created over the digital image and each labeled fiber contained within the original micrograph was redrawn digitally using Canvas’ freehand drawing tool. This digital procedure allowed us to subsequently adjust the thickness of the lines. The new digital layer, without the underlying micrograph, was finally saved as a TIFF file.
A similar procedure was used to produce the plots showing the distribution of presumed labeled synaptic boutons in Figures 6 and 7. To convey a clear impression of synaptic bouton density, each plot of Figure 7 was subsequently transferred to a Photoshop document and blurred using a Gaussian filter with a 20-pixel square matrix.
Viñuela A., Aparicio M.A., Berrebi A.S, & Saldaña E. (2011). Connections of the Superior Paraolivary Nucleus of the Rat: II. Reciprocal Connections with the Tectal Longitudinal Column. Frontiers in Neuroanatomy, 5, 1.
Publication 2010
Albinism Anesthesia Anesthetics Animals Avidin Biotin biotinylated dextran amine Body Weight Brain Buffers Cell Respiration Cloning Vectors cresyl violet External Auditory Canals Females Fibrosis Fixatives Formaldehyde Glutaral Histocytochemistry Iontophoresis Ketamine Hydrochloride Lens, Crystalline Metals, Heavy Microscopy Microtomy Molecular Probes Operative Surgical Procedures Otitis Media paraform Perfusion Peroxidase Phosphates physiology Presynaptic Terminals Rattus Reflex sodium phosphate Sucrose Transverse Sinuses Xylazine
5
Mapping Motor Cortex Projections
Subjects were sedated with 1 mg/kg ketamine intramuscularly (i.m.), then anesthetized with 1.5–2.5% isofluorane. After mounting in a stereotaxic frame, a frontoparietal craniotomy was performed to expose both the right motor cortex. At each of 127 injection sites (59 locations, many at multiple depths; Fig. 1) in the right primary motor cortex, approximately 150 nanoliters of lysine-fixable biotinylated dextran amine (BDA; 10% in H20; 10,000 molecular weight; Molecular Probes, Eugene, OR) was injected with a pulled glass micropipette (outside diameter at tip ~40 μm) attached to a picospritzer (Parker Hannifin Corp., Fairfield, NJ). These sites included areas of motor cortex that innervate: 1) the hand and arm: 84 injections were made at 28 locations, 1.5 and 2.5 mm anterior to the central sulcus, spanning a territory from 13.3 to 24.5 mm lateral to the sagittal sinus and at depths in each site of 2.0, 3.5 and 5.5 mm (Fig. 1); 2) the trunk: 11 injections were made at 11 locations, 1.5 mm anterior to the central sulcus, spanning a territory from 3.9 to 12.5 mm lateral to the saggital sinus and at a depth of 2.2 mm (Fig. 1); 3) the foot and lower extremities: 32 injections were made at 20 locations, 2 and 3 mm lateral of the saggital sinus, spanning a territory from 1 to 11 mm anterior to the junction of the central sulcus and the saggital sinus and at depths ranging from 1.8 to 6.5 mm, (Fig. 1). After tracer injection, the craniotomy flap was replaced and the incision was closed.
Rosenzweig E.S., Brock J.H., Culbertson M.D., Lu P., Moseanko R., Edgerton V.R., Havton L.A, & Tuszynski M.H. (2009). Extensive Spinal Decussation and Bilateral Termination of Cervical Corticospinal Projections in Rhesus Monkeys. The Journal of comparative neurology, 513(2), 151-163.
Publication 2009
biotinylated dextran amine Cortex, Cerebral Craniotomy Foot Ketamine Lower Extremity Lysine Molecular Probes Motor Cortex Motor Cortex, Primary Reading Frames Sinuses, Nasal Surgical Flaps Transverse Sinuses Vascular Access Ports

Most recents protocols related to «Transverse Sinuses»

1
Anatomical Study of Mastoid Process
This study was an estimation survey of the overall rate in counting data, aiming for a positive rate with a keypoint within a specific-diameter circle. The difference between the sample rate (a) and the overall rate (P) was expected to be no more than 10%. Based on the sample rate of a small-scale presurvey, P=80% and a = 0.05, while the sample size = (Ua/δ)/P(1 − P), where δ = 0.10, P=0.88, a = 0.05, and Ua = 1.96 (U α is the U value corresponding to the significance level, and δ is error).
The expected sample size was finally calculated as 123 cases. Finally, for this study, 79 patients who underwent thin-section CT of the head in Enze Medical Center (Group), Enze Hospital, were randomly selected for an anatomical study. All the patients were Chinese nationals, including 97 male and 52 female patients. The minimum age was nine years old, and the maximum was 78, with 74 cases involving the left side of the skull and 75 cases involving the right. Imaging data were reconstructed using workstation (GE ADW4.6) 3D CT software (General Electric Company, USA) to create 3D skull images.
Images containing any unclear surface markers were excluded. A total of 149 hemiskull base 3D images from 79 patients were adequate for analysis (clear visualization of the entire mastoid process, the asterion, the digastric groove apex, the external auditory canal, the transverse sinus sulcus, and the sigmoid sinus sulcus).
Hu W., Zhou J., Liu Z.M., Li Y., Cai Q.F., Hu X.M, & Yu Y.B. (2023). Computed Tomography Study of the Retrosigmoid Craniotomy Keyhole Approach Using Surface Landmarks. International Journal of Clinical Practice, 2023, 5407912.
Full text: Click here
Publication 2023
Chinese Cranium Electricity External Auditory Canals Head Males Microtomy Patients Process, Mastoid Sigmoid Colon Sinuses, Nasal Transverse Sinuses Woman
2
Sigmoid Sinus Keyhole Surgical Approach
The relevant literature mostly discusses using the transverse-sinus-sigmoid junction or the superior curvature of the sigmoid sinus to set the keyhole, and only a few studies provide a clear explanation of this process [14 (link)].
In this study, the apex of the superior curvature of the sigmoid sinus groove on the 3D CT skull reconstruction images was used to determine the location of the keypoint on the medial surface of the skull. The sigmoid sinus was divided into three parts: superior curvature, vertical segment, and inferior curvature. The superior curvature is adjacent to the lower boundary of the outer edge of the tentorium. It begins where the transverse sinus ends, at the point where the sinus starts to curve inferiorly, and it ends where the curvature stops, which is where the vertical segment begins. Point E was defined as the keypoint on the medial surface of the skull. It was at the inner edge of the superior curvature of the sigmoid sinus along the angular bisector of the intersection of the lines passing through the central axis of the transverse sinus and the vertical segment of the sigmoid sinus (Figures 1(a) and 1(b)). Point E was the projection of this point on the lateral surface of the skull (Figures 1(c) and 1(d)), while the hole that was drilled with the keypoint as its center was the keyhole.
Hu W., Zhou J., Liu Z.M., Li Y., Cai Q.F., Hu X.M, & Yu Y.B. (2023). Computed Tomography Study of the Retrosigmoid Craniotomy Keyhole Approach Using Surface Landmarks. International Journal of Clinical Practice, 2023, 5407912.
Full text: Click here
Publication 2023
Cranium Epistropheus Reconstructive Surgical Procedures Sigmoid Colon Sinuses, Nasal Tentorium Cerebelli Transverse Sinuses Upper Extremity
3
Quantitative Analysis of CSF Spaces
The delineated CSF space was separated manually from the final CSF mask in ITK-SNAP into seven compartments (Appendix 1—figure 3B– ‘Filtration and labeling’), for further statistical comparison: lateral ventricles; third ventricle; fourth ventricle; basilar artery; basal perivascular space at the skull base surrounding the Circle of Willis; parietal perivascular spaces and cisterns (ventrally from the position of posterior cerebral artery, via space neighboring the transverse sinuses and dorsally to the junction of the superior sagittal sinus and transverse sinuses); remaining perivascular space within the olfactory area, surrounding anterior cerebral and frontopolaris arteries, middle cerebral arteries branches, and posterior cisterns including pontine and cisterna magna. For supplementary comparison, the segmented lateral, third and fourth ventricular spaces were considered jointly as the ventricular space, and the basilar, basal and the remaining anterior/posterior CSF spaces were considered jointly as the whole perivascular space. Number of voxels was counted, and the volume of each segment was calculated by multiplying the voxels count by the voxel dimension from the original 3D-CISS image, for subsequent statistical comparison.
To compensate for the brain capsule volume differences and provide a reliable measure of the brain’s CSF space volume between animals, a ratio of the CSF to the brain volume (intracranial volume) was calculated for each delineated CSF segment as: RatioCSFspace=CSFcompartmentvolumeBrainvolume−CSFwholesegmentedvolume
The ratios obtained for each of the CSF compartments, as well as the segmented brain volumes were compared between KO and WT animals using nonparametric Mann-Whitney U-test.
Gomolka R.S., Hablitz L.M., Mestre H., Giannetto M., Du T., Hauglund N.L., Xie L., Peng W., Martinez P.M., Nedergaard M, & Mori Y. (2023). Loss of aquaporin-4 results in glymphatic system dysfunction via brain-wide interstitial fluid stagnation. eLife, 12, e82232.
Full text: Click here
Publication 2023
Animals Arteries Base of Skull Basilar Artery Brain Brain Perivascular Spaces Capsule Circle of Willis CISH protein, human Filtration Heart Ventricle Magna, Cisterna Middle Cerebral Artery Pons Posterior Cerebral Artery Sense of Smell Sinus, Superior Sagittal Transverse Sinuses Ventricle, Lateral Ventricles, Fourth Ventricles, Third
4
Immediate Implant Placement in Maxillary Molar Region
Reporting of this study follows the STROBE (Strengthening the Reporting of Observational Studies in Epidemiology) guidelines11 (link),12 (link). A retrospective study was conducted on 148 implants in 106 patients who received immediate implant placement at the Department of Oral and Maxillofacial Surgery, Seoul National University Dental Hospital from 2011 to 2019. The study protocol and access to patient records were approved by the Institutional Review Board of Seoul National University, Seoul, Korea (No. S-D20200007). All methods were performed in accordance with the relevant guidelines and regulations of the Declaration of Helsinki.
The following inclusion criteria were applied:
(1) Immediate implant placement following tooth extraction in the maxillary molar region.
(2) No contraindications to surgical procedures.
(3) Implant treatment using tapered, sand-blasted, large-grit, and acid-etched (SLA) surfaced internal dental implants.
The exclusion criteria were as follows:
(1) Simultaneous sinus augmentation via the lateral window technique.
(2) Lack of pre- and postoperative clinical and radiographic data.
Informed consent was obtained from patients, and clinical and radiograph examinations were carried out. Preoperative radiographs were obtained to check the root configuration, periapical condition, maxillary sinus condition, proximity of roots with the maxillary sinus, and ABH.
Mustakim K.R., Eo M.Y., Lee J.Y., Myoung H., Seo M.H, & Kim S.M. (2023). Guidance and rationale for the immediate implant placement in the maxillary molar. Journal of the Korean Association of Oral and Maxillofacial Surgeons, 49(1), 30-42.
Publication 2023
Acids Dental Health Services Ethics Committees, Research Implant, Dental Maxilla Maxillary Sinus Molar Operative Surgical Procedures Patients Periapical Diseases Physical Examination Plant Roots Sinus Disease, Paranasal Tooth Extraction Tooth Root Transverse Sinuses X-Rays, Diagnostic
5
Maxillary Sinus Lift Procedure Protocols
This study employed the lateral window technique during surgery. The surgeries were performed under aseptic conditions using a regional blockade of the posterior superior alveolar, infraorbital, and greater palatine nerves and a terminal infiltrative at the bottom of the vestibule and palate to anesthetize. When the maxillary sinus floor did not meet the ridge crest or when there was a minimal area of keratinized tissue, the lateral wall of the maxillary sinus was accessed through a full thickness mucoperiosteal flap incised over the alveolar crest or the slightly palatalized ridge crest. The length and divergence of the anterior and posterior relaxing incisions were chosen to provide access to the region of interest while allowing a good baseline blood supply to the flap. To avoid flap dehiscence, the incisions were located at some distance from the proposed antrostomy, which was subsequently planned based on clinical evaluation and tomographic images.
The Schneiderian membrane was then accessed through the delimitation of the osteotomy that was performed with a minimal exposure of the sinus membrane to facilitate its elevation with adequate visibility, at 3 mm from the anterior wall and floor of the maxillary sinus, considering that the main blood supply for the future graft stems from the bone walls and not from the Schneiderian membrane. The osteotomy was performed using a straight hand piece with a 2 mm spherical diamond drill at 22000 rpm. Drilling was performed with anterior-superior and lateral-lateral movements, without applying pressure on the bone wall to avoid perforating the sinus membrane, until a slight movement of the “bone island” was perceived and a dark shadowed area became visible. From this moment on, detachment and removal of the bone window and adequate elevation of the Schneiderian membrane were performed.
With the exposure of the receptor site, bone substitutes from the 3 groups (autogenous, xenogenous, and alloplastic) and respective brands were emplaced to fill the maxillary floor. The flaps were repositioned, starting with the suturing of the relaxing incisions and ending with the suturing of the incision over the alveolar crest, with synthetic and absorbable Vicryl (polyglactin 910) 4-0 suture (Johnson & Johnson). After the grafting stage, the patients were maintained under postoperative control. The treatment of sinus membrane perforations was performed using a collagen membrane (Colla Tape, Zimmer) to cover the perforated region. The membrane was sutured respecting a safety margin of 1-2 mm, followed by an 8 month healing period to allow the sinus membrane to repair and repeat the procedure.
For the second-stage surgeries, CBCTs were performed to verify the bone dimensions for implant installation with a total flap incision. Implant diameters were selected based on the local bone availability and the desired insertion torque of at least 45 Ncm, as determined by a torque ratchet (Manual Torque Ratchet, Neodent). All implants were installed according to the manufacturer's recommended standards and guidelines, avoiding excess torque. Complications that occurred during execution of the procedures, such as membrane perforation, exaggerated graft resorption, and partial or total loss, were documented as an integrant part of the analysis of the results of these reconstructive procedures, along with installation of prosthetic crowns and follow-ups during periodic returns.
Jamcoski V.H., Faot F., Marcello-Machado R.M., Melo A.C, & Fontão F.N. (2023). 15-Year Retrospective Study on the Success Rate of Maxillary Sinus Augmentation and Implants: Influence of Bone Substitute Type, Presurgical Bone Height, and Membrane Perforation during Sinus Lift. BioMed Research International, 2023, 9144661.
Full text: Click here
Publication 2023
Asepsis Binding Sites Bones Bone Substitutes Collagen Crista Ampullaris Crowns Diamond Grafts Maxilla Maxillary Sinus Movement Neck Nervousness Operative Surgical Procedures Osteotomy Palate Patients Polyglactin 910 Pressure Reconstructive Surgical Procedures Ridge, Alveolar Schneiderian Membrane Sinuses, Nasal Stem, Plant Surgical Flaps Tissue, Membrane Tissues Tomography Torque Transverse Sinuses Vestibular Labyrinth Vicryl

Top products related to «Transverse Sinuses»

1
Coherent opal photoactivator by Lumenis
The Coherent Opal Photoactivator is a lab equipment product that provides a controlled source of light for photoactivation experiments. It is designed to emit a specific wavelength of light to trigger photochemical reactions or activate photosensitive materials in a laboratory setting.
2
Stereotaxic frame by Kopf Instruments
Sourced in United States, Germany, Italy
The Stereotaxic frame is a laboratory instrument used to immobilize and position the head of a subject, typically an animal, during surgical or experimental procedures. It provides a secure and reproducible method for aligning the subject's head in a three-dimensional coordinate system to enable precise targeting of specific brain regions.
3
Visudyne by Lumenis
Visudyne is a laser-activated photosensitizer used in photodynamic therapy (PDT) for the treatment of wet age-related macular degeneration (AMD) and other ophthalmological conditions. It is administered intravenously and then activated by a non-thermal diode laser, which triggers a photochemical reaction that selectively damages abnormal blood vessels in the eye.
4
Stereotaxic apparatus by Stoelting
Sourced in United States, Ireland, Germany, Israel
A stereotaxic apparatus is a specialized laboratory instrument used to precisely position and orient surgical instruments or experimental tools within a subject's brain or other three-dimensional anatomical structure. It provides a standardized frame of reference to accurately target specific regions of the brain or body for various research and clinical applications.
5
45 bevel hamilton syringe by Hamilton Company
Sourced in United States
The 45° bevel Hamilton syringe is a laboratory equipment item designed for precise fluid handling. It features a 45-degree angled needle tip to facilitate smooth and controlled liquid transfer. The syringe is available in a range of sizes to accommodate various volume requirements.
6
Stereotaxic frame by Stoelting
Sourced in United States, Israel, Ireland, Sweden, France
The Stereotaxic Frame is a precision instrument used in neuroscience research to immobilize an animal's head in a fixed position. It allows for the accurate placement of microelectrodes, injection needles, or other tools within the brain of the subject.
7
Text to fcs conversion function by Tree Star
The Text to FCS conversion function is a core feature of our lab equipment product. It allows users to convert text-based data into the FCS (Flow Cytometry Standard) format, which is widely used in flow cytometry analysis. This function provides a convenient way to process and prepare data for further analysis within the lab equipment.
8
Innova 4100 iq by GE Healthcare
Sourced in United States
The Innova 4100-IQ is a general-purpose imaging system designed for a variety of laboratory and research applications. It features a high-resolution digital camera and advanced imaging capabilities to capture and analyze images of various samples.
9
Agilent 54622d by Agilent Technologies
Sourced in Germany
The Agilent 54622D is a two-channel digital oscilloscope that provides real-time digital acquisition and display of analog waveforms. It features a bandwidth of 100 MHz and a maximum sample rate of 2 GSa/s. The oscilloscope offers a range of standard functions, including triggering, cursors, and automated measurements.
10
Spss statistics ver 22 by IBM
Sourced in United States, Japan
SPSS Statistics ver. 22.0 is a software application for statistical analysis. It provides a comprehensive set of tools for data management, analysis, and presentation. The software is designed to handle a wide range of data types and supports a variety of statistical techniques, including regression analysis, hypothesis testing, and multivariate analysis.

More about "Transverse Sinuses"

The transverse sinuses are a pair of venous channels located in the posterior cranial fossa, responsible for draining blood from the superior petrosal and occipital sinuses.
These sinuses continue as the sigmoid sinuses and ultimately drain into the internal jugular veins.
Optimizing research protocols and enhancing reproducibility for studies involving the transverse sinuses can be streamlined using AI-driven solutions like PubCompare.ai, which help identify best practices from the literature, preprints, and patents.
Researchers studying the transverse sinuses may also encounter terms like the Coherent Opal Photoactivator, a device used for fluorescence imaging, the Stereotaxic frame, a tool for precise instrument placement, and Visudyne, a photosensitive drug used in photodynamic therapy.
The Stereotaxic apparatus, a 3D coordinate system for positioning, and the 45° bevel Hamilton syringe, a tool for precise liquid delivery, may also be relevant.
The Text to FCS conversion function, a tool for data analysis, as well as the Innova 4100-IQ and Agilent 54622D, which are analytical instrumentation, could also be encountered in this field of study.
Additionally, the SPSS Statistics ver. 22.0 software may be utilized for statistical analysis.
Optimizing research protocols and enhancing reproducibility for studies involving the transverse sinuses can be streamlined using AI-driven solutions like PubCompare.ai, which help identify best practices from the literature, preprints, and patents.
This can lead to more efficient and reliable research, ultimately advancing our understanding of the transverse sinuses and their role in the body.