> Anatomy > Cell Component > Cell Nucleus

Cell Nucleus

The cell nucleus is a membranous, organelle-containing structure that houses the genetic material and controls the activities of a eukaryotic cell.
It is the centralized command center, regulating gene expression, DNA replication, and cellular processes.
The cell nucleus plays a crucial role in cell division, growth, and development.
Researching the structure, function, and regulation of the cell nucleus is essential for understanding fundamental biological mechanisms and advancing fields like genetics, cell biology, and medicine.
PubCompare.ai's AI-powered tools can help accelertae these discoveries by quickly locating the best protocols, products, and pre-prings from the literature to optimize your cell nucleus research.

Most cited protocols related to «Cell Nucleus»

RNA-seq Library Preparation from HEK293T Cells

Nuclear RNA was prepared from HEK293T (kidney) cells. Briefly, cells were lysed on ice for 5 min in 10 mM Tris-HCl pH 7.5, 10 mM NaCl, 0.2 mM EDTA, 0.05% NP-40, and nuclei were spun at 2,500g for 3 min and then resuspended in QIAzol for RNA isolation using the miRNeasy kit according to the manufacturer’s instructions (Qiagen). The RNA-seq library was created using the Illumina TruSeq RNA Sample Preparation Kit v2 with the standard protocol, and sequenced on one lane of the HiSeq 2000 platform (100 bp, paired-end). Data are available at NCBI as accession number SRP041943. The database of annotated protein coding and noncoding genes (41,409 genes and 171,904 transcripts in total) was produced by merging all annotated genes from the RefSeq database^{29 (link)}, the UCSC Browser^{24 (link)} and the Ensembl database^{30 (link)}.

Pertea M., Pertea G.M., Antonescu C.M., Chang T.C., Mendell J.T, & Salzberg S.L. (2015). StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nature biotechnology, 33(3), 290-295.

Publication 2015

Cell Nucleus Cells DNA Library Edetic Acid Genes isolation Kidney Nonidet P-40 RNA, Nuclear RNA-Seq Sodium Chloride Standard Preparations Tromethamine

High-Throughput Chromatin Conformation Capture

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2014

Cell Lines Cell Nucleus Cells Formaldehyde Ligation Microtubule-Associated Proteins Nucleotides Streptavidin Technique, Dilution

Automated Quantification of p53 in Tumor Cells

Preprocessing steps were applied as described above. QuPath’s Cell detection command was then used to identify cells across all cores based upon nuclear staining. This command additionally estimates the full extent of each cell based upon a constrained expansion of the nucleus region, and calculates up to 33 measurements of intensity and morphology, including nucleus area, circularity, staining intensity for hematoxylin and DAB, and nucleus/cell area ratio. Because not all of these measurements are expected to provide independent or useful information with regard to cell classification, a subset of 16 measurements was chosen empirically and supplemented for each cell by measuring the local density of cells, and taking a Gaussian-weighted sum of the corresponding measurements within neighboring cells using QuPath’s Add smoothed features command. A two-way random trees classifier was then interactively trained to distinguish tumor epithelial cells from all other detections (comprising non-epithelial cells, necrosis, or any artefacts misidentified as cells) and applied across all slides (see Supplementary Video 2). Intensity thresholds were set to further subclassify tumor cells as being negative, weak, moderate or strongly positive for p53 staining based upon mean nuclear DAB optical densities. An H-score was calculated for each tissue core by adding 3x% strongly stained tumor nuclei, 2x% moderately stained tumor nuclei, and 1x% weakly stained tumor nuclei^{32 (link)}, giving results in the range 0 (all tumor nuclei negative) to 300 (all tumor nuclei strongly positive).

Bankhead P., Loughrey M.B., Fernández J.A., Dombrowski Y., McArt D.G., Dunne P.D., McQuaid S., Gray R.T., Murray L.J., Coleman H.G., James J.A., Salto-Tellez M, & Hamilton P.W. (2017). QuPath: Open source software for digital pathology image analysis. Scientific Reports, 7, 16878.

Full text: Click here

Publication 2017

Cell Nucleus Cells Debility Epithelial Cells Hematoxylin Necrosis Neoplasms Neoplasms, Epithelial Tissues Trees Vision

Sequencing and Assembly of Rice Genome

The IRGSP clone and PCR sequences of the O. sativa (japonica group, cultivar Nipponbare) genome deposited in the International Nucleotide Sequence Databases as of 25 February 2010 were used in construction of the MTP. In addition, sequence reads generated by the Syngenta rice genome sequencing project (Goff et al. 2002 (link)) were assembled and used to extend contigs.
For the next-generation DNA sequencing of an NIAS individual, total genomic DNA was prepared from nuclei isolated from Nipponbare rice young leaves (two weeks after germination) using the CTAB method (Murray and Thompson 1980 (link)). The DNA samples were fragmented by a nebulizer or Branson Sonifier 250 (Danbury, CT). Sequencing libraries were constructed following the protocols with Illumina Genomic DNA Sample Preparation Kit and Roche GS DNA Library Preparation Kit, respectively. Illumina genome sequencing was performed by Illumina Genome Analyzer II/IIx with the Illumina version 2 sequencing kit. GS-FLX genome sequencing was performed using the Roche GS LR70 Sequencing Kit. The sequence reads are available at the DDBJ Sequence Read Archive (DRA000651).
For the CSHL individual, ~5 μg of Nipponbare rice genomic DNA was used as input for standard Illumina libraries. The DNA was sheared by adaptive focused acoustics using the Covaris (Woburn, MA) instrument and end-repaired using T4 DNA polymerase, Klenow fragment, and T4 polynucleotide kinase. Fragments were then treated with Klenow fragment (3’ - 5’ exonuclease) to add a single 3’ deoxyA overhang and ligated to standard paired-end Illumina adapters. Qiagen (Valencia, CA) columns were used for purification between steps. The fragments were size-selected at ~225 bp (including adapters) using agarose gel electrophoresis. The actual insert size excluding adapters was ~150 bp. The library was then PCR amplified using Phusion DNA polymerase in HF buffer for 14 cycles and quantified using the Agilent BioAnalyzer (Santa Clara, CA). All libraries were normalized to 10 nM before loading on the Illumina sequencers. Production sequencing was performed using Illumina GAIIx instruments with paired-end modules using the Illumina version 3 sequencing kits. The library was sequenced with 76 bp paired-end read lengths. Sequence data was processed using the Illumina GAPipeline v1.1 and v1.3.2 (Firecrest/Bustard v1.9.6 and Firecrest/Bustard v1.3.2). The sequence reads are available at the Sequence Read Archive of NCBI (SRX032913).
Syngenta rice genome sequences (Goff et al. 2002 (link)) were filtered by using IRGSP rice genomic sequences with similarity searches. The filtered sequences were then assembled; 50 large Syngenta contigs (between 4 kb and 40 kb), a total of 748 kb were used for potential gap filling.

Kawahara Y., de la Bastide M., Hamilton J.P., Kanamori H., McCombie W.R., Ouyang S., Schwartz D.C., Tanaka T., Wu J., Zhou S., Childs K.L., Davidson R.M., Lin H., Quesada-Ocampo L., Vaillancourt B., Sakai H., Lee S.S., Kim J., Numa H., Itoh T., Buell C.R, & Matsumoto T. (2013). Improvement of the Oryza sativa Nipponbare reference genome using next generation sequence and optical map data. Rice, 6, 4.

Full text: Click here

Publication 2013

3'-5'-Exonucleases A-748 Acclimatization Acoustics Buffers Cell Nucleus Cetrimonium Bromide Clone Cells DNA-Directed DNA Polymerase DNA Library DNA Polymerase I Electrophoresis, Agar Gel Genome Germination Nebulizers Oryza sativa Polynucleotide 5'-Hydroxyl-Kinase

Nuclei Isolation for ATAC-Seq Analysis

See Supplementary
Protocol 2 for a detailed protocol. This protocol is highly similar
to the INTACT method^{19 (link)} and
either protocol can be used for the isolation of nuclei with equivalent results.
All of the steps were carried out at 4 °C. A frozen tissue fragment ~20
mg was placed into a pre-chilled 2-ml Dounce homogenizer containing 2 ml of cold
1× homogenization buffer (320 mM sucrose, 0.1 mM EDTA, 0.1%
NP40, 5 mM CaCl₂, 3 mM Mg(Ac)₂, 10 mM Tris pH 7.8,
1× protease inhibitors (Roche, cOmplete), and 167 μM
β-mercaptoethanol, in water). Tissue was homogenized with approximately
ten strokes with the loose ‘A’ pestle, followed by 20 strokes
with the tight ‘B’ pestle. Connective tissue and residual debris
were precleared by filtration through an 80-μm nylon mesh filter
followed by centrifugation for 1 min at 100 r.c.f. While avoiding the pelleted
debris, 400 μl was transferred to a pre-chilled 2-ml round bottom
Lo-Bind Eppendorf tube. An equal volume (400 μl) of a 50%
iodixanol solution (50% iodixanol in 1× homogenization buffer)
was added and mixed by pipetting to make a final concentration of 25%
iodixanol. 600 μl of a 29% iodixanol solution (29%
iodixanol in 1× homogenization buffer containing 480 mM sucrose) was
layered underneath the 25% iodixanol mixture. A clearly defined
interface should be visible. In a similar fashion, 600 μl of a
35% iodixanol solution (35% iodixanol in 1×
homogenization containing 480 mM sucrose) was layered underneath the 29%
iodixanol solution. Again, a clearly defined interface should be visible between
all three layers. In a swinging-bucket centrifuge, nuclei were centrifuged for
20 min at 3,000 r.c.f. After centrifugation, the nuclei were present at the
interface of the 29% and 35% iodixanol solutions. This band with
the nuclei was collected in a 300 μl volume and transferred to a
pre-chilled tube. Nuclei were counted after addition of trypan blue, which
stains all nuclei due to membrane permeabilization from freezing. 50,000 counted
nuclei were then transferred to a tube containing 1 ml of ATAC-seq RSB with
0.1% Tween-20. Nuclei were pelleted by centrifugation at 500 r.c.f. for
10 min in a pre-chilled (4 °C) fixed-angle centrifuge. Supernatant was
removed using the two pipetting steps described above. Because the nuclei were
already permeabilized, no lysis step was performed, and the transposition mix
(25 μl 2× TD buffer, 2.5 μl transposase (100 nM final),
16.5 μl PBS, 0.5 μl 1% digitonin, 0.5 μl
10% Tween-20, 5 μl water) was added directly to the nuclear
pellet and mixed by pipetting up and down six times. Transposition reactions
were incubated at 37 °C for 30 min in a thermomixer with shaking at
1,000 r.p.m. Reactions were cleaned up with Zymo DNA Clean and Concentrator 5
columns. The remainder of the ATAC-seq library preparation was performed as
described previously¹⁸.

Corces M.R., Trevino A.E., Hamilton E.G., Greenside P.G., Sinnott-Armstrong N.A., Vesuna S., Satpathy A.T., Rubin A.J., Montine K.S., Wu B., Kathiria A., Cho S.W., Mumbach M.R., Carter A.C., Kasowski M., Orloff L.A., Risca V.I., Kundaje A., Khavari P.A., Montine T.J., Greenleaf W.J, & Chang H.Y. (2017). An improved ATAC-seq protocol reduces background and enables interrogation of frozen tissues. Nature methods, 14(10), 959-962.

Publication 2017

2-Mercaptoethanol ATAC-Seq Buffers Cell Nucleus Centrifugation Cerebrovascular Accident Connective Tissue Digitonin DNA Library Edetic Acid Filtration iodixanol isolation Nylons Protease Inhibitors Sucrose Tissue, Membrane Tissues Transposase Tromethamine Trypan Blue Tween 20

Most recents protocols related to «Cell Nucleus»

Bioceramic Composition Enhances Cell Adhesion

Not available on PMC !

Example 8

Cell adhesion was also evaluated by means of in vitro scratch wound-healing assay. HDPSCs cells were analyzed by difference in staining with phalloidin (cell nucleus) and DAPI to visualize actin cytoskeleton.

Cell adhesion results showed excellent interaction and adhesion between neighboring cells in the presence of bioceramic composition. The Bioceramic composition sealer (CB5) and Bioceramic composition repair (CB6), showed a gradual increase in growth over time, an extended morphology and a high content of F-Actin (cell microfilamen), reaching confluence after 72 hours of culture.

The analysis of cell proliferation (via cell viability study), apoptosis, cell adhesion and morphology (via cell adhesion study) and migration (via cell migration study) showed very positive results, indicating that the proposed bioceramic composition induces the odonto/osteogenic mineralization and differentiation process in the presence of tooth-specific human stem cells (hDPSCs pulp). While a market resin sealer was also used in the comparative studies, however, all results were not satisfactory for this product.

US11857558B2. Dental and medical compositions having a multiple source of metallic ions (2024-01-02). ANGELUS INDÚSTRIA DE PRODUTOS ODONTOLÓGICOS S/A [BR]. Inventors: César Eduardo Bellinati [BR], Cristiane Vila [BR], William Pereira Dos Santos [BR], Maíra Bendlin Calzavara [BR].

Full text: Click here

Patent 2024

Apoptosis Biological Assay Cell Adhesion Cell Nucleus Cell Proliferation Cell Survival DAPI Dental Pulp Differentiations, Cell F-Actin Homo sapiens Microfilaments Migration, Cell Osteogenesis Phalloidine Physiologic Calcification Resins, Plant Stem, Plant Stem Cells Tooth

Protein synthesis inhibition and SMN localization

Not available on PMC !

Example 4

The protein synthesis inhibitor-induced nuclear accumulation of SMN is not the result of general cell toxicity as no reduction in cell viability was monitored even after an overnight treatment of these cells with 10 μM CHX, conditions in which all of the SMN was localized to the nucleus. In addition, the nuclear accumulation is specific to the localization of SMN and not the result of general mis-localization of proteins, as the localization of many other, both nuclear and cytoplasmic proteins that were examined, including the RNA-binding proteins hnRNP A1, poly(A)-binding protein (PABP), FXR1 and snRNPs, was not significantly affected (FIG. 3c).

Furthermore, the effect was reversible as SMN staining gradually re-appeared in the cytoplasm when cells were washed and placed in fresh medium devoid of cycloheximide. A similar effect of protein synthesis inhibitors was also observed in several other cell types and in other species, including U2OS cells and both human and mouse fibroblasts, and was independent of the amount of SMN they contained. Hela cells with reduced SMN by RNAi, compared to control cells expressing a non-targeting shRNA, showed a similar effect (FIG. 9).

US11866764B2. Method for testing and screening p38 MAP kinase modifiers (2024-01-09). THE TRUSTEES OF THE UNIVERSITY OF PENNSYLVANIA [US]. Inventors: Gideon Dreyfuss [US], Mumtaz Kasim [US].

Full text: Click here

Patent 2024

Cell Nucleus Cells Cell Survival Cycloheximide Cytoplasm Fibroblasts HeLa Cells Heterogeneous Nuclear Ribonucleoprotein A1 Homo sapiens Mus Poly(A)-Binding Proteins Proteins Protein Synthesis Inhibitors RNA-Binding Proteins RNA Interference Short Hairpin RNA Small Nuclear Ribonucleoproteins

Chemically Modified miRNAs for Intracellular Targeting

Not available on PMC !

Example 1

miRNAs with naturally occurring sequences were fused covalently to phosphorothioated ssDNA (PS) 20meric oligo to facilitate cellular internalization targeting intracellular molecular targets. A non-phosphorothioated, phosphodiester ssDNA oligo (PO) extension of the miRNAs was employed as a non-internalizing control.

Applicants modified naturally occurring miRNAs, for example, let7a-3p (SEQ ID NO:1) (FIG. 1), let7a-5p (SEQ ID NO:2) (FIG. 3), miR17-3p (SEQ ID NO:3) (FIG. 5), miR17-5p (SEQ ID NO:4) (FIG. 7), and miR218-5p (SEQ ID NO:5) (FIG. 9) by attaching a phosphorothioated ssDNA (PS) 20meric oligo to the 3′ end of the miRNAs via a chemical linker. Examples of a phosphorothioated ssDNA (PS) 20meric oligo include, but are not limited to, SEQ ID NO:6 (TCCATGAGCTTCCTGATGCT) and SEQ ID NO:7 (AGCATCAGGAAGCTCATGGA). Applicants designed that the modification by ssDNA oligo avoids any C/G or G/C motifs, because it is known that CpG oligodeoxynucleotides (CpG-ODN) involve undesired Toll-like receptor (TLR) engagement and subsequent intracellular signaling. Applicants used an alkyl chain harboring a fluorophore as a linker to track the conjugate molecule.

US11857633B2. Phosphorothioate-conjugated miRNAs and methods of using the same (2024-01-02). City of Hope [US]. Inventors: Andreas Herrmann [US], Hua Yu [US].

Full text: Click here

Patent 2024

Acids Cell Nucleus Cells CPG-ODN DNA, Single-Stranded MicroRNAs Oligonucleotides Protoplasm Toll-Like Receptors

Lipid Staining in Liver Tissue

Not available on PMC !

Example 18

Frozen tissue sections of liver were cut at 10 μm and air dried to the slides. After fixation in 10% formalin for 5 min, the slides were briefly washed with running tap water for 10 min, followed by rinse with 60{circumflex over ( )} isopropanol. Subsequently, oil red O working solution (0.3% oil red O) was used for lipid staining for 15 min. Slides were again rinsed with 60% isopropanol and then nuclei were lightly stained with alum haematoxylin, followed by rinse with distilled water and mounted in glycerine jelly. After half an hour, pictures were taken under microscopy.

Exemplary data are shown in FIG. 19, in which reduced lipid droplet amounts were observed after daily administration of mTA4 or mTA37 for 5 weeks.

US11865160B2. Modified therapeutic agents, stapled peptide lipid conjugates, and compositions thereof (2024-01-09). THE SCRIPPS RESEARCH INSTITUTE [US]. Inventors: Weijun Shen [US], Pengyu Yang [US], Huafei Zou [US], Peter G. Schultz [US].

Full text: Click here

Patent 2024

alum, potassium Cell Nucleus Formalin Frozen Sections Glycerin Isopropyl Alcohol Lipid Droplet Lipids Liver Microscopy solvent red 27 Tissues

Urinary ex-mRNA as a Biomarker for Myotonic Dystrophy

Not available on PMC !

Example 2

Based on qPCR cycle threshold (Ct) values of reference genes GTF2B and GAPDH, urine ex-mRNA content tended to be higher in DM1 as compared to UA subjects (FIG. 1A and FIG. 7G). The lower expression of DMPK, the gene causing DM1, in urine from DM1 vs. UA subjects may be due to retention of mutant transcripts in the nucleus preventing their release into the cytoplasm and incorporation into EVs²². In serum, these transcripts were expressed at similar levels in both DM1 and UA subjects, and were present at lower levels than in urine (FIG. 1B and FIG. 7H).

US11866783B2. Extracellular mRNA markers of muscular dystrophies in human urine (2024-01-09). The General Hospital Corporation [US]. Inventors: Thurman Wheeler [US], Xandra O. Breakefield [US], Leonora Balaj [US].

Full text: Click here

Patent 2024

Cell Nucleus Cytoplasm GAPDH protein, human Gene Expression Genes Retention (Psychology) RNA, Messenger Serum Urine

Top products related to «Cell Nucleus»

4 6 diamidino 2 phenylindole (dapi) by Merck Group

Sourced in United States, Germany, Japan, United Kingdom, China, Italy, Sao Tome and Principe, France, Macao, Canada, Switzerland, Spain, Australia, Denmark, India, Poland, Israel, Belgium, Sweden, Ireland, Netherlands, Panama, Brazil, Portugal, Czechia, Puerto Rico, Austria, Hong Kong, Singapore

DAPI is a fluorescent dye that binds strongly to adenine-thymine (A-T) rich regions in DNA. It is commonly used as a nuclear counterstain in fluorescence microscopy to visualize and locate cell nuclei.

4 6 diamidino 2 phenylindole (dapi) by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, Japan, China, Canada, Italy, Australia, France, Switzerland, Spain, Belgium, Denmark, Panama, Poland, Singapore, Austria, Morocco, Netherlands, Sweden, Argentina, India, Finland, Pakistan, Cameroon, New Zealand

DAPI is a fluorescent dye used in microscopy and flow cytometry to stain cell nuclei. It binds strongly to the minor groove of double-stranded DNA, emitting blue fluorescence when excited by ultraviolet light.

Hoechst 33342 by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, Japan, China, France, Canada, Spain, Belgium, Italy, Australia, Austria, Denmark, Netherlands, Switzerland, Ireland, New Zealand, Portugal, Brazil, Argentina, Singapore, Poland, Ukraine, Macao, Thailand, Finland, Lithuania, Sweden

Hoechst 33342 is a fluorescent dye that binds to DNA. It is commonly used in various applications, such as cell staining and flow cytometry, to identify and analyze cell populations.

Triton x 100 by Merck Group

Sourced in United States, Germany, United Kingdom, Italy, China, Japan, France, Canada, Sao Tome and Principe, Switzerland, Macao, Poland, Spain, Australia, India, Belgium, Israel, Sweden, Ireland, Denmark, Brazil, Portugal, Panama, Netherlands, Hungary, Czechia, Austria, Norway, Slovakia, Singapore, Argentina, Mexico, Senegal

Triton X-100 is a non-ionic surfactant commonly used in various laboratory applications. It functions as a detergent and solubilizing agent, facilitating the solubilization and extraction of proteins and other biomolecules from biological samples.

4 6 diamidino 2 phenylindole (dapi) by Beyotime

Sourced in China, United States, Germany, Japan, United Kingdom, Switzerland, Puerto Rico

DAPI is a fluorescent dye used in molecular biology and microscopy to stain and visualize DNA. It selectively binds to the minor groove of double-stranded DNA, emitting a blue fluorescence when excited by ultraviolet light. DAPI is commonly used for nuclear staining and counterstaining in various applications such as fluorescence microscopy and flow cytometry.

Alexa fluor 488 by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, Japan, France, Italy, Canada, China, Spain, Switzerland, Denmark, Australia, Hungary, Belgium, Ireland, Israel, Netherlands, Moldova, Republic of, India, Austria, Czechia, Poland

Alexa Fluor 488 is a fluorescent dye used in various biotechnological applications. It has an excitation maximum at 495 nm and an emission maximum at 519 nm, producing a green fluorescent signal. Alexa Fluor 488 is known for its brightness, photostability, and pH-insensitivity, making it a popular choice for labeling biomolecules in biological research.

Fluorescence microscope by Olympus

Sourced in Japan, United States, Germany, China, Italy, United Kingdom, Denmark, Switzerland, France

The Olympus Fluorescence Microscope is an optical microscope that uses fluorescence to visualize and analyze samples. It illuminates the specimen with light of a specific wavelength, causing fluorescent molecules within the sample to emit light at a different wavelength, which is then detected and displayed.

Bovine serum albumin (bsa) by Merck Group

Sourced in United States, Germany, United Kingdom, China, Italy, Japan, France, Sao Tome and Principe, Canada, Macao, Spain, Switzerland, Australia, India, Israel, Belgium, Poland, Sweden, Denmark, Ireland, Hungary, Netherlands, Czechia, Brazil, Austria, Singapore, Portugal, Panama, Chile, Senegal, Morocco, Slovenia, New Zealand, Finland, Thailand, Uruguay, Argentina, Saudi Arabia, Romania, Greece, Mexico

Bovine serum albumin (BSA) is a common laboratory reagent derived from bovine blood plasma. It is a protein that serves as a stabilizer and blocking agent in various biochemical and immunological applications. BSA is widely used to maintain the activity and solubility of enzymes, proteins, and other biomolecules in experimental settings.

In situ cell death detection kit by Roche

Sourced in Germany, United States, Switzerland, China, United Kingdom, France, Canada, Belgium, Japan, Italy, Spain, Hungary, Australia

The In Situ Cell Death Detection Kit is a laboratory product designed for the detection of programmed cell death, or apoptosis, in cell samples. The kit utilizes a terminal deoxynucleotidyl transferase (TdT) to label DNA strand breaks, allowing for the visualization and quantification of cell death. The core function of this product is to provide researchers with a tool to study and analyze cell death processes.

Paraformaldehyde (pfa) by Merck Group

Sourced in United States, Germany, United Kingdom, China, Italy, France, Macao, Australia, Canada, Sao Tome and Principe, Japan, Switzerland, Spain, India, Poland, Belgium, Israel, Portugal, Singapore, Ireland, Austria, Denmark, Netherlands, Sweden, Czechia, Brazil

Paraformaldehyde is a white, crystalline solid compound that is a polymer of formaldehyde. It is commonly used as a fixative in histology and microscopy applications to preserve biological samples.

What are the main functions of the cell nucleus?

The cell nucleus is the command center of eukaryotic cells, responsible for several crucial functions. It houses the genetic material (DNA) and controls gene expression, DNA replication, and cellular processes. The nucleus also plays a vital role in cell division, growth, and development. Understanding the structure, function, and regulation of the cell nucleus is essential for advancing fields like genetics, cell biology, and medicine.

How can researchers optimize their cell nucleus research?

PubCompare.ai's AI-powered platform can help researchers accelertae their cell nucleus discoveries. The tool allows you to screen protocol literature more efficiently and leverage AI to pinpoint critical insights. By using PubCompare.ai, you can identify the most effective protocols related to the cell nucleus for your specific research goals. The platform's AI-driven analysis can highlight key differences in protocol effectiveness, enabling you to choose the best option for reproducibility and accuracy.

What are some common challenges in studying the cell nucleus?

Studying the cell nucleus can present several challenges, such as understanding its complex structure, accurately measuring its functions, and investigating its dynamic behaviors. Researchers may also face difficulties in isolating and maintaining the integrity of the nucleus during experimentation. PubCompare.ai's AI-powered tools can help overcome these challenges by providing access to the latest protocols, products, and pre-prints from the literature, enabling researchers to optimize their experimental designs and streamline their cell nucleus research.

Are there different types or variations of the cell nucleus?

While the basic structure and function of the cell nucleus are similar across eukaryotic cells, there can be some variations depending on the cell type and organism. For example, the size, shape, and number of nuclei can differ in certain cell types, such as muscle cells or plant cells. Additionally, the organization and composition of the nuclear material can vary, influencing gene expression and cellular processes. Researchers can use PubCompare.ai to explore these nuances and find the most relevant protocols and information to study the specific type of cell nucleus relevant to their research.

More about "Cell Nucleus"

The cell nucleus is a crucial organelle in eukaryotic cells, serving as the command center and housing the genetic material.
It plays a vital role in regulating gene expression, DNA replication, and cellular processes.
Researching the structure, function, and regulation of the cell nucleus is essential for understanding fundamental biological mechanisms and advancing fields like genetics, cell biology, and medicine.
The cell nucleus is surrounded by a double-layered nuclear envelope, which acts as a barrier between the nucleus and the cytoplasm.
Inside the nucleus, the genetic material, composed of DNA and associated proteins, is organized into chromosomes.
The nucleus also contains various sub-compartments, such as the nucleolus, which is responsible for the production of ribosomes.
Techniques like fluorescence microscopy, using dyes like DAPI and Hoechst 33342, can be used to visualize and study the cell nucleus.
Permeabilization agents like Triton X-100 help facilitate the entry of these fluorescent probes into the nucleus.
Labeling with Alexa Fluor 488 or other fluorescent markers can also provide valuable insights into the organization and dynamics of nuclear structures.
Bovine serum albumin (BSA) is commonly used as a blocking agent in immunofluorescence experiments to reduce non-specific binding and improve signal-to-noise ratio.
The In Situ Cell Death Detection Kit, which utilizes terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL), can be employed to detect and quantify apoptosis or programmed cell death within the nucleus.
Fixation with paraformaldehyde is a common method for preserving the structural integrity of the cell nucleus and other cellular components for microscopic analysis.
By combining these techniques and tools, researchers can explore the intricate workings of the cell nucleus, leading to advancements in our understanding of fundamental biological processes and their implications in health and disease.