Log In Sign up
The largest database of trusted experimental protocols
> Anatomy > Cell Component > Centrosome

Centrosome

The centrosome is a cellular organelle that serves as the main microtubule-organizing center (MTOC) in animal cells.
It plays a crucial role in the proper alignment and segregation of chromosomes during cell division.
The centrosome consists of a pair of centrioles surrounded by a protein-rich matrix called the pericentriolar material (PCM).
The PCM anchors and nucleates microtubules, which are essential for various cellular processes, such as cell motility, intracellular transport, and the formation of the mitotic spindle.
Centrosome abnormalities have been linked to a variety of human diseases, including cancer and neurodegenerative disorders.
Understanding the structure, function, and regulation of the centrosome is a key area of research in cell biology and development.
The PubCompare.ai tool can help researchers optimize their centrosome studies by providing access to the latest protocols and enabling AI-driven comparisons to identify the most effective approaches.

Most cited protocols related to «Centrosome»

1
Centrosome Reorientation in Tumor Invasion
The reorientation of the centrosome during tumor invasion was assessed by 2D invasion assay. The two-well culture insert with 0.5 mm gap between wells (ibidi) was placed on a fibronectin-coated glass-bottom dish. SaOS2 cells transfected with the respective siRNAs were plated onto the culture insert and grown to confluent monolayers. After the inserts were removed, the monolayers were washed with PBS and overlaid with Matrigel (BD) diluted 1:20 in PBS, followed by incubation for 4 hr before addition of growth medium. Cells were then cultured for 24 hr to allow invasion toward the space between the monolayers. After fixation with 4% (w/v) paraformaldehyde, cells were stained with antibody to γ-tubulin to visualize the centrosome, and counterstained with DAPI. The percentages of the edge cells in which the centrosome was within the 120° sector emerging from the center of the nucleus and facing toward the space between the monolayers was measured.
Nishita M., Park S.Y., Nishio T., Kamizaki K., Wang Z., Tamada K., Takumi T., Hashimoto R., Otani H., Pazour G.J., Hsu V.W, & Minami Y. (2017). Ror2 signaling regulates Golgi structure and transport through IFT20 for tumor invasiveness. Scientific Reports, 7, 1.
Full text: Click here
Publication 2017
Biological Assay Centrosome Cerebellar Nuclei Culture Media DAPI FN1 protein, human Hyperostosis, Diffuse Idiopathic Skeletal Immunoglobulins matrigel Neoplasm Invasiveness paraform RNA, Small Interfering Tubulin
2
Time-lapse FRET Imaging of Mitotic Dynamics

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2010
Cells Centrosome Fluorescence Resonance Energy Transfer Light Medulla Oblongata Mercury Microscopy Mitosis Serum Signal Transduction Strains TNFRSF11A protein, human Training Programs
3
Fluorescent Kinetochore and Centrosome Tracking

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2011
Antibiotics Cells Centrioles Centrosome Clone Cells Kinetochores tdTomato
4
Time-lapse Imaging and FRET Analysis of Cellular Processes
Time-lapse imaging was performed on cells in L15 medium with 10% serum at 37°C using either an epifluorescence microscope (Deltavision; Applied Precision) controlled by SoftWoRx software and equipped with an inverted microscope (IX70; Olympus), an electron multiplier charge-coupled device camera (Cascade II 512K; Photometrics), and a 40× UApo NA 1.35 objective (Olympus) or a spinning-disk system (Marianas; Intelligent Imaging Innovations) controlled by Slidebook software and comprising a microscope (Axiovert Observer Z1; Carl Zeiss, Inc.) equipped with a disk-scanning unit (CSU-X1 Nipkow; Yokogawa) and a camera (QuantEM 512SC; Yokogawa). FRET imaging was performed using a CFP/YFP filter set with CFPex 436/10, CFPem 470/30, YFPem 535/30, and a CFP/YFP/mCherry dichroic C85363 (Chroma Technology Corp.). The same exposure time was used for CFPex/CFPem and CFPex/YFPem (between 100 and 200 ms). All quantifications were performed using ImageJ software (National Institutes of Health). For emission ratio measurements, we used the following formulas: whole cell signal = sum of the intensity of the pixels for one cell; mean background signal = mean signal per pixel for a region selected just beside the cell; whole cell signal corrected = whole cell signal − (area for the selected cell × mean background); and emission ratio = whole cell YFP signal corrected/whole cell CFP signal corrected.
Intensity-modulated display representations were performed using MetaMorph software according to the manufacturer's recommendations (MDS Analytical Technologies). In brief, for each intensity-modulated display, we used eight color hues and 32 intensities, ranking from dark to bright per hue. The maximum and minimum values were fixed manually and are indicated on each figure. The color intensities displayed for each hue were determined automatically by the software using one of the CFPex/YFPem images as a reference (Tsien and Harootunian, 1990 (link)).
For quantifications of cytoplasmic/nuclear ratio, we designed a region of interest corresponding approximately to one third of the nucleus and excluding centrosomes (Fig. 6 A) that could be used to quantify the nuclear signal and the cytoplasmic signal close to the nucleus in the same cell. FRAP experiments were performed using a 488-nm laser at maximum power and an exposure time of 100 ms.
Gavet O, & Pines J. (2010). Activation of cyclin B1–Cdk1 synchronizes events in the nucleus and the cytoplasm at mitosis. The Journal of Cell Biology, 189(2), 247-259.
Publication 2010
Cell Nucleus Cells Centrosome Cytoplasm Diet, Formula Electrons Fluorescence Resonance Energy Transfer Innovativeness Medical Devices Microscopy Serum TNFRSF11A protein, human
5
Characterization of Tetraploid Cell Lines
All cell lines were maintained at 37°C with 5% CO2 atmosphere. Immunofluorescence microscopy was performed as previously described 17 (link). Fixed cell images were collected by confocal immunofluorescence on a Yokogawa CSU-X1 spinning disk confocal mounted on a Nikon Ti-E inverted microscope (Nikon Instruments). Live-cell imaging was performed using a TE2000-E2 inverted Nikon microscope equipped with the Nikon Perfect Focus system enclosed within a temperature and CO2-controlled environment that maintained an atmosphere of 37°C and 3-5% humidified CO2. Sequential FACS sorting of tetraploids with 8c DNA content was used to generate tetraploid cells with two centrosomes. Detailed descriptions of FISH, karyotyping, imaging, cell lines, culture conditions, and antibodies used in this study can be found in supplementary methods.
Ganem N.J., Godinho S.A, & Pellman D. (2009). A Mechanism Linking Extra Centrosomes to Chromosomal Instability. Nature, 460(7252), 278-282.
Publication 2009
Antibodies Atmosphere Cell Lines Cells Centrosome Environment, Controlled Fishes Immunofluorescence Immunofluorescence Microscopy Microscopy Tetraploidy

Most recents protocols related to «Centrosome»

1
Chromosomally Stable Colon Cancer Cell Models
The cellular models consisted
of chromosomally stable human colon cancer DLD1 diploid (2N) and tetraploid
(4N) cells, along with tetraploid centrosome -amplified (4NCA) DLD1
cells and DLD1 HSET knockout (KO) cells. DLD1 2N and 4N cells were
generated and characterized as previously described.27 (link),41 ,42 (link) In order to generate 4NCA cells,
we used dihydro-cytochalasin B (DCB) to transiently block cytokinesis
and induce tetraploidisation and centrosome amplification in DLD1
cells. Centrosome amplification in 4NCA cells is transient and therefore
they were generated from 2N cells for each run of the assay.27 (link) The DLD1 HSET KO cells were knockout clones
generated by CRISPR and validated by sequencing to have a homozygous
deletion in the KIFC1 gene.
Saint-Dizier F., Matthews T.P., Gregson A.M., Prevet H., McHardy T., Colombano G., Saville H., Rowlands M., Ewens C., McAndrew P.C., Tomlin K., Guillotin D., Mak G.W., Drosopoulos K., Poursaitidis I., Burke R., van Montfort R., Linardopoulos S, & Collins I. (2023). Discovery of 2-(3-Benzamidopropanamido)thiazole-5-carboxylate Inhibitors of the Kinesin HSET (KIFC1) and the Development of Cellular Target Engagement Probes. Journal of Medicinal Chemistry, 66(4), 2622-2645.
Full text: Click here
Publication 2023
Biological Assay Cancer of Colon Cardiac Arrest Cells Centrosome Clustered Regularly Interspaced Short Palindromic Repeats Cytochalasin B Diploid Cell Diploidy Genes, vif Homo sapiens Tetraploidy Transients
2
Fluorescent Staining of Fertilized Oocytes
The same staining protocol was used following both IVF experiments mentioned above. After three washings in medium (PBS supplemented with 0.5% Triton-X and 2% fetal bovine serum), non-specific binding sites were blocked in saturation medium (PBS supplemented with 20% fetal calf serum and 0.5% Triton-X) for 1 h at 38.5 °C. Samples were then incubated with Hoechst staining solution (1 µg/mL) for 10 min, at room temperature, before observation under a microscope fitted with epifluorescence (Olympus BX 41). Percentages of fertilized oocytes (presence of 2 pronuclei) and development to the 2-cell stage was recorded at 17 h post-insemination. Spot Basic 5.1 software (Diagnostics Instruments) was used to capture images of oocytes and embryos. As previously reported, higher proportions of 2-cell stage at the 17 hr time point indicated a faster first cell cycle because of functional sperm centrosomes [4 (link),25 (link)].
Rowlison T, & Comizzoli P. (2023). Transfer of Galectin-3-Binding Protein via Epididymal Extracellular Vesicles Promotes Sperm Fertilizing Ability and Developmental Potential in the Domestic Cat Model. International Journal of Molecular Sciences, 24(4), 3077.
Full text: Click here
Publication 2023
Binding Sites Cells Centrosome Diagnosis Embryo Fetal Bovine Serum Germ Cells Insemination Microscopy Ovum Sperm
3
Generating p53 Knockout Cell Line
For the generation of p53 knock-out (p53KO) cell line, CRISPR/Cas9 plasmid (sc-416469) and p53 Homologous direct Recombinant-HDR plasmids (sc-416469-HDR) were transfected into MCF10A-Plk4 cells using the Neon® Transfection system. After transfection recovery, cells were selected with puromycin in order to select p53KO stable cell line. To have monoclonal stable p53KO clones, puromycin-resistant cells were sorted into single-cell clones by using a BD FACS Aria IIu.
To validate if p53 was successfully knocked-out, cells were exposed to three different conditions to determine the functionality of the p53 protein: treatment with 1 and 3 µM of Doxorubicin (mild and severe DNA damage, respectively) for 4 h and kept for 24 h in drug-free medium and, a third condition where 1 µg/ml of Doxycycline was added to cells for 24 h (inducing extra centrosomes). After the 24 h, cells were harvested for western blot analysis. Total protein levels of p53 and p21, a downstream target of p53, was assessed by Western Blot.
Fonseca I., Horta C., Ribeiro A.S., Sousa B., Marteil G., Bettencourt-Dias M, & Paredes J. (2023). Polo-like kinase 4 (Plk4) potentiates anoikis-resistance of p53KO mammary epithelial cells by inducing a hybrid EMT phenotype. Cell Death & Disease, 14(2), 133.
Full text: Click here
Publication 2023
Cell Lines Cells Centrosome Clone Cells Clustered Regularly Interspaced Short Palindromic Repeats DNA Damage Doxorubicin Doxycycline Neon NRG1 protein, human Oncoprotein p53 Pharmaceutical Preparations Plasmids Puromycin Rubella Transfection Western Blot
4
Gene Silencing in Centrosome-Aberrant Cells
P-Cadherin gene silencing (CDH3) was performed in MCF10A-Plk4p53KO using a validated siRNA, specific for CDH3 (50 nM, Hs_GCDH3_6), with the following target sequence 5’ AAGCCTCTTACCTGCCGTAAA 3′, from Qiagen (USA). P53 gene silencing was performed in MCF10A-Plk4, MCF10A-Plk41-608 and RPE-Plk4 cell lines using a specific siRNA (100 nM, L-003329-00-0020, Dharmacon). Transfections were carried out using Lipofectamine 2000 (Invitrogen), according to manufacturer’s recommended procedures. A scrambled siRNA targeting sequence 5’ AAGCCTCTTACCTGCCGTAAA 3′, with no homology to any gene, was used as a negative control (Qiagen, USA). Cells were incubated with the transfection mix for 6 h. After siRNA transfection, cells were incubated for 24 h in the presence or absence of Dox for 24 h (1 µg/ml) to induce extra centrosomes. Gene inhibition was evaluated by western blot after 31 h of cell transfection for the MFE assay and after 47 h for condition media collection.
Fonseca I., Horta C., Ribeiro A.S., Sousa B., Marteil G., Bettencourt-Dias M, & Paredes J. (2023). Polo-like kinase 4 (Plk4) potentiates anoikis-resistance of p53KO mammary epithelial cells by inducing a hybrid EMT phenotype. Cell Death & Disease, 14(2), 133.
Full text: Click here
Publication 2023
Biological Assay CDH3 protein, human Cell Lines Cells Centrosome Culture Media, Conditioned Genes lipofectamine 2000 P-Cadherin Psychological Inhibition RNA, Small Interfering Transfection Western Blot
5
Quantifying Centriole Amplification in Mitosis
Mitotic cells were observed using a Leica DMI6000 (Leica Microsystems, Germany) Microscope and images were acquired with a Hamamatsu FLASH4.0 (Hamamatsu, Japan) camera, using the HCX PL APO CS 63x/1.30 GLY 21°C objective, and the LAS X Software. Images were taken in Z-Stacks in a range of 10-14μm, with a distance between planes of 0.2μm.
We consider as centriole amplification, when mitotic cells presented more than four (>4) centrioles. In order to obtain the percentage of cells with extra centrioles, at least 100 cells were analyzed for centriole number per condition and per experiment and only centrioles positive for the two centriolar markers (Centrin-1 and CP110) were considered. Centrosomes were quantified manually, using the Fiji/Image J Software (National Institutes of Health).
Fonseca I., Horta C., Ribeiro A.S., Sousa B., Marteil G., Bettencourt-Dias M, & Paredes J. (2023). Polo-like kinase 4 (Plk4) potentiates anoikis-resistance of p53KO mammary epithelial cells by inducing a hybrid EMT phenotype. Cell Death & Disease, 14(2), 133.
Full text: Click here
Publication 2023
Apolipoproteins C Cells Centrioles Centrosome Microscopy Trimethoprim-Sulfamethoxazole Combination

Top products related to «Centrosome»

1
Nocodazole by Merck Group
Sourced in United States, Germany, United Kingdom, Japan, Sao Tome and Principe, Canada, China, Switzerland, France, Poland, Macao, Australia
Nocodazole is a synthetic compound that acts as a microtubule-destabilizing agent. It functions by binding to and disrupting the polymerization of microtubules, which are essential components of the cytoskeleton in eukaryotic cells. This property makes Nocodazole a valuable tool in cell biology research for studying cell division, cell motility, and other cellular processes that rely on the dynamics of the microtubule network.
2
Ab4448 by Abcam
Sourced in United Kingdom, United States
Ab4448 is a lab equipment product offered by Abcam. It serves as a core functional component for research applications. Details on its specific intended use are not available.
3
Matlab by MathWorks
Sourced in United States, United Kingdom, Germany, Canada, Japan, Sweden, Austria, Morocco, Switzerland, Australia, Belgium, Italy, Netherlands, China, France, Denmark, Norway, Hungary, Malaysia, Israel, Finland, Spain
MATLAB is a high-performance programming language and numerical computing environment used for scientific and engineering calculations, data analysis, and visualization. It provides a comprehensive set of tools for solving complex mathematical and computational problems.
4
Prism 6 by GraphPad
Sourced in United States, United Kingdom, Canada, China, Germany, Japan, Belgium, Israel, Lao People's Democratic Republic, Italy, France, Austria, Sweden, Switzerland, Ireland, Finland
Prism 6 is a data analysis and graphing software developed by GraphPad. It provides tools for curve fitting, statistical analysis, and data visualization.
5
Gtu 88 by Merck Group
Sourced in United States
The GTU-88 is a compact, versatile laboratory instrument designed for a variety of applications. It is capable of performing precise temperature and humidity control functions to support various experimental and testing procedures. The GTU-88 is suitable for use in a range of laboratory settings, but a detailed description of its intended use is not available.
6
4 6 diamidino 2 phenylindole (dapi) by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Japan, China, Canada, Italy, Australia, France, Switzerland, Spain, Belgium, Denmark, Panama, Poland, Singapore, Austria, Morocco, Netherlands, Sweden, Argentina, India, Finland, Pakistan, Cameroon, New Zealand
DAPI is a fluorescent dye used in microscopy and flow cytometry to stain cell nuclei. It binds strongly to the minor groove of double-stranded DNA, emitting blue fluorescence when excited by ultraviolet light.
7
Cytochalasin d by Merck Group
Sourced in United States, Germany, Macao, United Kingdom, China, Italy, Canada, Sao Tome and Principe
Cytochalasin D is a laboratory reagent that inhibits actin polymerization. It is commonly used in cell biology research to disrupt the cytoskeleton and study its role in cellular processes.
8
Thymidine by Merck Group
Sourced in United States, Germany, United Kingdom, Sao Tome and Principe, France, Italy, Japan, China
Thymidine is a nucleoside that is a component of DNA. It serves as a building block for DNA synthesis and is essential for cellular division and growth.
9
4 6 diamidino 2 phenylindole (dapi) by Merck Group
Sourced in United States, Germany, Japan, United Kingdom, China, Italy, Sao Tome and Principe, France, Macao, Canada, Switzerland, Spain, Australia, Denmark, India, Poland, Israel, Belgium, Sweden, Ireland, Netherlands, Panama, Brazil, Portugal, Czechia, Puerto Rico, Austria, Hong Kong, Singapore
DAPI is a fluorescent dye that binds strongly to adenine-thymine (A-T) rich regions in DNA. It is commonly used as a nuclear counterstain in fluorescence microscopy to visualize and locate cell nuclei.
10
Alexa fluor 488 by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, Japan, France, Italy, Canada, China, Spain, Switzerland, Denmark, Australia, Hungary, Belgium, Ireland, Israel, Netherlands, Moldova, Republic of, India, Austria, Czechia, Poland
Alexa Fluor 488 is a fluorescent dye used in various biotechnological applications. It has an excitation maximum at 495 nm and an emission maximum at 519 nm, producing a green fluorescent signal. Alexa Fluor 488 is known for its brightness, photostability, and pH-insensitivity, making it a popular choice for labeling biomolecules in biological research.

More about "Centrosome"

The centrosome, also known as the microtubule-organizing center (MTOC), is a crucial cellular organelle in animal cells that plays a pivotal role in chromosome alignment and segregation during cell division.
This protein-rich structure consists of a pair of centrioles surrounded by the pericentriolar material (PCM), which serves as the anchor and nucleation site for microtubules.
These dynamic cytoskeletal elements are essential for various cellular processes, such as cell motility, intracellular transport, and the formation of the mitotic spindle.
Centrosome abnormalities have been linked to a variety of human diseases, including cancer and neurodegenerative disorders.
Understanding the structure, function, and regulation of the centrosome is a key area of research in cell biology and development.
Researchers can utilize tools like PubCompare.ai to optimize their centrosome studies by accessing the latest protocols, while leveraging AI-driven comparisons to identify the most effective approaches.
To further enhance centrosome research, researchers may employ various chemical agents and imaging techniques.
Nocodazole, a microtubule-depolymerizing agent, can be used to study the role of microtubules in centrosome function.
Antibodies, such as Ab4448, can be utilized to visualize and analyze centrosome components.
Advanced imaging techniques, like MATLAB-based analysis and Prism 6 for statistical evaluation, can provide detailed insights into centrosome structure and dynamics.
Additionally, specific cell lines, such as GTU-88 expressing cells, and fluorescent dyes, like DAPI for DNA staining and Alexa Fluor 488 for protein labeling, can be employed to investigate centrosome-related processes.
Treatments with cytoskeletal-disrupting agents, like Cytochalasin D, or cell cycle synchronization techniques, such as Thymidine-mediated G1/S arrest, can further elucidate the role of the centrosome in cellular function.
By integrating these tools and techniques, researchers can optimize their centrosome studies, enhance reproducibility, and gain a deeper understanding of this crucial cellular organelle and its involvement in health and disease.