> Anatomy > Cell Component > Phagosomes

Phagosomes

Phagosomes are specialized intracellular vesicles formed by the invagination of the plasma membrane during the process of phagocytosis.
They play a critical role in the immune system by engulfing and digesting foreign particles, pathogens, and apoptotic cells.
Phagosome research is crucial for understanding host-pathogen interactions, antigen presentation, and cellular homeostasis.
Optimizing phagosome research can lead to advancements in immunology, infectious disease, and cell biology.
PubCompare.ai's AI-driven platform can helpl researchers easily locate the best protocols and products from literature, pre-prints, and patents to take their phagosome studies to the next level.

Most cited protocols related to «Phagosomes»

Analysis of L. pneumophila intracellular replication

L. pneumophila serogroup I parental strain AA100/130b and the mutants dotA, ankB, and complemented ankB mutants were grown as described previously [10] (link). Escherichia coli strain DH5α was used for cloning purposes. Isolation and preparation of human monocyte-derived macrophages (hMDMs) and maintenance of the macrophage-like U937 cells were performed as previously described [9] (link). Cultures of A. polyphaga and D. discoideum were performed as described previously [9] (link),[10] (link).
For intracellular proliferation studies, infections were performed as we described previously [9] (link). Briefly, macrophages were infected at a multiplicity of infection (MOI) of 10 for 1 h followed by treatment with 50 µg/ml gentamicin for 1 h to kill extracellular bacteria. At each time point, the macrophages were lysed and dilutions were plated on agar plates. For single cell analysis studies, infections were performed as we described above and at 12 h cells were fixed and processed for confocal microscopy. Phagosomes were isolated from post nuclear supernatants (PNS) of infected cells as described previously [29] (link). Samples were then fixed and probed as described below. The cya constructs were generated by PCR using specific primers (Table 1). Measurement of cAMP in cell lysates for adenylate cyclase fusion assays was performed using the Direct Cyclic AMP Enzyme Immunoassay kit (Assay Designs), as we described previously [10] (link).

Price C.T., Al-Khodor S., Al-Quadan T., Santic M., Habyarimana F., Kalia A, & Kwaik Y.A. (2009). Molecular Mimicry by an F-Box Effector of Legionella pneumophila Hijacks a Conserved Polyubiquitination Machinery within Macrophages and Protozoa. PLoS Pathogens, 5(12), e1000704.

Full text: Click here

Publication 2009

Adenylate Cyclase Agar Bacteria Biological Assay Cells Cyclic AMP Enzyme Immunoassay Escherichia coli Gentamicin Homo sapiens Infection isolation Macrophage Microscopy, Confocal Oligonucleotide Primers Parent Phagosomes Protoplasm Single-Cell Analysis Strains Technique, Dilution tetraxetan U937 Cells

Phagosome Isolation and Protein Analysis

Detailed descriptions of reagents and experiments can be found in Supplementary Methods. All stable cell lines were generated by retroviral gene transfer. For phagosome isolation, RAW cells were fed latex beads (Polysciences), the cells were disrupted by Dounce homogenization, and latex bead containing phagosomes were purified on a 62%−10% sucrose step gradient in a Beckman SW40Ti centrifuge. After purification, phagosomes were lysed by addition of TritonX-100, and proteins in phagosomes were separated by SDS-PAGE and visualized by immunoblot. Pulse/chase analyses were performed by starving cells of cysteine/methionine for 1 hour, pulsing with ³⁵S-cysteine/methionine for 45 minutes, and chasing in molar excess of unlabeled cysteine/methionine for the indicated time periods. After lysis, radiolabeled proteins were immunoprecipated and visualized by SDS-PAGE. Deglycosylation assays were performed on immunoprecipitated proteins using endoglycosidaseH or PNGaseF (both from NEB) with supplied buffers according to manufacturer's instructions. Proteins were separated by SDS-PAGE and visualized by immunoblot. In vitro proteolysis with recombinant cathepsins (Biomol) was performed according to manufacturer guidelines. For MyD88/TLR9 coimmunoprecipitations, cells were lysed in RIPA Buffer before or after stimulation with CpG, and protein complexes were precipitated with anti-FLAG matrix. For CpG binding assays, TLR9-HA containing lysates were incubated with Biotin-CpG followed by precipitation with streptavidin matrix. In both cases, precipitated proteins were visualized by SDS-PAGE followed by immunoblot. NF-κB luciferase assays were performed by transient transfection of HEK293T cells with an NF-κB luciferase reporter plasmid and the indicated expression plasmids using LTX transfection reagent (Invitrogen) according to manufacturer's instructions. C57/Bl/6 mice were purchased from Jackson Laboratories. All knockout mice have been previously described19 (link)-22 (link). Mice were housed within animal facilities at UC Berkeley or UCSF according to IACUC guidelines.

Ewald S.E., Lee B.L., Lau L., Wickliffe K.E., Shi G.P., Chapman H.A, & Barton G.M. (2008). The ectodomain of Toll-like receptor 9 is cleaved to generate a functional receptor. Nature, 456(7222), 658-662.

Publication 2008

Animals Biological Assay Biotin Buffers Cathepsins Cell Lines Cells Cysteine Gene Transfer, Horizontal Immunoblotting Institutional Animal Care and Use Committees isolation Luciferases Methionine Mice, Inbred C57BL Mice, Knockout Molar Mus Phagosomes Plasmids Proteins Proteolysis Radioimmunoprecipitation Assay RELA protein, human Retroviridae SDS-PAGE Streptavidin Sucrose Transfection Transients

Phagosome Isolation and Protein Analysis

Publication 2008

Phagosomal Lipidome Analysis by Mass Spectrometry

The phagosomal lipid extractions were performed using an established
protocol.^{16 (link),17 (link),28 (link)} Briefly, the
phagosomal preparations were washed with sterile Dulbecco’s
PBS (DPBS; three times) and transferred into a glass vial using 1
mL of DPBS. A total of 3 mL of 2:1 (v/v) chloroform (CHCl₃)/methanol (MeOH) with the internal standard mix (50 pmol of each
internal standard listed in Supporting Information Table 1) was added, and the mixture was vortexed. The two phases
were separated by centrifugation at 2800g for 5 min.
The organic phase (bottom) was removed. A total of 50 μL of
formic acid was added to acidify the aqueous homogenate, and CHCl₃ was added to make up a 4 mL volume. The mixture was vortexed,
and separated by centrifugation at 2800g for 5 min.
Both the organic extracts were pooled and dried under a stream of
N₂. The lipidome was solubilized in 200 μL of 2:1
(v/v) CHCl₃/MeOH, and 20 μL was used for the lipidomics
analysis. All the lipid species analyzed in this study were quantified
using the multiple reaction monitoring high resolution (MRM-HR) scanning
method (Supporting Information Table 1)
on a Sciex X500R QTOF mass spectrometer (MS) fitted with an Exion-LC
series UHPLC. All data were acquired and analyzed using the SciexOS
software. The LC separation was achieved using a Gemini 5U C18 column
(Phenomenex, 5 μm, 50 × 4.6 mm) coupled to a Gemini guard
column (Phenomenex, 4 × 3 mm). The LC solvents were as follows:
positive mode, buffer A, 95:5 (v/v) H₂O/MeOH + 0.1% formic
acid + 10 mM ammonium formate; buffer B, 60:35:5 (v/v) isopropanol
(IPA)/MeOH/H₂O + 0.1% (v/v) formic acid + 10 mM ammonium
formate; negative mode, buffer A, 95:5 (v/v) H₂O/MeOH +
0.1% (v/v) NH₄OH; buffer B, 60:35:5 (v/v) IPA/MeOH/H₂O + 0.1% (v/v) NH₄OH. All the lipid estimations
were performed using an electrospray ion (ESI) source, with following
MS parameters: turbo spray ion source, medium collision gas, curtain
gas = 20 L min^–1, ion spray voltage = 4500 V (positive
mode) or −5500 V (negative mode), at 400 °C. A typical
LC-run was 55 min, with the following solvent run sequence post injection:
0.3 mL min^–1 0% B for 5 min, 0.5 mL min^–1 0% B for 5 min, 0.5 mL min^–1 linear gradient of
B from 0–100% over 25 min, 0.5 mL min^–1 of
100% B for 10 min, and re-equilibration with 0.5 mL min^–1 of 0% B for 10 min. A detailed list of all the species targeted
in this MRM-HR study, describing the precursor ion mass and adduct,
the product ion targeted, and MS voltage parameters can be found in Supporting Information Table 1. All the endogenous
lipid species were quantified by measuring the area under the curve
in comparison to the respective internal standard, and then normalizing
to the total protein content of the phagosomal preparation. All the
lipidomics data are represented as mean ± SEM of four (or more)
biological replicates per group (Supporting Information Table 1).

Pathak D., Mehendale N., Singh S., Mallik R, & Kamat S.S. (2018). Lipidomics Suggests a New Role for Ceramide Synthase in Phagocytosis. ACS Chemical Biology, 13(8), 2280-2287.

Publication 2018

Acids Biopharmaceuticals Buffers Centrifugation Chloroform formic acid formic acid, ammonium salt Isopropyl Alcohol Lipidome Lipids Methanol Phagosomes Proteins Solvents Spindle Pole Body Sterility, Reproductive

Phagocytosis and Phagosome Characterization

Phagosomes created by phagocytosing 759-nm-diameter latex beads were observed using differential interference contrast microscopy (Barak et al., 2013 (link), Barak et al., 2014 (link)). For further details, see sections 3 and 4 of Supplemental Experimental Procedures. Phagosome motion was visualized inside agar-flattened Dictyostelium cells (section 5, Supplemental Experimental Procedures). Purification and in vitro motility of latex bead phagosomes has been described (Barak et al., 2014 (link)). Further details can be found in Supplemental Experimental Procedures (section 6). Phagosomes were prepared using silica beads or latex beads from J774, RAW264.7, or Dictyostelium cells. Purity of latex bead phagosomes was confirmed using markers against endosomal, cytosolic, and membrane proteins (Supplemental Experimental Procedures, section 6; Figure S2). Confocal imaging was used to detect proteins on the phagosome membrane. EPs/LPs were treated with filipin and imaged under epifluorescence illumination. Further details can be found in Supplemental Experimental Procedures, section 7 (for phagosomes from J774 and RAW cells) and section 9 (for phagosomes from Dictyostelium). Measurement of fluorescence intensity on phagosomes is described in Supplemental Experimental Procedures, section 8. Statistical hypothesis testing was done using Student’s t test. Two-tailed p values (95% confidence) were calculated. Error bars are SD or SEM, as indicated.
DRM isolation from purified phagosomes was done as described previously (Goyette et al., 2012 (link)). Further details can be found in in section 11 of Supplemental Experimental Procedures. Lipids were extracted from phagosomes using a methanol-chloroform mixture for thin-layer chromatography (TLC) experiments. Silica TLC plates were used to separate the lipids with an appropriate solvent system, followed by visualization on a Bio-Rad instrument. Further details can be found in section 12 of Supplemental Experimental Procedures. MβCD prepared in buffer (30 mM Tris and 4 mM EGTA [pH 8.0]) was incubated with LPs (22°C, 15 min) at final concentrations ranging from 10 mM to 30 mM. Further details can be found in section 13 of Supplemental Experimental Procedures. LPG purified from Leishmania donovani (Turco et al., 1987 (link)) was obtained as a gift. The stock solution (in ddH₂O) was diluted appropriately. LPs were incubated with LPG (22°C, 15 min) before observation (Dermine et al., 2005 (link)). Further details can be found in section 13 of Supplemental Experimental Procedures. Bead motility with dynein using an ATP releasate from Dictyostelium cells has been described elsewhere (Soppina et al., 2009b (link)). Further details can be found in section 14 of Supplemental Experimental Procedures. See Supplemental Experimental Procedures, section 12 for details of lipidomics measurements. PC and free cholesterol was measured on lipids obtained from EPs and LPs purified from RAW264.7 cells.

Rai A., Pathak D., Thakur S., Singh S., Dubey A.K, & Mallik R. (2016). Dynein Clusters into Lipid Microdomains on Phagosomes to Drive Rapid Transport toward Lysosomes. Cell, 164(4), 722-734.

Full text: Click here

Publication 2016

Agar Buffers Cells Chloroform Cholesterol Cytosol Dictyostelium Dynein ATPase Egtazic Acid Endosomes Filipin Fluorescence isolation Latex Leishmania donovani Light Lipids Membrane Proteins Methanol Microscopy, Differential Interference Contrast Motility, Cell Phagosomes RAW 264.7 Cells Silicon Dioxide Solvents Student Thin Layer Chromatography Tromethamine

Most recents protocols related to «Phagosomes»

Automated Intracellular Mycobacterial Analysis

Images from the automated confocal microscope were analyzed using multi-parameter scripts developed using Columbus system (version 2.3.1; PerkinElmer). Segmentation algorithms were applied to input images to detect nuclei and the signal of Mtb H37Rv to determine infection and replication rates. Briefly, the host cell segmentation was performed using two different Hoechst signal intensities—a strong intensity corresponding to the nucleus and a weak intensity in cytoplasm—with the algorithm “Find Nuclei” and “Find Cytoplasm”, as described previously [25 (link)]. GFP or DsRed signal intensities in a cell were used for the intracellular bacterial segmentation with the algorithm “Find Spots”. The identified intracellular bacteria were quantified as intracellular Mtb area with number of pixels. Subsequently, the population of infected cells was determined, and the increase of intracellular Mtb area, corresponding to intracellular mycobacterial replication, was calculated. For quantification of phagosomal acidification with Lysotracker Green DND-26, green signal intensity in a cell was used for the intracellular acidic compartment segmentation with the algorithm “Find Spots”.

Belhaouane I., Pochet A., Chatagnon J., Hoffmann E., Queval C.J., Deboosère N., Boidin-Wichlacz C., Majlessi L., Sencio V., Heumel S., Vandeputte A., Werkmeister E., Fievez L., Bureau F., Rouillé Y., Trottein F., Chamaillard M., Brodin P, & Machelart A. (2023). Tirap controls Mycobacterium tuberculosis phagosomal acidification. PLOS Pathogens, 19(3), e1011192.

Full text: Click here

Publication 2023

Acids Bacteria Cell Nucleus Cytoplasm Debility DNA Replication Exanthema Infection LysoTracker Microscopy, Confocal Mycobacterium Phagosomes Protoplasm Signal Transduction

Automated Fluorescent Confocal Microscopy Assays

Images were acquired using an automated fluorescent confocal microscope (In Cell analyzer 6000, GE) equipped with a 20X (NA 0.70) air lens or 60X (NA 1.2) water lens for Tirap localization, intracellular mycobacterial replication, phagosomal acidification, phagosomal rupture, LD formation and quantitation of intracellular Mtb secreted effectors assays. The confocal microscope was equipped with 405, 488, 561 and 642 nm excitation lasers. The emitted fluorescence was captured using a camera associated with a set of filters covering a detection wavelength ranging from 450 to 690 nm. Hoechst 33342-stained nuclei and CCF4-stained cells were detected using the 405 nm laser with a 450/50-nm emission filter. Green signals corresponding to LysoTracker Green DND-26, CCF4-AM, ZsGreen⁺ Tcells, and H37Rv-GFP were recorded using 488 nm laser with 540/75-nm emission filters. Red signals corresponding to H37Rv-DsRed was recorded using 561 nm laser with 600/40-nm emission filters. LipidTOX signal was detected using 630-nm excitation and 690-nm emission wavelengths.

Full text: Click here

Publication 2023

Biological Assay Cell Nucleus Cells DNA Replication Fluorescence HOE 33342 Lens, Crystalline LysoTracker Microscopy, Confocal Mycobacterium Phagosomes Protoplasm

Quantifying Mycobacterium tuberculosis Intracellular Dynamics

2x10⁴ BMDM were seeded per well in 384-well plates. Cells were infected for 3 h with H37Rv-GFP at a MOI of 2. Cells were extensively washed with RPMI-FBS in order to remove extracellular Mtb and incubated at 37°C with 5% CO₂.
For intracellular mycobacterial replication assay, 10% formalin solution (Sigma-Aldrich) containing 10 μg/mL Hoechst 33342 (Life-Technologies) was added to each well at 3 h and 96 hpi. Plates were incubated for 30 min, allowing nuclei staining and cell fixation. Cells were stored in DPBS until image acquisition.
To quantify phagosomal acidification 3 hpi, cells were incubated with 1mM LysoTracker Green DND-26 for 1.5h at 37°C with 5% CO₂. Cells were then fixed with a solution containing 10% formalin solution and 10 μg/mL Hoechst 33342 [25 (link)].
To inhibit intracellular acidification, cells were incubated with 100 nM of Concanamycin A (ConA) (Sigma-Aldrich, C9705) 2 h before infection until the end of the assay.
For phagosomal rupture, 24 hpi, cells were stained with 8 μM CCF4-AM in EM buffer (120 mM NaCl2, 7 mM KCl, 1.8 mM CaCl2, 0.8 mM MgCl2, 5 mM glucose, 2.5 μM probenecid, and 25 mM Hepes, pH 7.3) for 1 h at room temperature in the dark. Cells were then washed three times using EM buffer before imaging.
For LD formation assay, cells were washed and fixed at 96 hpi, as previously described [25 (link)]. Cells were washed twice with DBPS and intracellular LD were stained with 25 μL per well of 2000-fold diluted HCS LipidTOX deep Red neutral lipid probe (Invitrogen) in DPBS for 30 min at room temperature.

Full text: Click here

Publication 2023

Biological Assay Buffers Cardiac Arrest Cell Nucleus Cells concanamycin A discoidin-binding polysaccharide DNA Replication Formalin Glucose HEPES HOE 33342 Infection Lipids LysoTracker Magnesium Chloride Mycobacterium Phagosomes Probenecid Protoplasm

Quantifying Phagocytic Activity via pHrodo Assay

The phagocytosis assay was performed according to the manufacturer’s instructions using pH-sensitive pHrodo Red Zymosan BioParticles (Life Technologies). The pHrodo Red conjugates do not fluoresce outside the cell at neutral pH but do fluoresce at acidic pH values such as those in phagosomes; this enables an accurate measurement of phagocytosis. Briefly, MGCs were incubated with Zymosan conjugate particles (10 μg/ml) diluted in a live-cell imaging solution (Thermo Fisher Scientific) for 2 h in the dark. Nuclei were counterstained using Hoechst (1:1,000; Life Technologies). After incubation, the cells were thoroughly washed and fixed with 2% paraformaldehyde for 10 min at room temperature. Cell fluorescence was then measured with a microplate reader (SpectraMax M5; Molecular Devices).

Kim J.H., Han J., Afridi R., Kim J.H., Rahman M.H., Park D.H., Lee W.S., Song G.J, & Suk K. (2023). A multiplexed siRNA screen identifies key kinase signaling networks of brain glia. Life Science Alliance, 6(5), e202201605.

Full text: Click here

Publication 2023

Acids Biological Assay Cell Nucleus Cells Fluorescence Medical Devices paraform Phagocytosis Phagosomes Zymosan

Isogenic L. monocytogenes Mutants with Virulence

Isogenic derivatives of L. monocytogenes serovar 4b clinical isolate P14 with constitutive in vivo-like virulence gene expression (75 (link)) were used in this study. The construction of ΔinlA and ΔinlB in-frame deletion mutants is described below, the ΔactA and Δhly mutants have been reported elsewhere (27 (link), 76 (link)). The R. equi 103S and S. aureus USA300 strains used as controls for Rab5 detection in bacterial phagosomes were from our bacterial isolate collection and R. Fitzgerald’s laboratory (Roslin Institute, University of Edinburgh), respectively. Mammalian expression plasmids pEYFP-CBD, encoding the Listeria cell wall-binding cytosolic probe, and pGFP-iPX, encoding the PI3P-binding probe, were kindly provided by J. Swanson’s lab (University of Michigan Medical School, Ann Arbor, MI, USA) and the L. Stephen/P. Hawkins’s lab (Babraham Institute, Cambridge, United Kingdom), respectively (5 (link), 39 (link)). The plasmid pHinlB used for complementation of the ΔinlB mutant is a derivative of the E. coli Gram-positive shuttle vector pHPS9 (77 (link)) containing the inlB gene. The insert was prepared by PCR amplification of inlB and upstream inlAB operon regulatory regions from L. monocytogenes PAM14 ΔinlA genomic DNA using oligonucleotides mainl13SalI13 (ACGCGTCGACGAACATAAAGGGTAGAGG) and inlBBamHI (CGGGATCCCGATTCTTGCTAGACCACC), which carry SalI and BamHI restriction sites (underlined), respectively. After cloning into the pTOPO cloning T-vector (Invitrogen), the SalI/BamHI insert was transferred to pHPS9.

Cain R.J., Scortti M., Monzó H.J, & Vázquez-Boland J.A. (2023). Listeria InlB Expedites Vacuole Escape and Intracellular Proliferation by Promoting Rab7 Recruitment via Vps34. mBio, 14(1), e03221-22.

Full text: Click here

Publication 2023

Bacteria Cell Wall Cytosol Deletion Mutation derivatives Escherichia coli Gene Expression Genes Genome Listeria Mammals Oligonucleotides Operon Phagosomes Plasmids Reading Frames Regulatory Sequences, Nucleic Acid Shuttle Vectors Staphylococcus aureus Strains Virulence

Top products related to «Phagosomes»

Lysotracker red dnd 99 by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, Japan, France, China, Spain

LysoTracker Red DND-99 is a fluorescent dye that selectively stains acidic organelles, such as lysosomes, in live cells. It can be used to visualize and monitor the distribution and activity of lysosomes within the cellular environment.

Phrodo green e coli bioparticles by Thermo Fisher Scientific

Sourced in United States, United Kingdom

The PHrodo Green E. coli BioParticles are fluorescent particles derived from E. coli bacteria. They are designed to be used as a tool for researchers to study phagocytosis, which is the process by which cells engulf and internalize solid particles. The PHrodo Green dye used in these particles is pH-sensitive, allowing for the monitoring of the phagosomal environment during the phagocytic process.

Live cell imaging solution by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Canada, Netherlands, Switzerland, Japan

The Live Cell Imaging Solution is a specialized laboratory equipment designed to capture high-quality images and videos of living cells in real-time. It provides the necessary tools and technology to support dynamic cellular analysis and observation.

Ccf 4 by Thermo Fisher Scientific

Sourced in United States

The CCF-4 is a compact centrifuge designed for general laboratory use. It features a fixed-angle rotor that can accommodate 4 microcentrifuge tubes. The centrifuge has a maximum speed of 6,000 rpm and a maximum relative centrifugal force (RCF) of 2,000 xg. The unit is equipped with an imbalance detection system and automatic rotor identification. The CCF-4 provides a basic centrifugation solution for a variety of common laboratory applications.

Cellquest software by BD

Sourced in United States, Germany, United Kingdom, Italy, Canada, China, Japan, Belgium, France, Spain, Switzerland, Poland, Uruguay, Denmark, Singapore

CellQuest software is a data acquisition and analysis software designed for flow cytometry applications. It provides tools for acquiring, processing, and analyzing flow cytometry data.

Vectashield by Vector Laboratories

Sourced in United States, United Kingdom, Germany, Canada, Japan, France, Switzerland, Panama, Spain, China, Italy

Vectashield is a non-hardening, aqueous-based mounting medium designed for use with fluorescent-labeled specimens. It is formulated to retard photobleaching of fluorescent dyes and provides excellent preservation of fluorescent signals.

Zen software by Zeiss

Sourced in Germany, United States, United Kingdom, France, Canada, Switzerland, Japan, Belgium, Australia

ZEN software is a comprehensive imaging and analysis platform designed for microscopy applications. It provides a user-friendly interface for image acquisition, processing, and analysis, supporting a wide range of Zeiss microscopy instruments.

Prism 6 by GraphPad

Sourced in United States, United Kingdom, Canada, China, Germany, Japan, Belgium, Israel, Lao People's Democratic Republic, Italy, France, Austria, Sweden, Switzerland, Ireland, Finland

Prism 6 is a data analysis and graphing software developed by GraphPad. It provides tools for curve fitting, statistical analysis, and data visualization.

Facscalibur by BD

Sourced in United States, Germany, United Kingdom, China, Canada, Japan, Italy, France, Belgium, Singapore, Uruguay, Switzerland, Spain, Australia, Poland, India, Austria, Denmark, Netherlands, Jersey, Finland, Sweden

The FACSCalibur is a flow cytometry system designed for multi-parameter analysis of cells and other particles. It features a blue (488 nm) and a red (635 nm) laser for excitation of fluorescent dyes. The instrument is capable of detecting forward scatter, side scatter, and up to four fluorescent parameters simultaneously.

Chloroquine by Merck Group

Sourced in United States, Germany, United Kingdom, China, France, Macao, Sao Tome and Principe, Switzerland, Italy, Canada, Japan, Spain, Belgium, Israel, Brazil, India

Chloroquine is a laboratory chemical primarily used as a research tool in biochemical and cell biology applications. It is a white, crystalline solid that is soluble in water. Chloroquine is commonly used in experiments to study cellular processes, such as autophagy and endocytosis, by inhibiting the function of lysosomes. Its core function is to serve as a research reagent for scientific investigations, without making any claims about its intended use.

What are the different types or variations of Phagosomes?

Phagosomes can exist in various forms depending on their cargo and stage of maturation. Some key phagosome types include: 1. Early Phagosomes: Newly formed phagosomes that have just engulfed their target. 2. Late Phagosomes: Phagosomes that have undergone a series of fusion and fission events with endosomes and lysosomes, becoming more acidic and degradative. 3. Pathogen-Containing Phagosomes: Phagosomes that have internalized pathogens like bacteria or viruses, which can sometimes subvert the phagosome's degradative functions. 4. Apoptotic Cell-Containing Phagosomes: Phagosomes that have engulfed and are processing apoptotic or dead cells. Understanding these phagosome subtypes is crucial for studying host-pathogen interactions, antigen presentation, and cellular homeostasis.

How can Phagosome research be applied in different fields?

Phagosome research has wide-ranging applications across several disciplines: 1. Immunology: Phagosomes play a critical role in antigen presentation and immune cell function. Optimizing phagosome research can lead to breakthroughs in vaccine development and immunotherapies. 2. Infectious Disease: Many pathogens have evolved mechanisms to subvert or escape the phagosome's degradative processes. Studying phagosome-pathogen interactions can inform new antimicrobial therapies. 3. Cell Biology: Phagosomes are essential for cellular homeostasis, recycling, and signaling. Advancing phagosome research can provide insights into fundamental cellular processes. 4. Neurodegenerative Diseases: Abnormalities in phagosome function have been linked to the pathogenesis of neurodegenerative disorders like Alzheimer's and Parkinson's disease. Phagosome research may uncover new therapeutic targets. By leveraging PubCompare.ai's AI-driven platform, researchers can more easily identify the most effective protocols and products to optimize their phagosome studies across these diverse fields.

What are some common challenges in Phagosome research, and how can PubCompare.ai help?

Some key challenges in phagosome research include: 1. Identifying the most effective protocols and products from the vast literature: PubCompare.ai's AI-driven platform can help researchers quickly screen and compare protocols to find the best options for their specific needs. 2. Pinpointing critical insights amidst large datasets: PubCompare.ai's intelligent algorithms can analyze research papers, pre-prints, and patents to highlight the key differences in protocol effectiveness, enabling researchers to make more informed choices. 3. Ensuring reproducibility and accuracy: By identifying the optimal protocols, PubCompare.ai helps researchers achieve greater reproducibility and data integrity in their phagosome studies. 4. Staying up-to-date with the latest advancements: PubCompare.ai's platform provides a centralized, user-friendly interface to discover the newest phagosome-related protocols and products, keeping researchers at the forefront of the field. Utilizing PubCompare.ai's AI-driven tools can give phagosome researchers a significant edge in overcoming these common challneges and taking their studies to the next level.

How does PubCompare.ai's platform work to support Phagosome research?

PubCompare.ai's AI-driven platform is designed to streamline and optimize phagosome research in several ways: 1. Efficient Protocol Screening: The platform allows researchers to quickly sift through the vast literature on phagosome-related protocols, comparing them side-by-side to identify the most effective options. 2. AI-Powered Insights: PubCompare.ai's intelligent algorithms analyze research papers, pre-prints, and patents to pinpoint the critical differences in protocol effectiveness, helping researchers make more informed decisions. 3. Tailored Recommendations: Based on a researcher's specific goals and experimental conditions, PubCompare.ai can provide personalized recommendations for the optimal phagosome protocols and products to use. 4. Continuous Updates: The platform stays up-to-date with the latest advancements in phagosome research, ensuring that users have access to the most cutting-edge protocols and products. By leveraging PubCompare.ai's AI-driven tools, phagosome researchers can streamline their workflows, enhance reproducibility, and accelerate their discoveries - taking their studies to new heights.

What are some common mistakes or pitfalls to avoid in Phagosome research?

Some common pitfalls to be mindful of in phagosome research include: 1. Using suboptimal protocols or products: Failing to identify the most effective phagosome-related protocols and reagents can lead to inconsistent results and wasted time and resources. 2. Ignoring phagosome heterogeneity: Treating all phagosomes as a homogeneous population can overlook important differences in their composition, maturation, and function. 3. Overinterpreting phagosome-pathogen interactions: Caution is needed when extrapolating findings from in vitro phagosome-pathogen studies to complex in vivo scenarios. 4. Neglecting quality control and reproducibility: Inadequate attention to experimental controls and data validation can undermine the reliability and impact of phagosome research. 5. Falling behind on the latest advancements: Failing to stay up-to-date with the rapidly evolving field of phagosome biology can prevent researchers from leveraging the most cutting-edge tools and techniques. By leveraging PubCompare.ai's AI-driven platform, phagosome researchers can avoid these common pitfalls and optimize their workflows for greater success.

How can PubCompare.ai help researchers compare and select the best Phagosome protocols?

PubCompare.ai's AI-driven platform is specifically designed to help researchers identifiy and compare the most effective phagosome-related protocols from the literature, pre-prints, and patents. Here's how it works: 1. Efficient Screening: The platform allows you to quickly sift through a vast database of phagosome protocols, comparing them side-by-side based on key criteria like experimental conditions, reagents used, and reported outcomes. 2. AI-Powered Insights: PubCompare.ai's intelligent algorithms analyze the protocol details and associated research to highlight the critical differences in their effectiveness, helping you make more informed decisions. 3. Personalized Recommendations: Based on your specific research goals and experimental setup, PubCompare.ai can provide tailored recommendations for the optimal phagosome protocols and products to use. 4. Continuous Updates: The platform stays up-to-date with the latest advancements in phagosome research, ensuring you have access to the most cutting-edge protocols and reagents. By leveraging PubCompare.ai's AI-driven tools, you can streamline your phagosome research workflows, enhance reproducibility, and accelerate your discoveries - taking your studies to new heights.

What are some unique or interesting applications of Phagosome research?

Phagosome research has uncovered a wide range of fascinating and impactful applications, including: 1. Developing Novel Immunotherapies: Understanding how phagosomes process and present antigens has led to breakthroughs in vaccine design and cancer immunotherapy. 2. Combating Intracellular Pathogens: Studying how pathogens subvert phagosome function has revealed new targets for antimicrobial therapies against infections like tuberculosis and malaria. 3. Enhancing Cellular Homeostasis: Insights into phagosome-mediated recycling and signaling have implications for treating neurodegenerative diseases and other conditions linked to cellular dysfunction. 4. Improving Nano-Delivery Systems: Engineered phagosomes are being explored as versatile platforms for targeted drug delivery, particularly for cancer and inflammatory diseases. 5. Advancing Synthetic Biology: Researchers are using phagosome components to create novel biomimetic systems, paving the way for innovative applications in areas like tissue engineering and bioremediation. By leveraging PubCompare.ai's AI-driven platform, researchers can more easily stay up-to-date with these cutting-edge phagosome research applications and identify the best protocols to support their own unique projects.

More about "Phagosomes"

phagosome, phagocytosis, immune system, host-pathogen interactions, antigen presentation, cellular homeostasis, immunology, infectious disease, cell biology, LysoTracker Red DND-99, PHrodo Green E. coli BioParticles, Live Cell Imaging Solution, CCF-4, CellQuest software, Vectashield, ZEN software, Prism 6, FACSCalibur, Chloroquine, PubCompare.ai