Protoplasm

Example 7

Impact of IL-2 signalling on Teff responses is characterised in a T cell activation assay, in which intracellular granzyme B (GrB) upregulation and proliferation are examined. Previously frozen primary human Pan T cells (Stemcell Technologies) are labelled with eFluor450 cell proliferation dye (Invitrogen) according to manufacturer's recommendation, and added to 96-U-bottom well plates at 1×10⁵ cells/well in RPMI 1640 (Life Technologies) containing 10% FBS (Sigma), 2 mM L-Glutamine (Life Technologies) and 10,000 U/ml Pen-Strep (Sigma). The cells are then treated with 10 μg/ml anti-CD25 antibodies or control antibodies followed by Human T-Activator CD3/CD28 (20:1 cell to bead ratio; Gibco) and incubated for 72 hrs in a 37° C., 5% CO₂ humidified incubator. To assess T cell activation, cells are stained with the eBioscience Fixable Viability Dye efluor780 (Invitrogen), followed by fluorochrome labelled antibodies for surface T cell markers (CD3-PerCP-Cy5.5 clone UCHT1 Biolegend, CD4-BV510 clone SK3 BD Bioscience, CD8-Alexa Fluor 700 clone RPA-T8 Invitrogen, CD45RA-PE-Cy7 clone HI100 Invitrogen, CD25-BUV737 clone 2A3 BD Bioscience) and then fixed and permeabilized with the eBioscience™ Foxp3/Transcription Factor Staining Buffer Set (Invitrogen) before staining for intracellular GrB and intranuclear FoxP3 (Granzyme B-PE clone GB11 BD Bioscience, FoxP3-APC clone 236A/E7). Samples are acquired on the Fortessa LSR X20 Flow Cytometer (BD Bioscience) and analysed using the BD FACSDIVA software. Doublets are excluded using FCS-H versus FCS-A, and lymphocytes defined using SSC-A versus FCS-A parameters. CD4⁺ and CD8⁺ T cell subsets gated from the live CD3+ lymphocytes are assessed using a GrB-PE-A versus proliferation eFluor450-A plot. Results are presented as percentage of proliferating GrB positive cells from the whole CD4⁺ T cell population. Graphs and statistical analysis is performed using GraphPad Prism v7. (results not shown)

Example 2

Once miRNAs were modified by elongation and fluorescently marked to enable intracellular tracking of modified miRNAs, Applicants assessed cellular internalization of PS-modified miRNAs by flow cytometry including PO-modified miRNA as negative non-internalizing controls. Human multiple myeloma cells MM.1 S were incubated either for 30 min or for 48 hrs with modified miRNA as indicated and analyzed by flow cytometry to assess cellular load of cells with modified miRNA. For modified let7a-3p miRNA (FIGS. 2A and 2B) and modified let7a-5p miRNA (FIGS. 4A and 4B), 10 μg/ml was used for both 30 min and 48 hr incubation. For miR17-3p miRNA (FIGS. 6A and 6B), modified miR17-5p miRNA (FIGS. 8A and 8B) and modified miR218-5p miRNA (FIGS. 10A and 10B), 20 μg/ml was used for 30 min incubation and 10 μg/ml was used for 48 hr incubation, respectively.

Example 1

miRNAs with naturally occurring sequences were fused covalently to phosphorothioated ssDNA (PS) 20meric oligo to facilitate cellular internalization targeting intracellular molecular targets. A non-phosphorothioated, phosphodiester ssDNA oligo (PO) extension of the miRNAs was employed as a non-internalizing control.

Applicants modified naturally occurring miRNAs, for example, let7a-3p (SEQ ID NO:1) (FIG. 1), let7a-5p (SEQ ID NO:2) (FIG. 3), miR17-3p (SEQ ID NO:3) (FIG. 5), miR17-5p (SEQ ID NO:4) (FIG. 7), and miR218-5p (SEQ ID NO:5) (FIG. 9) by attaching a phosphorothioated ssDNA (PS) 20meric oligo to the 3′ end of the miRNAs via a chemical linker. Examples of a phosphorothioated ssDNA (PS) 20meric oligo include, but are not limited to, SEQ ID NO:6 (TCCATGAGCTTCCTGATGCT) and SEQ ID NO:7 (AGCATCAGGAAGCTCATGGA). Applicants designed that the modification by ssDNA oligo avoids any C/G or G/C motifs, because it is known that CpG oligodeoxynucleotides (CpG-ODN) involve undesired Toll-like receptor (TLR) engagement and subsequent intracellular signaling. Applicants used an alkyl chain harboring a fluorophore as a linker to track the conjugate molecule.