Log In Sign up
The largest database of trusted experimental protocols
> Anatomy > Cell > Alveolar Epithelial Cells

Alveolar Epithelial Cells

Alveolar epothelial cells are specialized cells that line the alveoli of the lungs.
They play a crucial role in gas exchange, fluid balance, and immune function within the respiratory system.
These cells come in two main types: type I alveolar epithelial cells, which are thin and facilitate gas exchange, and type II alveolar epithelial cells, which produce surfactant to reduce surface tension.
Studying the biology and behavior of alveolar epithelial cells is vital for understanding lung health and disease, and developing new therapies for conditions like lung injury, fibrosis, and cancer.

Most cited protocols related to «Alveolar Epithelial Cells»

1
Chemoresistant cancer cell line establishment
The N-myc-amplified neuroblastoma cell lines UKF-NB-2, UKF-NB-3, and UKF-NB-6 were established from stage 4 neuroblastoma patients.31 (link), 32 (link), 33 (link) The alveolar rhabdomyosarcoma cell line UKF-Rhb-1 was established from a bone marrow metastasis.11 (link) The melanoma cell lines Colo-679 and Mel-HO were obtained from the DSMZ (Braunschweig, Germany).
Parental chemosensitive cell lines were adapted to growth in the presence of anti-cancer drugs by continuous exposure of these cell lines to the increasing concentrations of these drugs as described before.31 (link), 32 (link)The following chemoresistant UKF-NB-3 sublines were derived from the resistant cancer cell line (RCCL) collection: UKF-NB-3rCDDP1000 (adapted to CDDP), UKF-NB-3rDAC8 (DAC), UKF-NB-3rDOX20 (DOX), UKF-NB-3rGEMCI10 (GEMCI), UKF-NB-3rIRINO800 (IRINO), UKF-NB-3rMEL400 (MEL), UKF-NB-3rOXALI2000 (OXALI), UKF-NB-3rPCL20 (PCL), UKF-NB-3rTOPO15 (TOPO), UKF-NB-3rVCR10 (VCR), and UKF-NB-3rVINOR20 (VINOR).
The following chemoresistant UKF-NB-2 sublines were derived from the RCCL collection: UKF-NB-2rCDDP1000, UKF-NB-2rDOX20, and UKF-NB-2rVCR10.
The following chemoresistant UKF-Rhb-1 sublines were derived from the RCCL collection: UKF-Rhb-1rCDDP1000 and UKF-Rhb-1rDOCE10 (DOCE), UKF-Rhb-1rDOX10, UKF-Rhb-1rGEMCI10, UKF-Rhb-1rIRINO200, UKF-Rhb-1rMEL400, UKF-Rhb-1rOXALI1000, and UKF-Rhb-1rVCR10Moreover, the following melanoma sub-lines were derived from the RCCL collection: Colo-679rVCR20, Colo-679rPLX403210 μM (PLX4032, vemurafenib), MelHOrVCR20, MelHOrCDDP1000, MelHOrDAC20, and MelHOrPLX403210 μM.
The corresponding IC50 values for the parental cells and their drug-resistant sublines are provided in Supplementary Table 4.
All cells were propagated in IMDM supplemented with 10% FBS, 100 IU/ml penicillin and 100 mg/ml streptomycin at 37 °C. Cells were routinely tested for mycoplasma contamination and authenticated by short tandem repeat profiling.
Standard molecular cloning techniques were used to generate lentiviral vectors based on Lentiviral Gene Ontology vector technology (see http://www.lentigo-vectors.de), and cell transduction was performed as described before.11 (link), 18 (link), 34 (link)
Michaelis M., Rothweiler F., Barth S., Cinatl J., van Rikxoort M., Löschmann N., Voges Y., Breitling R., von Deimling A., Rödel F., Weber K., Fehse B., Mack E., Stiewe T., Doerr H.W., Speidel D, & Cinatl J j.r. (2011). Adaptation of cancer cells from different entities to the MDM2 inhibitor nutlin-3 results in the emergence of p53-mutated multi-drug-resistant cancer cells. Cell Death & Disease, 2(12), e243-.
Publication 2011
Alveolar Epithelial Cells Alveolar Rhabdomyosarcoma Antineoplastic Agents Bone Marrow Cell Lines Cells Cisplatin Cloning Vectors Lentigo LINE-1 Elements Malignant Neoplasms Melanoma Mycoplasma Neoplasm Metastasis Neuroblastoma Parent Patients Penicillins Pharmaceutical Preparations PLX4032 Rhabdomyosarcoma Rhabdomyosarcoma 1 Short Tandem Repeat Streptomycin Topotecan Vemurafenib
2
Multiplexed qPCR Analysis of Lung Cell Transcriptomes
Single-cell multiplexed qPCR data was analyzed and displayed using custom R scripts12 . qPCR experiments were performed for E16.5 (2 biological replicates), E18.5 (2 biological replicates) distal lung epithelial cells and for adult AT2 cells (1 replicate). The limit of detection of multiplexed qPCR values was determined as 22 threshold cycles (Ct) by a calibration experiment with 16-fold serial dilutions of total lung cDNA and 6 replicates for each concentration. Genes that were not expressed were given a value higher than the limit of detection and the limit of detection was subtracted from all Ct values to transform Ct values to log2 expression values (log2Ex = CtLoD – Ct, CtLoD = 22). Cells not expressing either of two housekeeping genes Actb and Gapdh, or expressing them below three standard deviations below the mean, were scored as unhealthy and removed from the analysis. After applying this filter, 74 single cells remained for two experiments at E18.5, 33 cells for two experiments at E16.5 and 48 cells for the experiment with adult AT2 cells. In all experiments, cells were isolated from pooled lungs from one litter (5-9 lungs). To combine experiments from different chips for the same embryonic time point, the expression value of each gene for a given cell was normalized to the median gene expression value of that cell. Normalized gene expression values were further scaled gene-by-gene by mean-centering and dividing by the standard deviation of expressing cells. PCA and hierarchical clustering using Euclidean distance metric were performed in R for all cells using 10 canonical marker genes for bronchiolar and alveolar cells (Abca3, Sftpb, Muc1, Sftpc, Lyz2, Aqp5, Pdpn, Ager, Foxj1, Scgb1a1).
Treutlein B., Brownfield D.G., Wu A.R., Neff N.F., Mantalas G.L., Espinoza F.H., Desai T.J., Krasnow M.A, & Quake S.R. (2014). Reconstructing lineage hierarchies of the distal lung epithelium using single cell RNA-seq. Nature, 509(7500), 371-375.
Publication 2014
Adult Alveolar Epithelial Cells Biopharmaceuticals Bronchioles Cells DNA, Complementary DNA Chips DNA Replication Embryo Epithelial Cells Experimental Lung Inflammation GAPDH protein, human Gene Expression Genes Genes, Housekeeping Genetic Markers Lung MUC1 protein, human RAGE receptor protein, human SFTPB protein, human Technique, Dilution
3
Multiplexed qPCR Analysis of Lung Cell Transcriptomes
Single-cell multiplexed qPCR data was analyzed and displayed using custom R scripts12 . qPCR experiments were performed for E16.5 (2 biological replicates), E18.5 (2 biological replicates) distal lung epithelial cells and for adult AT2 cells (1 replicate). The limit of detection of multiplexed qPCR values was determined as 22 threshold cycles (Ct) by a calibration experiment with 16-fold serial dilutions of total lung cDNA and 6 replicates for each concentration. Genes that were not expressed were given a value higher than the limit of detection and the limit of detection was subtracted from all Ct values to transform Ct values to log2 expression values (log2Ex = CtLoD – Ct, CtLoD = 22). Cells not expressing either of two housekeeping genes Actb and Gapdh, or expressing them below three standard deviations below the mean, were scored as unhealthy and removed from the analysis. After applying this filter, 74 single cells remained for two experiments at E18.5, 33 cells for two experiments at E16.5 and 48 cells for the experiment with adult AT2 cells. In all experiments, cells were isolated from pooled lungs from one litter (5-9 lungs). To combine experiments from different chips for the same embryonic time point, the expression value of each gene for a given cell was normalized to the median gene expression value of that cell. Normalized gene expression values were further scaled gene-by-gene by mean-centering and dividing by the standard deviation of expressing cells. PCA and hierarchical clustering using Euclidean distance metric were performed in R for all cells using 10 canonical marker genes for bronchiolar and alveolar cells (Abca3, Sftpb, Muc1, Sftpc, Lyz2, Aqp5, Pdpn, Ager, Foxj1, Scgb1a1).
Treutlein B., Brownfield D.G., Wu A.R., Neff N.F., Mantalas G.L., Espinoza F.H., Desai T.J., Krasnow M.A, & Quake S.R. (2014). Reconstructing lineage hierarchies of the distal lung epithelium using single cell RNA-seq. Nature, 509(7500), 371-375.
Publication 2014
Adult Alveolar Epithelial Cells Biopharmaceuticals Bronchioles Cells DNA, Complementary DNA Chips DNA Replication Embryo Epithelial Cells Experimental Lung Inflammation GAPDH protein, human Gene Expression Genes Genes, Housekeeping Genetic Markers Lung MUC1 protein, human RAGE receptor protein, human SFTPB protein, human Technique, Dilution
4
Comprehensive DNA Methylation Profiling Across Cell Types
All DNA methylation profiles were determined either on the Illumina Infinium Human Methylation 450K or EPIC BeadChip arrays. DNA methylation data for white blood cells (neutrophils, monocytes, B-cells, CD4+ T-cells, CD8+ T-cells, NK-cells, n = 6 each) were downloaded from GSE110555 (EPIC)38 (link). Data for erythrocyte progenitors (n = 5) were downloaded from GSE63409 (450K)39 (link), and data for left atrium (n = 4) were downloaded from GSE62727 (450K)40 (link). Data for bladder (n = 19), breast (n = 98), cervix (n = 3), colon (n = 38), esophagus (n = 16), oral cavity (n = 34), kidney (n = 160), prostate (n = 50), rectum (n = 7), stomach (n = 2), thyroid (n = 56), and uterus (n = 34) were downloaded from TCGA26 (link). DNA methylation data for adipocytes (n = 3, 450K), hepatocytes (n = 3, 450K and EPIC), alveolar lung cells (n = 3, EPIC), neurons (n = 3, 450K and EPIC), vascular endothelial cells (n = 2, EPIC) pancreatic acinar cells (n = 3, 450K and EPIC), duct cells (n = 3, 450K and EPIC), beta cells (n = 4, 450K and EPIC), colon epithelial cells (n = 3, EPIC) were generated in house and are available from the corresponding authors upon reasonable request. Detailed sample information is available in Supplementary Data 1.
Moss J., Magenheim J., Neiman D., Zemmour H., Loyfer N., Korach A., Samet Y., Maoz M., Druid H., Arner P., Fu K.Y., Kiss E., Spalding K.L., Landesberg G., Zick A., Grinshpun A., Shapiro A.M., Grompe M., Wittenberg A.D., Glaser B., Shemer R., Kaplan T, & Dor Y. (2018). Comprehensive human cell-type methylation atlas reveals origins of circulating cell-free DNA in health and disease. Nature Communications, 9, 5068.
Full text: Click here
Publication 2018
Acinar Cell Adipocytes Alveolar Epithelial Cells Atrium, Left B-Lymphocytes Breast CD4 Positive T Lymphocytes CD8-Positive T-Lymphocytes Cells Cervix Uteri Colon DNA Methylation Epithelial Cells Erythrocytes Esophagus Hepatocyte Homo sapiens Kidney Leukocytes Lung Methylation Monocytes Natural Killer Cells Neurons Neutrophil Oral Cavity Pancreas Pancreatic beta Cells Prostate Rectum Stomach Thyroid Gland Urinary Bladder Uterus Vascular Endothelial Cells
5
Histopathological Evaluation of Lung Damage

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2020
Alveolar Epithelial Cells Animals Cells Cytopathogenic Effect, Viral Edema Eosin Hemorrhage Inflammation Light Microscopy Lung Mus Paraffin Embedding pathogenesis Pathologists Physical Examination Tissues Virus Diseases

Most recents protocols related to «Alveolar Epithelial Cells»

1
Histopathological Assessment of Lung Fibrosis

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2023
Alveolar Epithelial Cells Blood Vessel Bronchi Bronchioles Bronchoalveolar Lavage Fluid Cells Cell Wall Eosin Fibrosis Light Microscopy Lung Metaplasia Mus Muscle Tissue Paraffin Embedding paraform Pathologists Pulmonary Fibrosis Tissues
2
Histopathological Lung Evaluation in SARS-CoV-2 Hamster Model

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2023
Alveolar Epithelial Cells Animals Bronchi Bronchiolitis Bronchitis Cells Character COVID 19 Edema Eosin Epithelial Cells Ethanol Fingers Formalin Hamsters Hemorrhage Hyalin Substance Hyperplasia Lung Lymphocyte Lymphoid Tissue Macrophage Microscopy Necrosis Neutrophil Paraffin Embedding Pathologists Pneumonia Pneumonia, Interstitial Tissue, Membrane Tissues Type-II Pneumocytes Xylene
3
Construction and Validation of Engineered E. coli Strains
The invasive E. coli strain SVC1 is a K‐12 derivative [F–endA1 hsdR17 (rK– mK+) glnV44 thi‐1 relA1 rfbD1 spoT1 Δrnc ΔdapA]. The cells are auxotrophic for diaminopimelic acid (DAP) due to a deletion of dapA. E. coli cells were cultured in brain–heart infusion medium supplemented with DAP (100 μg/mL) and appropriate antibiotics at the following concentrations: kanamycin, 25 μg/mL; ampicillin, 100 μg/mL. A549 cells are a human adenocarcinoma alveolar basal epithelial cell line. For the in vitro GFP silencing experiments, an A549 cell line constitutively expressing GFP (Cell Biolabs, San Diego, California, USA, AKR‐209) was used. The identity of the A549/GFP cells was confirmed by GFP expression, morphology, and trypan‐blue dye exclusion, and all cell cultures were routinely monitored for microbial contamination using standard techniques. The construction of pSiVEC‐scramble (non‐specific small RNA sequence), pSiVEC‐PA, and pSiVEC‐NP, which were derived from pmbv43 [8 (link)], is described in a previous publication [9 (link)]. pSiVEC‐GFP was constructed using the DNA template encoding the shRNA specific for GFP [77 (link)] from the copepod Pontellina plumata: sense, GCTACGGCTTCTACCACTTT and antisense, AAAGTGGTAGAAGCCGTAGC. Using standard cloning and transformation methods, resulting SVC1 colonies transformed with the plasmids pSiVEC‐scramble, pSiVEC‐PA, pSiVEC‐NP, and pSiVEC‐GFP were screened by PCR, and a single positive clone was sequence validated and propagated. Stocks were generated and stored at −80°C in 20% glycerol. A single frozen aliquot from each construct stock was thawed to determine colony forming units (CFU)/mL via plate enumeration [9 (link)]. These strains are referred to as SVC1‐scramble, SVC1‐PA, SVC1‐NP, and SVC1‐GFP.
Mora D.S., Cox M., Magunda F., Williams A.B, & Linke L. (2023). An optimized live bacterial delivery vehicle safely and efficaciously delivers bacterially transcribed therapeutic nucleic acids. Engineering in Life Sciences, 23(3), e2200037.
Full text: Click here
Publication 2023
A549 Cells Adenocarcinoma Alveolar Epithelial Cells Ampicillin Antibiotics Brain Cell Culture Techniques Cells Clone Cells Copepoda Culture Media Deletion Mutation Diaminopimelic Acid Escherichia coli Freezing Glycerin Heart Homo sapiens Kanamycin Plasmids Short Hairpin RNA Strains Trypan Blue
4
Apoptosis in Lung Tissue by NET Exposure
Lung tissue was harvested for detection of apoptotic cells in situ with Click-iT Plus TUNEL Assay Alexa Fluor 488, according to the manufacturer’s instructions (Thermo Fisher Scientific; cat. C10617). Human alveolar basal epithelial A549 cells (5 × 104) were maintained in DMEM and cultured with purified NETs (10 ng/ml) pretreated, or not, with DNase I (0·5 mg/ml; Pulmozyme, Roche). The cultures were then incubated for 24 h at 37 °C. Viability was determined by flow cytometric analysis of Annexin V staining.
Veras F.P., Gomes G.F., Silva B.M., Caetité D.B., Almeida C.J., Silva C.M., Schneider A.H., Corneo E.S., Bonilha C.S., Batah S.S., Martins R., Arruda E., Fabro A.T., Alves-Filho J.C., Cunha T.M, & Cunha F.Q. (2023). Targeting neutrophils extracellular traps (NETs) reduces multiple organ injury in a COVID-19 mouse model. Respiratory Research, 24, 66.
Full text: Click here
Publication 2023
alexa fluor 488 Alveolar Epithelial Cells Annexin A5 Apoptosis Biological Assay Cells Deoxyribonuclease I Flow Cytometry Homo sapiens In Situ Nick-End Labeling Lung Pulmozyme SLC6A2 protein, human Tissues
5
Histological Assessment of Murine Lung Pathology
Lungs were dissected from mice euthanized by intraperitoneal sodium pentobarbital injection as described above. The left lung lobe of each animal was removed at necropsy, instilled intratracheally with 4% paraformaldehyde (PFA), and post-fixed for 24 h by immersion in 4% PFA, prior to transfer into 70% ethanol and storage at 4 °C. Lung samples were then routinely processed to paraffin blocks and 5-µm thick serial sections prepared by cutting through the whole paraffin block and mounting sections 1:10 onto glass slides. These slides were stained with hematoxylin and eosin according to standard procedure and examined microscopically by an experienced veterinary pathologist. Microscopic lung findings were scored semi-quantitatively following accepted principles74 (link). Briefly, all serial sections per animal were first evaluated blinded to treatment at low magnification (×40 to ×100) to select the lung level(s) with the most severe and extensive lesions for each animal. The extent of the lesions across this section was then estimated (and scored as 0 = < 5%; 1 = 5–33%; 2 = 33–66%; 3 = >66%) and this parameter taken as a weighing factor to multiply with the sum of all the individually scored lesions, calculating an overall combined lung pathology score per animal. The individual lesions were scored at high magnification (×200–400) and these included alveolar interstitial inflammatory cells (neutrophils, macrophages, and/or lymphocytes/plasma cells), perivascular mixed inflammatory cell infiltrate and edema, necrosis, intra-alveolar neutrophils, macrophages, and/or hemorrhage (each scored as 0 = none; 1 = mild, 2 = moderate, 3 = severe). Alveolar septal thickening (scored as 0 = none, 1 = 2-fold increase, 2 = 2–4-fold increase, 3 = more than 4-fold increase compared with unaffected septa), hyaline membranes, and intra-alveolar proteinaceous fluid (the latter two scored as 0 = none, 1 = 1, 2 = more than 1 per alveolus) were scored as well.
Myeni S.K., Bredenbeek P.J., Knaap R.C., Dalebout T.J., Morales S.T., Sidorov I.A., Linger M.E., Oreshkova N., van Zanen-Gerhardt S., Zander S.A., Enjuanes L., Sola I., Snijder E.J, & Kikkert M. (2023). Engineering potent live attenuated coronavirus vaccines by targeted inactivation of the immune evasive viral deubiquitinase. Nature Communications, 14, 1141.
Full text: Click here
Publication 2023
Alveolar Epithelial Cells Animals Autopsy Edema Eosin Ethanol factor A Hemorrhage Hyalin Substance Inflammation Injections, Intraperitoneal Lobar Pneumonia Lung Lymphocyte Macrophage Microscopy Mus Necrosis Neutrophil Paraffin paraform Pathologists Pentobarbital Sodium Pericytes Plasma Cells Proteins Submersion Tissue, Membrane Tooth Socket

Top products related to «Alveolar Epithelial Cells»

1
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
2
Dulbecco modified eagle medium (dmem) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.
3
Penicillin streptomycin by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia
Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.
4
Streptomycin by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, France, Canada, Australia, Japan, Switzerland, Italy, Belgium, Israel, Austria, Spain, Netherlands, Poland, Brazil, Denmark, Argentina, Sweden, New Zealand, Ireland, India, Gabon, Macao, Portugal, Czechia, Singapore, Norway, Thailand, Uruguay, Moldova, Republic of, Finland, Panama
Streptomycin is a broad-spectrum antibiotic used in laboratory settings. It functions as a protein synthesis inhibitor, targeting the 30S subunit of bacterial ribosomes, which plays a crucial role in the translation of genetic information into proteins. Streptomycin is commonly used in microbiological research and applications that require selective inhibition of bacterial growth.
5
Penicillin by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, France, Canada, Japan, Australia, Switzerland, Italy, Israel, Belgium, Austria, Spain, Brazil, Netherlands, Gabon, Denmark, Poland, Ireland, New Zealand, Sweden, Argentina, India, Macao, Uruguay, Portugal, Holy See (Vatican City State), Czechia, Singapore, Panama, Thailand, Moldova, Republic of, Finland, Morocco
Penicillin is a type of antibiotic used in laboratory settings. It is a broad-spectrum antimicrobial agent effective against a variety of bacteria. Penicillin functions by disrupting the bacterial cell wall, leading to cell death.
6
Rpmi 1640 medium by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Japan, France, Canada, Australia, Italy, Switzerland, Belgium, New Zealand, Spain, Israel, Sweden, Denmark, Macao, Brazil, Ireland, India, Austria, Netherlands, Holy See (Vatican City State), Poland, Norway, Cameroon, Hong Kong, Morocco, Singapore, Thailand, Argentina, Taiwan, Province of China, Palestine, State of, Finland, Colombia, United Arab Emirates
RPMI 1640 medium is a commonly used cell culture medium developed at Roswell Park Memorial Institute. It is a balanced salt solution that provides essential nutrients, vitamins, and amino acids to support the growth and maintenance of a variety of cell types in vitro.
7
Hpaepic by ScienCell
Sourced in United States
HPAEpiC is a primary human pulmonary arterial endothelial cell culture product developed and manufactured by ScienCell Research Laboratories. It is designed for the in vitro study of human pulmonary arterial endothelial cells.
8
L glutamine by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, France, Canada, Switzerland, Italy, Australia, Belgium, China, Japan, Austria, Spain, Brazil, Israel, Sweden, Ireland, Netherlands, Gabon, Macao, New Zealand, Holy See (Vatican City State), Portugal, Poland, Argentina, Colombia, India, Denmark, Singapore, Panama, Finland, Cameroon
L-glutamine is an amino acid that is commonly used as a dietary supplement and in cell culture media. It serves as a source of nitrogen and supports cellular growth and metabolism.
9
A549 cell by American Type Culture Collection
Sourced in United States, China, United Kingdom, France, Germany
A549 cells are a type of human lung epithelial cell line derived from a 58-year-old Caucasian male with lung carcinoma. These cells are widely used in various areas of biomedical research, including studies related to lung biology, respiratory diseases, and cancer.
10
Penicillin by Merck Group
Sourced in United States, Germany, United Kingdom, Italy, France, Switzerland, Brazil, China, Poland, Macao, Spain, Canada, Japan, Australia, Austria, Belgium, Israel, Sao Tome and Principe, Netherlands, India, Sweden, Ireland, Argentina, Czechia, Denmark, New Zealand, Hungary, Mexico, Holy See (Vatican City State), Ukraine
Penicillin is a type of antibacterial drug that is widely used in medical and laboratory settings. It is a naturally occurring substance produced by certain fungi, and it is effective against a variety of bacterial infections. Penicillin works by inhibiting the growth and reproduction of bacteria, making it a valuable tool for researchers and medical professionals.

More about "Alveolar Epithelial Cells"

Alveolar epithelial cells (AECs) are a specialized type of pulmonary cells that line the alveoli, the tiny air sacs within the lungs.
These cells play a crucial role in maintaining lung homeostasis and facilitating gas exchange, a vital process for respiratory function.
There are two main subtypes of AECs: type I alveolar epithelial cells, which are thin and facilitate efficient gas diffusion, and type II alveolar epithelial cells, which produce surfactant - a lipid-protein complex that reduces surface tension and prevents alveolar collapse.
AECs are essential for various physiological processes, including fluid balance, immune function, and wound healing within the respiratory system.
Studying the biology and behavior of these cells is crucial for understanding lung health and disease, and developing new therapies for conditions like acute lung injury, pulmonary fibrosis, and lung cancer.
Researchers often use cell culture models, such as HPAEpiC (human primary alveolar epithelial cells) and A549 cells (a lung adenocarcinoma cell line), to investigate AEC function.
These models are typically cultured in media like DMEM (Dulbecco's Modified Eagle Medium) or RPMI 1640, supplemented with fetal bovine serum (FBS), L-glutamine, and antibiotics like penicillin/streptomycin.
Optimizing these culture conditions and protocols is essential for ensuring reproducible and reliable results in AEC research.
PubCompare.ai's AI-driven platform can help researchers streamline their alveolar epithelial cell studies by providing access to a comprehensive database of published protocols, preprints, and patents.
The tool's intelligent comparison features allow users to quickly identify the best experimental procedures and products for their specific research needs, enhancing the efficiency and reproducibility of their investigations.