> Anatomy > Cell > Hybridomas

Hybridomas

Hybridomas are a type of immortalized cell line created by fusing a B lymphocyte with a myeloma cell.
These hybrid cells produce large quantities of a specific monoclonal antibody, making them invaluable tools for biomedical research and therapeutic development.
PubCompare.ai's AI-driven platform can help streamline your Hybridomas work by locating the most effective protocols from literature, preprints, and patents, and identifying the best products and procedures to optimize your research.
Experience the futre of reproducible Hybridomas research today with PubCompare.ai.

Most cited protocols related to «Hybridomas»

Purification and Culture of Human Brain Cells

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2015

Antibodies Antibodies, Anti-Idiotypic Astrocytes Brain Cell Culture Techniques Cells Endothelial Cells Fetus Gray Matter Homo sapiens Hybridomas Hyperostosis, Diffuse Idiopathic Skeletal Lectin Lysine Macrophage Microglia Neurons Oligodendrocyte Precursor Cells Oligodendroglia Papain Poly A Protease Inhibitors RNA-Seq Serum Thy-1 Antigens Tissues Trypsin

Zebrafish Ventricular Resection and Regeneration

Outbred Ekkwill strain (EK) or EK/AB mixed background zebrafish 6–12 months of age were used for ventricular resection surgeries as described previously4 (link). All transgenic strains were analyzed as hemizygotes; details of their construction are described in the separate Methods section. Animal density was maintained at ~4 fish/liter in all experiments. 4-hydroxytamoxifen (4-HT) (Sigma) dissolved with ethanol (5 mg/ml) was diluted in water to 0.5 mg/ml for intraperitoneal injections. 10% ethanol was used as a vehicle control. EGFP labeling quantification is described in the separate Methods section. Heat-shock experiments were performed as described previously27 (link), using double transgenic hsp70:dnfgfr1; cmlc2:nucDsRed2 or hsp70:dnfgfr1; gata4:EGFP animals. For BrdU incorporation experiments, 2.5 mg/ml BrdU (Sigma) was injected intraperitoneally once daily for 3 days prior to collection. Immunofluorescence, in situ hybridization, and Acid Fuchsin Orange G stains (detecting fibrin and collagen) were performed as described previously4 (link). Primary antibodies used in this study were: anti-Mef2 (rabbit; Santa Cruz Biotechnology), anti-Myosin heavy chain (F59, mouse; Developmental Studies Hybridoma Bank), anti-β-catenin (rabbit; Sigma), anti-zf Raldh2 (rabbit: Abmart), anti-BrdU (rat; Accurate), and anti-GFP (rabbit, used only for co-detection with BrdU; Invitrogen). Secondary antibodies (Invitrogen) used in this study were Alexa Fluor 594 goat anti-rabbit IgG (H+L) for anti-Mef2, Alexa Fluor 594 goat anti-mouse IgG (H+L) for F59, Alexa Fluor 594 goat anti-rat IgG (H+L) for anti-BrdU, and Alexa Fluor 488 goat anti-rabbit IgG (H+L) for anti-GFP. In situ hybridization and immunofluorescence images were taken using a Leica DM6000 microscope with a Retiga-EXi camera (Q-IMAGING), and confocal images were taken using a Leica SP2 or SP5 confocal microscope. Physiology methods are described in the separate Methods section.

Kikuchi K., Holdway J.E., Werdich A.A., Anderson R.M., Fang Y., Egnaczyk G.F., Evans T., MacRae C.A., Stainier D.Y, & Poss K.D. (2010). Primary contribution to zebrafish heart regeneration by gata4+ cardiomyocytes. Nature, 464(7288), 601-605.

Publication 2010

acid-fuchsin afimoxifene ALDH1A2 protein, human Alexa594 alexa fluor 488 Animals Animals, Transgenic anti-IgG Antibodies Bromodeoxyuridine Collagen CTNNB1 protein, human Ethanol Fibrin Fishes Fluorescent Antibody Technique Goat Heart Ventricle Heat-Shock Proteins 70 Heat-Shock Response Hemizygote Hybridomas Injections, Intraperitoneal In Situ Hybridization Mice, House Microscopy Microscopy, Confocal Myosin Heavy Chains Operative Surgical Procedures Orange G physiology Rabbits Staining Strains Zebrafish

Purification and Culture of Astrocytes

Astrocytes were purified by immunopanning from postnatal day 5 rats or mice (see above) forebrains and cultured as previously described^{18 (link)}. Briefly, cortices were enzymatically (papain) then mechanically dissociated to generate a single cell suspension that was incubated on successive negative immunopanning plates to remove microglia, endothelial cells, and oligodendrocyte lineage cells before positively selecting for astrocytes with an Itgb5-coated panning plate. Isolated astrocytes were cultured in a defined, serum-free base media containing 50% neurobasal, 50% DMEM, 100 U/ml penicillin, 100 μg/ml streptomycin, 1 mM sodium pyruvate, 292 μg/ml L-glutamine, 1× SATO and 5 μg/ml of N-acetyl cysteine. This media was supplemented with the astrocyte-required survival factor HBEGF (Peprotech, 100–47) at 5ng/ml as previously descried^{18 (link)}. A similar immunopanning protocol was used for other central nervous system cell types, with positive selection using THY1 (cortical neurons), 192 hybridoma clone (embryonic spinal motor neurons^{35 (link)}), CD31 (endothelial cells^{36 (link)}), O4 (oligodendrocyte lineage cells), PDGFRβ (pericytes^{37 (link)}), CD45 (microglia/macrophages). A1 reactive astrocytes were generated in vitro by growing purified astrocytes for 6 days and then treating for 24 h with Il-1α (3 ng/ml, Sigma, I3901), TNFα (30 ng/ml, Cell Signaling Technology, 8902SF), and C1q (400 ng/ml, MyBioSource, MBS143105).

Liddelow S.A., Guttenplan K.A., Clarke L.E., Bennett F.C., Bohlen C.J., Schirmer L., Bennett M.L., Münch A.E., Chung W.S., Peterson T.C., Wilton D.K., Frouin A., Napier B.A., Panicker N., Kumar M., Buckwalter M.S., Rowitch D.H., Dawson V.L., Dawson T.M., Stevens B, & Barres B.A. (2017). Neurotoxic reactive astrocytes are induced by activated microglia. Nature, 541(7638), 481-487.

Publication 2017

Acetylcysteine Astrocytes Cells Central Nervous System Clone Cells Cortex, Cerebral Culture Media, Serum-Free Embryo Endothelial Cells Endothelium Glutamine HBEGF protein, human Hybridomas Macrophage Microglia Mus Neurons Oligodendroglia Papain Penicillins Platelet-Derived Growth Factor beta Receptor Prosencephalon Pyruvate Rattus Sodium Streptomycin Tumor Necrosis Factor-alpha

Prion Protein Detection and Analysis

Equal amounts of recombinant prion proteins (100ng for Figure 5A and 10ng for Figure 5C) were mixed with loading dye and loaded on a 12% NuPAGE gel (Invitrogen, running with MES buffer). Mouse brain homogenates were prepared in PBS, 0.05% sodium deoxycholate, and 0.05% Nonidet P-40. For PK digestion 25 µg/ml of enzyme was used to digest PrP^C. Samples corresponding to 40 µg of total proteins (with or without prior PK digestion) were mixed with loading dye and loaded on a 12% NuPAGE gel. Proteins were then transferred onto a nitrocellulose membrane incubated with hybridoma cell supernatant or purified monoclonal anti-PrP antibodies and horseradish peroxidase (HRP)-conjugated rabbit anti-mouse IgG (gamma) antibody (Zymed). For analysis of samples acquired from immunoprecipitation, blots were incubated with a biotinylated anti-PrP (POM1) antibody and HRP-labeled avidin (Pharmingen). Blots were finally incubated with HRP substrate (ECL, Pierce) and exposed on photosensitive film (Kodak) or with Versadoc 3000 imaging system (Bio-Rad).

Polymenidou M., Moos R., Scott M., Sigurdson C., Shi Y.Z., Yajima B., Hafner-Bratkovič I., Jerala R., Hornemann S., Wuthrich K., Bellon A., Vey M., Garen G., James M.N., Kav N, & Aguzzi A. (2008). The POM Monoclonals: A Comprehensive Set of Antibodies to Non-Overlapping Prion Protein Epitopes. PLoS ONE, 3(12), e3872.

Full text: Click here

Publication 2008

anti-IgG Avidin Brain Buffers Deoxycholic Acid, Monosodium Salt Digestion Enzymes Gamma Rays Horseradish Peroxidase Hybridomas Immunoglobulins Immunoprecipitation Monoclonal Antibodies Mus Nitrocellulose Nonidet P-40 Photosensitization Prions Proteins Rabbits Tissue, Membrane

Hybrid Antibody Production in 293 Cells

Total RNA was prepared from NLDC-145 19 and GLII7 (gift of R.J. Hodes, National Institutes of Health, Bethesda, MD) hybridomas (both rat IgG2a) using Trizol (GIBCO BRL). Full-length Ig cDNAs were produced with 5′-RACE PCR kit (GIBCO BRL) using primers specific for 3′-ends of rat IgG2a and Ig kappa. The V regions were cloned in frame with mouse Ig kappa constant regions and IgG1 constant regions carrying mutations that interfere with FcR binding 20. DNA coding for hen egg lysozyme (HEL) peptide 46–61 with spacing residues on both sides was added to the C terminus of the heavy chain using synthetic oligonucleotides. Gene specific primers for cloning of rat IgG2a and Ig kappa: 3′-ATAGTTTAGCGGCCGCGATATCTCACTAACACTCATTCCTGTTGAAGCT; 3′-ATAGTTTAGCGGCCGCTCACTAGCTAGCTTTACCAGGAGAGTGGGAGAG-ACTCTTCT; HEL peptide fragment construction: 5′-CTAGCGACATGGCCAAGAAGGAGACAGTCTGGAGGCTCGAG-GAGTTCGGTAGGTTCACAAACAGGAAC; 5′-acagacgtagcacagactatggtattctccagattaacagcaggtattatgacggtaggacatgataggc; 3′-gctgtaccggttcttcctctgtcagacctccgagctcctcaa-gccatccaagtgtttgtccttgtgtctg; 3′-CCATCGTGTCTGATACCATAAGAGGTCTAATTGTCGTCCATAATACTGCCATCCTGTACTATCCGCCGG.
Hybrid antibodies were transiently expressed in 293 cells after transfection using calcium-phosphate. Cells were grown in serum-free DMEM supplemented with Nutridoma SP (Boehringer). Antibodies were purified on Protein G columns (Amersham Pharmacia Biotech). The concentrations of purified antibodies were determined by ELISA using goat anti–mouse IgG1 (Jackson Immunotech).

Hawiger D., Inaba K., Dorsett Y., Guo M., Mahnke K., Rivera M., Ravetch J.V., Steinman R.M, & Nussenzweig M.C. (2001). Dendritic Cells Induce Peripheral T Cell Unresponsiveness under Steady State Conditions in Vivo. The Journal of Experimental Medicine, 194(6), 769-780.

Publication 2001

Antibodies Calcium Phosphates Cells DNA, Complementary Enzyme-Linked Immunosorbent Assay G-substrate Genes Goat hen egg lysozyme hen egg lysozyme peptide (46-61) Hybridomas Hybrids IgG1 IgG2A Immunoglobulin Constant Regions Mice, House Mutation Oligonucleotide Primers Oligonucleotides Peptide Fragments Reading Frames Serum Transfection trizol

Most recents protocols related to «Hybridomas»

Antibody Reactivity Evaluation Across Species

Not available on PMC !

Example 3

Reactivity of the antibodies of the invention against several species of mesothelin (cyno, rat, mouse) was tested using assays well known in the art. The data is summarized in FIG. 4.

FACS binding assays were performed to evaluate the binding of the anti-Mesothlelin antibodies to murine, rat and cynomologous monkey mesothelin orthologues, using recombinant forms of the various receptors transiently expressed on 293T cells. FACs assays were performed by incubating hybridoma supernatants with 10,000 to 25,000 cells in PBS/2% Fetal bovine serum/2 mM Calcium Chloride at 4° C. for one hour followed by two washes with PBS/2% Fetal bovine serum/2 mM Calcium Chloride. Cells were then treated with florochrome-labeled secondary antibodies at 4° C. followed by one wash. The cells were resuspended in 50 μl of PBS/2% FBS and antibody binding was analyzed using a FACSCalibur™ instrument.

US11866508B2. Anti-mesothelin binding proteins (2024-01-09). AMGEN INC. [US]. Inventors: William Christian Fanslow, III [US], Carl Kozlosky [US], Jean Gudas [US].

Full text: Click here

Patent 2024

Anti-Antibodies Antibodies Biological Assay Calcium chloride Cells Cross Reactions HEK293 Cells Hybridomas Immunoglobulins Mesothelin Monkeys Mus

Efficient Antibody Generation via mRNA Immunization

Not available on PMC !

Example 4

An overview of the immunization strategies for lectin-binding proteins, such as galectin-3, is shown in Table 18.

BALB/c mice were immunized with 2 mg/kg mRNA, complexed with LNPs, or 20 μg recombinant protein as indicated in Table 18. Plasma anti-galectin-3 IgG titers were assayed 7 days after the final boost, which was delivered at day 55.

FIG. 3 shows that the use of galectin-3 mRNA as a final boosting agent resulted in a significantly higher target-specific IgG titer than when purified recombinant protein (a traditional immunogen) was used. This effect was observed regardless of whether the antigens were delivered subcutaneously or intravenously.

Hybridomas producing galectin-3-specific antibodies were generated, and high affinity monoclonal anti-galectin-3 antibodies were obtained from further screens.

TABLE 18

Priming ImmunizationBoostFinal Boost

(Day 0)(Day 7)(Day 55)

mRNA (I.V.)mRNA (I.V.)mRNA (I.V.)

mRNA (I.V.)mRNA (I.V.)Recombinant protein

(I.V.)

mRNA (S.C.)mRNA (S.C.)mRNA (S.C.)

mRNA (S.C.)mRNA (S.C.)Recombinant protein

(S.C.)

Summary of the Hit Rates Attainable by mRNA-Mediated Immunization

Table 19 provides a target protein-specific summary of the total number of hybridoma wells (generally about one third (⅓) of these wells contain hybridomas) screened and the number of confirmed target-specific antibodies obtained from those hybridomas wells following the use of lipid-encapsulated mRNA as an immunogen.

Table 20 provides a comparison of mRNA-LNP immunization methods with other conventional methods of immunization by number of hybridomas producing target-specific antibodies. In general, these data suggest that mRNA-LNP immunization is an effective method for inducing an immune response to a target protein antigen and for obtaining a higher number/rate of target protein-specific antibodies. In particular, these results confirm that mRNA-LNP immunization is surprisingly more effective than conventional immunization methods for obtaining antibodies specific for transmembrane proteins, e.g., multi-pass transmembrane proteins, such as GPCRs, which are difficult to raise antibodies against, and for poorly immunogenic proteins (e.g., proteins which produce low or no detectable target-specific IgGs in plasma of animals immunized with traditional antigen).

TABLE 19

Number of

Number ofhybridomas

hybridomaproducing

Proteinwellstarget-specific

targetType of proteinscreenedantibodies

RXFP1Multi-pass Transmembrane20240207

protein/GPCR

SLC52A2Multi-pass Transmembrane12880228

protein

ANGPTL8Soluble protein22816542

TSHRTransmembraneTBD130

protein/GPCR

APJTransmembrane22080230

protein/GPCR

GP130Single-pass Transmembrane23920614

protein

TABLE 20

Method of immunization and number of hybridomas producing

target-specific antibodies

Whole Virus-likeProtein/

ProteinType ofmRNA-cellsparticlesCDNApeptide

targetproteinLNP¹onlyonlyonlyonly

RXFP1GPCR/20766NDNDND

multi-pass

SLC52A2multi-228NSTNSTNDNST

pass

TSHRGPCR/130NDND4²41³

multi-pass

APJGPCR/230 94621 ND

multi-pass

¹Immunization with mRNA-LNP alone or in combination with another antigen format (e.g., protein/peptide).

²Sanders et al. 2002 Thyroid stimulating monoclonal antibodies Thyroid 12(12): 1043-1050.

³Oda et al. 2000. Epitope analysis of the human thyrotropin (TSH) receptor using monoclonal antibodies. Thyroid 10(12): 1051-1059.

ND—Not determined; antigen format not tested

NST—No specific titers detected. Because no target-specific IgG titers were detectable in plasma, hybridoma generation was not initiated on these groups.

In general, successful generation of hybridomas producing antigen-specific antibodies have been achieved for at least 15 different targets utilizing mRNA-LNP immunization methods as exemplified herein. These results show that the mRNA immunization methods described herein are capable of eliciting an immune response against a wide range of antigens (e.g., transmembrane proteins, for example multi-pass transmembrane proteins, such as GPCRs) in host animals, and are effective methods for producing high affinity monoclonal antibodies, which can serve as parentals for generation of chimeric variants, humanized variants, and affinity matured variants.

US11878060B2. mRNA-mediated immunization methods (2024-01-23). NOVARTIS AG [CH]. Inventors: John Dominy [US], Robert Dunn [US], Scott Glaser [US], Mark Keating [US], Carla Klattenhoff [US], Igor Splawski [US].

Full text: Click here

Patent 2024

Animals anti-IgG Antibodies Antigens Binding Proteins Cells Chimera DNA, Complementary Epitopes Galectin 3 Histocompatibility Antigens Class II Homo sapiens Hybridomas Integral Membrane Proteins Lectin Lipids Mice, Inbred BALB C Monoclonal Antibodies Parent Peptides Plasma Proteins Protein Targeting, Cellular Recombinant Proteins Response, Immune RNA, Messenger Soluble Glycoprotein 130 Thyroid Gland Thyrotropin Thyrotropin Receptor Vaccination Viral Proteins

Development of Anti-IL-17RA Monoclonal Antibodies

Not available on PMC !

Example 7

The development of fully human monoclonal antibodies directed against human IL-17RA was carried out using Abgenix (now Amgen Fremont Inc.) XenoMouse® technology (U.S. Pat. Nos. 6,114,598; 6,162,963; 6,833,268; 7,049,426; 7,064,244, which are incorporated herein by reference in their entirety; Green et al, 1994, Nature Genetics 7:13-21; Mendez et al., 1997, Nature Genetics 15:146-156; Green and Jakobovitis, 1998, J. Ex. Med. 188:483-495)). TABLE 4 shows the portions of the IL-17RA protein used as an immunogen and cell lines used to generate and screen anti-IL-17RA antibodies.

TABLE 4

ReagentDescription

IL-17RA.FcHuman IL-17RA extracellular domain with a

C-terminal human Fc domain. Expressed in a

stable CHO cell line.

IL-17RA-FLAG-polyHisHuman IL-17RA extracellular domain with a

(SEQ ID NO: 431)C-terminal FLAG-polyHis tag. Expressed by

transient transfection in COS PKB cells.

IL-17RA CHO cellsHuman IL-17RA full-length expressed on the

surface of CHO cells.

IgG2 XenoMouse® mice were immunized/boosted with IL-17RA-Fc (group 1) and IL-17RA-FLAG-polyHis (group 2). Serum titers were monitored by ELISA and mice with the best titers were fused to generate hybridomas. The resulting polyclonal supernatants were screened for binding to IL-17RA by ELISA, and the positive supernatants were screened for binding to IL-17RA CHO cells by FMAT. Positive supernatants were subjected to additional screening. IgG2 XenoMouse® mice were immunized with the following immunogens: IL-17RA-Fc (group 3) and IL-17RA-FLAG-pHis (group 4) and were tested following additional immunizations.

US11858999B2. IL-17 receptor A antigen binding proteins (2024-01-02). AMGEN K-A, INC. [US]. Inventors: Joel E. Tocker [US], Jacques J. Peschon [US], David Fitzpatrick [AU], James F. Smothers [US], Christopher Mehlin [US], Ai Ching Lim [US].

Full text: Click here

Patent 2024

Anti-Antibodies Antigens Binding Proteins Cell Lines CHO Cells COS Cells Enzyme-Linked Immunosorbent Assay GPI protein, human Homo sapiens Human Development Hybridomas IgG2 IL17RA protein, human Immunization Monoclonal Antibodies Mus Natural Childbirth Proteins Serum Transfection Transients

Antibodies for Glycated CD59 Detection

Not available on PMC !

Example 1

Antibodies to CD59 and K41 Amadori-modified GCD59 were each generated using CD59 fragments. For anti-K41 Amadori-modified GCD59 antibody preparation, CD59 fragments having Amadori-modified K41 were used. Antibodies were prepared by mouse immunization and development of hybridoma cells from animals exhibiting successful expression of antibodies with high affinity and specificity. Clone H9 was developed as a capture antibody, binding to both glycated and non-glycated CD59. Clones D2 and D3 were developed as detection antibodies, binding to K41 Amadori-modified GCD59. Antibodies were sequenced and analyzed to identify antibody regions. Resulting sequences are provided in Tables 1-7. Antibodies D2 and D3 were found to have heavy and light chains with identical amino acid sequences, but with heavy chain nucleotide sequences differing by a single nucleotide.

US11866506B2. Anti-CD59 antibodies (2024-01-09). Mellitus, LLC [US]. Inventors: Michael Chorev [US], Jose A. Halperin [US].

Full text: Click here

Patent 2024

Amino Acid Sequence Animals Antibodies Antibodies, Anti-Idiotypic Base Sequence CD59 protein, human Clone Cells Hybridomas Immunization Immunoglobulins Light Mice, House Nucleotides

Conserved MTB Epitope Targeting Antibodies

Not available on PMC !

Example 4

Composite MTB peptide vaccines induce antibodies that recognize the conserved MTB Alpha Crystallin HSP epitope (designated as TB Pep01) derived from Mycobacterium tuberculosis H37Rv (NC_000962.2).

Serum antibodies from mice 1433-1436 (see FIG. 26) immunized with 50 ug TB Pep01 CRM-conjugated vaccine demonstrated good responses to the conserved MTB epitope (alpha crystallin HSP), TB Pep01. Mouse 1435 (see FIG. 27), selected for fusion, produced hybridomas LD7 I BB2 and CA6 II GA8 that demonstrated good binding activity to TB Pep01 and TB Pep02 epitopes (FIG. 28). Monoclonal antibodies LD7 I BB2 I B9 and CA6 II GA8 I A5 (hereafter referred to as mAb LD7 and CA6) that were developed from the hybridomas not only bound to TB Pep01, but also to live M. smegmatis (see FIG. 29). Importantly, mAbs LD7 and CA6 promoted opsonophagocytic killing of mycobacteria (see FIGS. 30 and 31).

US11866463B2. Immunogenic compositions to treat and prevent microbial infections (2024-01-09). Longhorn Vaccines and Diagnostics, LLC [US]. Inventors: Luke T. Daum [US], Gerald W. Fischer [US], Clara J. Sei [US].

Full text: Click here

Patent 2024

alpha-Crystallins Antibodies Epitopes Figs Hybridomas Monoclonal Antibodies Mus Mycobacterium Mycobacterium tuberculosis H37Rv Serum Vaccines, Conjugate Vaccines, Peptide

Top products related to «Hybridomas»

Alexa fluor 488 by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, Japan, France, Italy, Canada, China, Spain, Switzerland, Denmark, Australia, Hungary, Belgium, Ireland, Israel, Netherlands, Moldova, Republic of, India, Austria, Czechia, Poland

Alexa Fluor 488 is a fluorescent dye used in various biotechnological applications. It has an excitation maximum at 495 nm and an emission maximum at 519 nm, producing a green fluorescent signal. Alexa Fluor 488 is known for its brightness, photostability, and pH-insensitivity, making it a popular choice for labeling biomolecules in biological research.

Vectashield by Vector Laboratories

Sourced in United States, United Kingdom, Germany, Canada, Japan, France, Switzerland, Panama, Spain, China, Italy

Vectashield is a non-hardening, aqueous-based mounting medium designed for use with fluorescent-labeled specimens. It is formulated to retard photobleaching of fluorescent dyes and provides excellent preservation of fluorescent signals.

4 6 diamidino 2 phenylindole (dapi) by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, Japan, China, Canada, Italy, Australia, France, Switzerland, Spain, Belgium, Denmark, Panama, Poland, Singapore, Austria, Morocco, Netherlands, Sweden, Argentina, India, Finland, Pakistan, Cameroon, New Zealand

DAPI is a fluorescent dye used in microscopy and flow cytometry to stain cell nuclei. It binds strongly to the minor groove of double-stranded DNA, emitting blue fluorescence when excited by ultraviolet light.

Rabbit anti gfp by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, France, Canada

Rabbit anti-GFP is a polyclonal antibody raised against green fluorescent protein (GFP) in rabbits. This antibody can be used to detect and visualize GFP-tagged proteins in various experimental applications.

4 6 diamidino 2 phenylindole (dapi) by Merck Group

Sourced in United States, Germany, Japan, United Kingdom, China, Italy, Sao Tome and Principe, France, Macao, Canada, Switzerland, Spain, Australia, Denmark, India, Poland, Israel, Belgium, Sweden, Ireland, Netherlands, Panama, Brazil, Portugal, Czechia, Puerto Rico, Austria, Hong Kong, Singapore

DAPI is a fluorescent dye that binds strongly to adenine-thymine (A-T) rich regions in DNA. It is commonly used as a nuclear counterstain in fluorescence microscopy to visualize and locate cell nuclei.

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

Alexa 488 by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, France, Japan, Switzerland, Canada, Panama, China, Italy, Denmark, Spain

Alexa 488 is a fluorescent dye used in various biological applications. It is a brighly fluorescent, green-emitting dye with excitation and emission maxima at 495 and 519 nm, respectively. Alexa 488 can be conjugated to biomolecules such as proteins, antibodies, or nucleic acids to enable their detection and visualization.

Penicillin streptomycin by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia

Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.

Dulbecco modified eagle medium (dmem) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica

DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.

Complete freund s adjuvant by Merck Group

Sourced in United States, China, Germany, United Kingdom, India, France, Japan, Poland, Sao Tome and Principe, Australia, Macao, Canada, Spain, Denmark, Israel, Sweden

Complete Freund's adjuvant is a laboratory reagent used to enhance the immune response in laboratory animals during the production of antibodies. It contains inactivated and dried mycobacteria suspended in a mineral oil emulsion. The mycobacteria component serves to stimulate the animal's immune system, leading to a stronger and more sustained antibody response to the antigen of interest.

What are the common challenges in working with Hybridomas?

One of the main challenges with Hybridomas is maintaining their stability and monoclonality over extended culture periods. Hybridomas can undergo genetic drift and changes in antibody production levels, which can impact the reliability and consistency of your results. Another challenge is optimizing the fusion and selection process to generate high-yielding Hybridomas in the first place. PubCompare.ai can help by identifying the most robust and reproducible Hybridoma generation protocols from the literature, preprints, and patents, ensuring you start with the best possible cell lines for your research.

What are the different types or variations of Hybridomas?

There are several variations of Hybridomas beyond the classic B cell-myeloma fusion. These include:Rodent-rodent Hybridomas: Fusing two different rodent cell lines, often mouse-mouse or rat-rat, to generate more stable cell lines. Human-human Hybridomas: Fusing two human B cells or a human B cell with a human myeloma cell line, which can produce fully human monoclonal antibodies. Humanized Hybridomas: Fusing a human B cell with a mouse myeloma cell to produce chimeric antibodies with human variable regions. PubCompare.ai can help you identify the optimal Hybridoma type and generation protocol for your specific research needs and antibody requirements.

How can PubCompare.ai assist in optimizing Hybridomas research?

PubCompare.ai's AI-driven platform can help streamline your Hybridomas research in several ways:1. Efficient protocol screening: The platform allows you to rapidly sift through the scientific literature, preprints, and patents to identify the most effective Hybridoma generation and culture protocols. 2. Critical insight generation: PubCompare.ai's AI analyzes the protocols to highlight key differences in factors like fusion efficiency, antibody production levels, and culture stability - enabling you to choose the best option for reproducibility.3. Procedure optimization: Based on the insights gleaned, PubCompare.ai can suggest the optimal products, reagents, and procedures to use for your specific Hybridomas research goals, saving you time and improving your chances of success.

What are some common applications of Hybridomas?

Hybridomas have a wide range of applications in biomedical research and therapeutic development:1. Monoclonal antibody production: Hybridomas are the gold standrad for generating large quantities of highly specific monoclonal antibodies.2. Immunoassay development: Hybridoma-derived antibodies are widely used in ELISA, Western blotting, and other immunoassay techniques.3. Target validation: Hybridoma antibodies can be used to identify and validate therapeutic targets and biomarkers.4. Therapeutic antibody discovery: Hybridoma technology is often the starting point for discovering and developing new therapeutic antibody candidates.5. Cell line characterization: Hybridoma-produced antibodies are invaluable tools for immunophenotyping and verifying cell line identities.PubCompare.ai can help you find the most effective Hybridoma protocols to support your specific applications and research objectives.

More about "Hybridomas"

Hybridomas are a type of immortalized cell line created by fusing a B lymphocyte with a myeloma cell.
These hybrid cells, also known as monoclonal antibody-producing cells, are invaluable tools for biomedical research and therapeutic development.
They produce large quantities of a specific monoclonal antibody, making them highly versatile and useful in a wide range of applications.
Monoclonal antibodies (mAbs) are a class of antibodies that are produced by a single clone of B cells, recognizing a specific antigen.
Hybridomas are the primary method for generating these mAbs, as they allow for the mass production of a desired antibody.
This technology has revolutionized the field of immunology and has led to advancements in areas such as cancer treatment, disease diagnosis, and targeted drug delivery.
To optimize your Hybridomas research, consider utilizing reagents and tools such as Alexa Fluor 488, a fluorescent dye commonly used for labeling and visualization; Vectashield, a mounting medium that helps preserve fluorescent signals; and DAPI, a nucleic acid stain that can be used to visualize cell nuclei.
Antibodies like Rabbit anti-GFP can also be useful for detecting and quantifying target proteins.
Additionally, the use of cell culture media like Dulbecco's Modified Eagle Medium (DMEM) and the addition of supplements such as Fetal Bovine Serum (FBS) and Penicillin/Streptomycin can help maintain the health and viability of your Hybridomas cultures.
To streamline your Hybridomas research, consider utilizing the AI-driven platform of PubCompare.ai.
This tool can help you locate the most effective protocols from literature, preprints, and patents, as well as identify the best products and procedures to optimize your work.
Experience the future of reproducible Hybridomas research today with PubCompare.ai.