Mice were group housed in cages of 2 to 5 on a 12-hour light/12-hour dark cycle with food and water provided ad libitum. The mice used in this study for behavioral testing were between 3–5 months of age, including both males and females.
Mice with
Nrxn1α promoter and exon 1 deletion (ΔExon1) were described previously [9 (
link)] and have been maintained in
C57BL/6J background. Mice with
Nrxn1α exon 9 deletion (ΔExon9) were generated by crossing an exon 9 floxed allele of
Nrxn1α (Nrxn1tm1a(KOMP)Wtsi from MRC Mary Lyon Center, Harwell, UK) [13 (
link)] with mice carrying
UBC-CreERT2 [70 (
link)]. An unexpected leaky activity of Cre in male gametes [33 (
link)] carrying both floxed exon 9 of
Nrxn1α and
UBC-Cre-ERT2 leads to a germline loss of exon 9 (ΔExon9). The deletion of exon 9 was confirmed by PCR analysis using primers flanking the deleted region and within the exon 9 sequence. To study a CNV identified in an individual on the autism spectrum [27 (
link)], mouse homologue of the ~20 kb deleted region at intron 17 of
Nrxn1α was identified and deleted using the CRISPR/Cas9-medicated genomic editing approach. Two sgRNAs (5’ AATATGTGGGCAAGCTGGGT
TGG 3’ and 5’ GAAATGGTACCTTTGATCTA
AGG 3’) flanking the deletion region in intron 17 of
Nrxn1α were injected together with Cas9 protein into 1-cell zygote of
C57BL/6J/
SJL genetic background. The target deletion was confirmed by PCR and sequencing analyses using primers flanking the deleted region and deletion carriers (ΔIntron17) were back crossed to
C57BL/6J for 5 more generations to collect littermates for behavioral phenotyping.
To generate experimental animals used in this study, heterozygous males were bred with heterozygous females to generate mice with homozygous (ΔExon9/ΔExon9; ΔIntron17/ΔIntron17) or heterozygous (ΔExon9/+; ΔIntron17/+) deletions, as well as WT littermates (+/+). We noted that mice carrying homozygous deletion of exon 9 (ΔExon9/ΔExon9) were significantly underrepresented with WT:Het:Homo ratio as 48:90:29, in contrast to the expected ratio of 42:83:42, indicating sub-viability in mice carrying a complete loss of
Nrxn1α. To generate mice carrying ΔExon1, heterozygous carriers of ΔExon1 were bred with WT mice to collect heterozygotes and WT for experiments described in this study.
Xu B., Ho Y., Fasolino M., Medina J., O’Brien W.T., Lamonica J.M., Nugent E., Brodkin E.S., Fuccillo M.V., Bucan M, & Zhou Z. (2023). Allelic contribution of Nrxn1α to autism-relevant behavioral phenotypes in mice. PLOS Genetics, 19(2), e1010659.
