Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > 6-Phosphofructokinase

6-Phosphofructokinase

6-Phosphofructokinase is a key enzyme invovled in glycolysis, catalyzing the irreversible conversion of frutucose-6-phosphate to frutucose-1,6-bisphosphate.
It plays a critical role in regulating cellular energy metabolism.
Researchers can maximize their 6-Phosphofructokinase studies with PubCompare.ai, an AI-driven platform that enhances reproducibility and accuracy.
Discover protocols from literature, preprints, and patents, and utilize intelligent comparisons to identify the best methodologies and products.
Boost your research efficiency and confindence with PubCompare.ai's powerful tools.

Most cited protocols related to «6-Phosphofructokinase»

1
Genome-Scale Metabolic Model of Methanogenic Archaea
The reconstruction software SimPheny™, version 1.7.1.1 (Genomatica Inc., San Diego, CA), was the software platform on which the model was built. The ORF draft annotations for M. barkeri Fusaro, downloaded from the ORNL website (http://genome.ornl.gov/microbial/mbar/, February 2004), were used as a framework on which translated metabolic proteins were assigned to form GPR assignments. The draft genome consisted of 67 contigs of length 4.8 Mb and 5072 predicted candidate ORFs. Most GPR assignments were made from the genome annotation and the model was constructed on a pathway basis manually. Biochemical databases such as KEGG (http://www.genome.jp/kegg/), the Enzyme Nomenclature Database (http://www.chem.qmul.ac.uk/iubmb/enzyme/) and the MetaCyc database (http://metacyc.org/) were used as general guides for pathways and sources for previous genome annotations. When a reaction was entered into the model, the participating metabolites were characterized according to their chemical formula and charge determined for a cytosolic pH of 7.2, a value consistent with the intracellular range determined for methanogens (von Felten and Bachofen, 2000 (link); de Poorter et al, 2003 (link), 2005 (link)). Metabolite charge was determined using its pKa value. When the metabolite pKa was not available, charge was determined using the pKa of ionizable groups present in a metabolite. It should be mentioned that the charge of almost all metabolites in the network will not change for a pH increase or decrease of greater than ∼1.5 pH units based on the pKa values of the ionizable groups (most frequently, carboxyl groups and amines, pKa ∼4 and ∼9, respectively). The BLAST algorithm (Altschul et al, 1997 (link)) was implemented to infer gene function for enzymes needed to form complete pathways where no gene could be found in the annotation (see Supplementary information 1 for detailed BLAST results). Operon structure was also considered when assigning function when multiple genes having identical annotations were found. GPR associations were also made directly from biochemical evidence presented in journal publications and reviews (see Supplementary information 1). The Pathway Tools software, version 8.5 (http://bioinformatics.ai.sri.com/ptools/), was used to generate an automated metabolic reconstruction and the pathways were analyzed and used to form or confirm GPR associations after manual inspection. Organism specificity of the reactions was achieved by including (i) the unique metabolites present in M. barkeri, such as H4SPT (Grahame and DeMoll, 1996 (link)), methanofuran-b (Bobik et al, 1987 (link)), and coenzyme F420 (Raemakers-Franken et al, 1991 (link)), (ii) specific physiological cofactors, such as ADP for phosphofructokinase (Verhees et al, 2003 (link)) and coenzyme F420 as an electron donor in glutamate synthase (Raemakers-Franken et al, 1991 (link)), (iii) the measured stoichiometric values for proton and ion translocation reactions in the electron transport chain of M. barkeri (Deppenmeier, 2004 (link); Muller, 2004 (link)), and (iv) the necessary metabolic transport reactions for substrates and products of metabolism. Transport reactions were added to the network from the genome annotation or alternatively from physiological data (these were added when a metabolite was taken up into the cell or excreted into the media; Krzycki et al, 1985 (link); Bock et al, 1994 ; Buchenau and Thauer, 2004 (link)). All of the reactions entered into the network were both elementally and charged balanced and were labeled either reversible or irreversible. Reversibility was determined first from primary literature if an enzyme was characterized and additionally from thermodynamic considerations, for example, reactions that consume high-energy metabolites (ATP, GTP, etc.) are generally irreversible.
ORFs in the draft genome annotation that were determined to be previously unannotated were genes assigned functionality in the model which contained the words ‘hypothetical' or similar. Genes that were deemed misannotated were determined to be assigned a function considerably different or more specific than what was given in the draft annotation.
Feist A.M., Scholten J.C., Palsson B.Ø., Brockman F.J, & Ideker T. (2006). Modeling methanogenesis with a genome-scale metabolic reconstruction of Methanosarcina barkeri. Molecular Systems Biology, 2, 2006.0004.
Publication 2006
6-Phosphofructokinase Amines carbon dioxide reduction factor Cells coenzyme F420 Cytosol Electrons Electron Transport Enzymes Genes Genome Glutamate Synthase Ion Transport Metabolism Methanobacteria Multiple Birth Offspring Open Reading Frames Operator, Genetic Operon Proteins Protons Protoplasm Reconstructive Surgical Procedures Tissue Donors Translocation, Chromosomal
2
Engineered E. coli Ancestor Strain

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2016
6-Phosphofructokinase Biological Evolution Carbon Clone Cells Enzymes Escherichia coli Frameshift Mutation Genes Genome Genotype Glyoxylates Mutation Operon Oxidoreductase Parent Phenotype Phosphates Phosphoglycerate Mutase Pyruvate Strains tartronate semialdehyde Vaccination
3
Kinetic Modeling of CHO Cell Metabolism
Most of fluxes kinetics are as previously described [29 ,30 (link),33 (link)] (S2 Table). All kinetic equations in this work are based on mechanistic formulations known as biologically relevant, rather than using empirical equations. Reactions rate are composed of multiplicative Michaelis-Menten kinetics accounting for each substrates involved. In the case of energetic nucleotides, ratios are used (AMP/ATP, ATP/ADP, NADH/NAD, NADP/NADPH, ADP/ATP, NAD/NADH, NADPH/NADP). This approach was successful in another work on the modeling of the metabolism of skeletal muscle cells [36 (link)] as well as in our previous work on a similar modelling approach applied to another CHO cell line [29 , 30 (link), 33 (link)]. The regulation of glycolysis is as previously described [33 (link)], with feedback inhibition phenomena of hexokinase (VHK), phosphoglucose isomerase (VPGI) and reverse lactate dehydrogenase (VrLDH), by glucose-6-phosphate, phosphoenolpyruvate and pyruvate, respectively. The AMP-to-ATP ratio activates phosphofructokinase (VPFK), lactate dehydrogenase (VLDH) and VHK, while fructose-6-phosphate activates pyruvate kinase (VPK). The reactions involving an inhibition mechanism were described according to the mathematical formulation of a non-competitive inhibition (Eq 1). However, the reaction mechanism used to describe activation phenomena is that for non-essential activation as proposed in [37 ] (Eq 2).
In the present work, VPFK is inhibited by intracellular citrate and extracellular lactate [38 (link),39 (link)], and VPK is inhibited by alanine [40 (link),41 ]. The reverse reaction of alanine aminotransferase (VrAlaTA) is also inhibited by glutamine to account for the switch from alanine production to alanine consumption when glutamine level is low, as observed in our experimental data. Reverse reactions are also modeled for glutamine synthetase (VGlnT), glutamate dehydrogenase (VGLDH), lactate dehydrogenase (VLDH), glutamate transport (VGluT) and adenylate kinase (VAK), but not for VASTA because there was no evidence from our measurements of a net production of extracellular aspartate, but only a net consumption.
The cell specific growth rate is modeled as a multiplicative Michaelis-Menten mechanism accounting for major precursors of cell building blocks, an approach that has been previously successfully applied to plant [27 (link)] and mammalian cells [29 ,30 (link),31 (link)]. All extracellular amino acids included in the model were considered, as well as the intracellular levels of glucose-6-phosphate, citrate and ribulose-5-phosphate, which act as the respective precursors for glycogen, proteins and lipids, and nucleotides such as DNA and RNA. For each of those species, a different affinity constant was determined, to represent the situation when one species, for instance glutamine, is nearly depleted without significantly affecting the growth rate. A specific set of affinity constants was also used to describe the mAb production rate. Finally, inhibitory effects of lactate and ammonia on the growth rate were added to account for their accumulation in the culture media. A non-competitive inhibition mechanism was applied [42 (link)], with a distinct affinity constant for lactate regarding the growth (Equation 33 in S2 Table) and VPFK (Equation 3 in S2 Table) reactions.
Robitaille J., Chen J, & Jolicoeur M. (2015). A Single Dynamic Metabolic Model Can Describe mAb Producing CHO Cell Batch and Fed-Batch Cultures on Different Culture Media. PLoS ONE, 10(9), e0136815.
Publication 2015
6-Phosphofructokinase Alanine Amino Acids Ammonia Aspartate Cell Lines Cells CHO Cells Citrate Culture Media D-Alanine Transaminase fructose-6-phosphate Glucose-6-Phosphate Glucosephosphate Isomerase Glutamate-Ammonia Ligase Glutamate Dehydrogenase Glutamates Glutamine Glycogen Glycolysis Hexokinase Kinase, Adenylate Kinetics Lactate Lactate Dehydrogenase Lipids Mammals Metabolism NADH NADP Nucleotides Phosphoenolpyruvate Plants Proteins Protoplasm Psychological Inhibition Pyruvate Kinase Pyruvates ribulose 5-phosphate Skeletal Myocytes Stem Cells, Hematopoietic
4
Comprehensive Model of P. aeruginosa Metabolism
A large-scale model of the central metabolism of P. aeruginosa was assembled according to the genome-scale model of P. aeruginosa PAO1 [24] (link), KEGG database [25] (link), and the Pseudomonas genome database [26] (link). The network compromised the Entner-Doudoroff pathway (EDP), incomplete Embden-Meyerhof-Parnas pathway lacking phosphofructokinase (EMPP), pentose phosphate pathway (PPP), gluconeogenesis, reactions of pyruvate carboxylase, PEP carboxylase, PEP carboxykinase, malic enzyme, tricarboxylic acid (TCA) cycle, glyoxylate pathway, and anabolic pathways generating biomass. The chemical composition of P. aeruginosa cells was adapted from that of closely related Pseudomonas species [27] (link), [28] . Because P. aeruginosa uniquely synthesizes the capsular polysaccharide alginate [29] (link), the cellular content of this polymer was measured (Table S1, [30] (link)), and the corresponding precursor demand was considered for all strains. The calculation of metabolic flux through the network was performed using OpenFLUX software [31] (link). For each strain, the mass isotopomer distributions of the derivatized amino acid residues [M-57] of alanine (m/z 260), glycine (m/z 246), valine (m/z 288), serine (m/z 390), threonine (m/z 404), phenylalanine (m/z 336), aspartate (m/z 418), glutamate (m/z 432), tyrosine (m/z 466), and the [M-85] fragment of serine (m/z 362) were used as input after correction for natural isotopes [32] (link). Multiple flux estimations using statistically varied starting values for free flux parameters confirmed the identification of a global minimum. For all flux data, 95% confidence intervals were calculated using a Monte Carlo approach [33] .
Berger A., Dohnt K., Tielen P., Jahn D., Becker J, & Wittmann C. (2014). Robustness and Plasticity of Metabolic Pathway Flux among Uropathogenic Isolates of Pseudomonas aeruginosa. PLoS ONE, 9(4), e88368.
Publication 2014
6-Phosphofructokinase Alanine Alginate Amino Acids Androgens, Synthetic Aspartate Capsule chemical composition Citric Acid Cycle Embden-Meyerhof Pathway Genome Gluconeogenesis Glutamates Glycine glyoxylate Isotopes Metabolism Pentose Phosphate Pathway Phenylalanine Polymers Polysaccharides Pseudomonas Pseudomonas aeruginosa Pyruvate Carboxylase pyruvic-malic carboxylase Serine Strains Threonine Tyrosine Valine
5
Cytokine-induced gene expression in cultured islets
Islets were cultured with IL-1ß (200 U/ml; R&D Systems, USA) for 2 h, and gene expression was measured by real-time PCR as previously reported (5 (link)).
Mouse Primers were as follows: Glut1, acctatggccaaggacacac and ctggtctcaggcaaggaaag; Glut2, cat gctgagctctgctgaag and acagtccaacggatccactc; insulin receptor substrate 2 (Irs2), gtagttcaggtcgcctctgc and ttgggaccaccactcctaag; pancreatic and duodenal homeobox 1 (Pdx1), gaaatccaccaaagctcacg and ttcaacatcactgcca gctc; phosphofructokinase (Pfk), atggcaaagctatcggtgtc and acacagtcccatttggcttc; Bak, cgctacgacacagagttcca and ggtagacgtacagggccaga; Bax, tgcagaggatgattgctgac and gatcagctcgggcactttag; Bcl2, tctgaaggattgatggcaga and catcagccacgcctaaaagt; Bclxl, ccattgctaccaggagaacc and aggagctggtttaggggaaa.
Human primers were as follows: GLUT1, agcct gcaaactcactgctc and cctaccctcaatccacaagc; GLUT2, ggccattactaacacgcattg and agcaccctgctaagcttttg; IRS2, cagtgttttccttttgggtacg and tggctattaaggagggcatc; v-akt murine thymoma viral oncogene homolog 2 (AKT2), acacctctgggtgtttggag and gaggagaaaggccagtaggg; PFK, ttgactgcaggaagaacgtg and gcacacaaatggaatcatcg.
Stokes R.A., Cheng K., Deters N., Lau S.M., Hawthorne W.J., O’Connell P.J., Stolp J., Grey S., Loudovaris T., Kay T.W., Thomas H.E., Gonzalez F.J, & Gunton J.E. (2012). Hypoxia-Inducible Factor-1α (HIF-1α) Potentiates β-Cell Survival After Islet Transplantation of Human and Mouse Islets. Cell transplantation, 22(2), 253-266.
Publication 2012
6-Phosphofructokinase AKT2 protein, human BCL2 protein, human Duodenum Gene Expression Homeo Box Sequence Homo sapiens IRS2 protein, human Mus Oligonucleotide Primers Oncogenes Pancreas PDX1 protein, human Real-Time Polymerase Chain Reaction SLC2A1 protein, human SLC2A2 protein, human Thymoma

Most recents protocols related to «6-Phosphofructokinase»

1
Quantification of Glycolytic Enzyme Activities
The specific enzyme activity of phosphofructokinase (PFK), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and pyruvate kinase (PK) was measured according to manufacture’s instruction (Catlog No. KT20327, KT20332 and KT20328, respectively, Moshake, Wuhan, China). WT-GBS or AR-GBS were cultured in BHI, washed three times with sterile saline, and was resuspended in 1× PBS (pH 7.0) to OD600 = 1.0. 5 ml of bacterial suspension was used for enzymatic activity assay that were centrifuged and resuspended in 1 mL phosphate-buffered saline (PBS) containing 10 mg lysozyme. After incubation for 30 min, bacteria were lysed by sonication for 10 min (200 W total power with 35% output, 2s pulse, 3s pause over ice). The solution was then centrifuged with 12,000 rpm at 4°C for 10 min to remove insoluble materials. Protein concentration of the supernatant was quantified by BCA protein concentration determination kit (P0009, Beyotime).
Specific enzymatic activities of PFK/GAPDH/PK activity were quantified by sandwich enzyme-linked immunosorbent assay (ELISA) based on that the antibody recognizes the phosphorylation or acetylation site that is only present in activated enzyme. 10 μL supernatant was added to ELISA plate pre-coated with antibodies against PFK, GAPDH or PK and then combined with HRP-labelled PFK, GAPDH or PK antibody to form antibody-antigen-HRP-conjugated antibody complex. The substrate TMB is converted into blue under the catalysis of HRP enzyme, and the final yellow colour under the action of acid is positively correlated with PFK/GAPDH/PK activity in the sample. The absorbance at 450 nm was measured in a PerkinElmer LS55 Fluorescence Spectrophotometer (PerkinElmer). PFK/GAPDH/PK activity concentration was calculated by standard curve. And the specific activities of the above three enzymes were calculated by normalizing the units of PFK/GAPDH/PK activity with the quantity of protein in each sample, which were expressed as U/mg protein.
Chen X.W., Wu J.H., Liu Y.L., Munang’andu H.M, & Peng B. (2023). Fructose promotes ampicillin killing of antibiotic-resistant Streptococcus agalactiae. Virulence, 14(1), 2180938.
Publication 2023
6-Phosphofructokinase Acetylation Acids Antibodies Bacteria Biological Assay Catalysis Complex, Immune Enzyme-Linked Immunosorbent Assay enzyme activity Enzymes Fluorescence Glyceraldehyde-3-Phosphate Dehydrogenases Immunoglobulins Muramidase Phosphates Phosphorylation Proteins Pulse Rate Pyruvate Kinase Saline Solution Sterility, Reproductive
2
Consensus Metabolic Model of E. coli
The “consensus” E. coli core metabolic model [41 (link)] was used with minor changes (see Supplementary Materials Table S1). Briefly, the model included the main pathways of E. coli glucose metabolism: Embden−Meyerhof−Parnas (EMP), pentose−phosphate (PP), and Entner−Doudoroff (ED), the tricarboxylic acid (TCA) cycle, the glyoxylate shunt, anaplerotic carboxylation, and decarboxylation of malate and oxaloacetate. For the transketolase (EC 2.2.1.1, TK) and transaldolase (EC 2.2.1.2, TA) reactions, a ping-pong mechanism of their action was considered, and reactions were modeled as metabolite specific, reversible, C2 and C3 fragment producing, and consuming half-reactions of TK-C2 and TA-C3 [42 (link)].
The fructose-1,6-bisphosphatase and phosphoenolpyruvate synthetase reactions were added to the model, as cells grown on glucose minimal medium possess these enzymes [43 (link),44 (link),45 (link)]. The energy-consuming futile cycles composed of reactions catalyzed by these two enzymes and by corresponding partners, such as 6-phosphofructokinase or pyruvate kinase reactions [46 (link),47 (link),48 (link),49 (link)], can affect the central metabolism of the cells [50 (link)]. Two alternative pathways for acetate synthesis were considered: first, acetate synthesis from acetyl-CoA via reversible reactions of the phosphate acetyltransferase and acetate kinase and, second, acetate synthesis from pyruvate via an irreversible pyruvate oxidase reaction. Both pathways are known to be active in E. coli [51 (link),52 (link),53 (link)]. Accounting for both pathways for acetate synthesis may affect the accuracy of the pyruvate dehydrogenase (PDH) flux estimation. Thus, the PDH flux was characterized by an interval in which the lower boundary was limited by the acetyl-CoA requirement for biomass synthesis and the upper boundary was determined under the assumption that all secreted acetate is synthesized from acetyl-CoA.
To account for CO2-associated carbon transfer, reactions accompanied by CO2 production or consumption were expressed in an explicit manner including an anabolic reaction and a reaction of CO2 exchange with an environment modeled as specified in [54 (link)].
Two known pathways for the glycine synthesis in E. coli, from serine and threonine [55 (link)], were included into the model. According to the previously performed analysis of cells grown aerobically on 13C-labeled glucose, the glycine cleavage is irreversible [56 (link)].
The reversible reactions were modeled as described in [57 (link)], that is, as forward (F) and reverse (R) fluxes, the difference between which gives a value of net flux through the reversible reaction.
The amino acid biosynthesis reactions, data on the mass isotopomer distribution (MID) of which were used for flux calculation, were explicitly expressed. To account for carbon transfer associated with biomass synthesis, reactions of nucleotides biosynthesis were explicitly expressed as well. One example is carbon transfer from the aspartate pool to the fumarate pool when aspartate is used as a donor of the amino group. Metabolites drained for biomass synthesis were accounted for by a single biomass equation, as described in Section 2.9.4.
Atom transition schemes were extracted from the literature [58 (link)]. The measured external carbon fluxes (effluxes) were biomass synthesis, efflux of secreted acetate, and the glucose uptake rate.
Malykh E.A., Golubeva L.I., Kovaleva E.S., Shupletsov M.S., Rodina E.V., Mashko S.V, & Stoynova N.V. (2023). H+-Translocating Membrane-Bound Pyrophosphatase from Rhodospirillum rubrum Fuels Escherichia coli Cells via an Alternative Pathway for Energy Generation. Microorganisms, 11(2), 294.
Publication 2023
6-Phosphofructokinase Acetate Acetate Kinase Amino Acids Anabolism Androgens, Synthetic Aspartate Biosynthetic Pathways Carbon Carbon Cycle Cells Citric Acid Cycle Coenzyme A, Acetyl Cytokinesis Decarboxylation Drug Kinetics Enzymes Escherichia coli Fructose Fumarate Futile Cycles Glucose Glycine glyoxylate Ligase malate Metabolism Nucleotides Oxaloacetate Oxidoreductase Pentosephosphates Phosphate Acetyltransferase Phosphoenolpyruvate Pyruvate Pyruvate Kinase Pyruvate Oxidase Serine Threonine Tissue Donors Transaldolase Transketolase
3
Quantification of Glycolytic Enzymes by ELISA
Hexokinase, 6-phosphofructokinase (PFK), phosphoglycerate kinase (PGK), and pyruvate kinase (CDC19) enzyme-linked immunosorbent assay (ELISA) kits were purchased from Shanghai Preferred Biotechnology Co., Ltd. Yeast cells were pretreated with Rg1, homogenates were centrifuged at 1620× g for 10 min, and the supernatant was taken to determine the amounts of hexokinase, PFK, PGK and CDC19. According to the instructions of the ELISA kits, 50 μL of standard was added to the standard well, and the sample wells contained 10 μL of sample and 40 μL of buffer. HRP-labeled antibody (100 μL) was added to the standard and sample wells, and the mixtures were incubated at 37 °C for 60 min. Washing was repeated five times. Then, 100 μL of substrate was added to each well, and the samples were incubated at 37 °C for 15 min in the dark. Stop solution (50 μL) was added, and the samples were detected at 450 nm using a microplate reader (Tecan Group).
Wang S., Qiao J., Jiang C., Pan D., Yu S., Chen J., Liu S., Zhang P., Zhao D, & Liu M. (2023). Ginsenoside Rg1 Delays Chronological Aging in a Yeast Model via CDC19- and SDH2-Mediated Cellular Metabolism. Antioxidants, 12(2), 296.
Publication 2023
6-Phosphofructokinase Buffers Cells Enzyme-Linked Immunosorbent Assay Hexokinase Immunoglobulins MCM2 protein, human Phosphoglycerate Kinase Pyruvate Kinase Yeast, Dried
4
Soleus Muscle Enzyme Activity Assay
Soleus samples (~20 mg) were used to determine the maximum activity of enzymes that participate in glucose metabolism: phosphofructokinase (PFK), pyruvate kinase (PK), lactate dehydrogenase (LDH), citrate synthase (CS), and carnitine palmitoyltransferase-1 (CPT-1), as previously described [50 (link),51 (link),52 (link),53 (link)]. Enzyme activities were assessed in triplicate and measurements performed every 10 s over a 3 min period on Spectramax M5 spectrophotometer (Molecular Devices, Sunnyvale, CA, USA). Results were expressed on a protein basis as determined by the BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA, USA).
Souza L.M., Gomes M.J., Brandao B.B., Pagan L.U., Gatto M., Damatto F.C., Rodrigues E.A., Pontes T.H., Borim P.A., Fernandes A.A., Murata G.M., Zornoff L.A., Azevedo P.S., Okoshi K, & Okoshi M.P. (2023). Effects of Resistance Exercise on Slow-Twitch Soleus Muscle of Infarcted Rats. Antioxidants, 12(2), 291.
Publication 2023
6-Phosphofructokinase Biological Assay Carnitine O-Palmitoyltransferase Citrate (si)-Synthase enzyme activity Glucose Lactate Dehydrogenase Medical Devices Metabolism Proteins Pyruvate Kinase Soleus Muscle Staphylococcal Protein A
5
Western Blot Analysis of Signaling Proteins
Western blotting analysis was applied to examine protein levels using antibodies recognizing Rho A (Abcam, Cambridge, MA, USA), ROCK1 (Abcam), ROCK2 (Abcam), myosin phosphatase-targeting subunit 1 (MYPT1) (Cell Signaling Technology (CST), Danvers, MA, USA), phosphorylated (p)-MYPT1 (CST), glucose transporter type 1, erythrocyte/brain (GLUT1) (Abcam), hexokinase 2 (HK2) (Abcam), pyruvate dehydrogenase kinase 1(PDK1) (Abcam), phosphofructokinase 1 (PFK1) (CST), lactate dehydrogenase A (LDHA) (Abcam), osteopontin (OPN) (Abcam), RUNX2 (Abcam), AMPK (Abcam), p-AMPK (Abcam), ubiquitination (Proteintech, Rosemont, IL, USA), Sodium Potassium ATPase (Abcam), and β-actin (Proteintech). Human aortic valve tissues and VICs were rinsed with cold 1× PBS, and then lysed on ice in radioimmunoprecipitation assay (RIPA) lysis buffer (Beyotime Biotech; 50 mM Tris, pH 7.4, 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 1 mM sodium orthovanadate, 1 mM sodium fluoride, 1 mM Ethylenediaminetetraacetic acid (EDTA), and leupeptin) containing 1 mM phenylmethylsulfonyl fluoride (PMSF) for 15 min, followed by homogenization with 20 kHz ultrasonic lapping and centrifugation at 14,000 rpm at 4 °C in a refrigerated microcentrifuge for 15 min to extract total protein. Then, supernatants were stored and a bicinchoninic acid (BCA) Protein Assay Kit (Beyotime Biotech) was used to detect the total protein concentration to normalize the samples. Equal amounts of samples (30–45 μg/lane) were run on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels and then transferred to polyvinylidene difluoride (PVDF) membranes using a wet-transfer system. The membranes were blocked using QuickBlock Blocking Buffer (Beyotime Biotech) at room temperature for 20 min, and then incubated with primary antibodies at 4 °C overnight. After three washes with Tris-buffered saline-Tween-20 (TBST) (Servicebio, Wuhan, China), we incubated membranes with the corresponding secondary antibodies coupled with horseradish peroxidase (HRP) for 90 min on shakers. After three washes with TBST, enhanced chemiluminescence (ECL) signals (Amersham Biosciences, Piscataway, NJ, USA) were detected using an ECL kit (Millipore, Billerica, MA, USA) with Imaging system (Thermo Fisher Scientific). Densitometric quantification was performed using Image J software.
Liu H., Yin H., Wang Z., Yuan Q., Xu F., Chen Y, & Li C. (2023). Rho A/ROCK1 signaling-mediated metabolic reprogramming of valvular interstitial cells toward Warburg effect accelerates aortic valve calcification via AMPK/RUNX2 axis. Cell Death & Disease, 14(2), 108.
Publication 2023
6-Phosphofructokinase Actins Antibodies bicinchoninic acid Biological Assay Brain Cardiac Arrest Centrifugation Chemiluminescence Cold Temperature Densitometry Deoxycholic Acid, Monosodium Salt Edetic Acid Erythrocytes Gels GLUT-1 Protein Hexokinase II Homo sapiens Horseradish Peroxidase LDH 5 leupeptin Na(+)-K(+)-Exchanging ATPase Orthovanadate Osteopontin PDK1 protein, human Phenylmethylsulfonyl Fluoride Phosphatase, Myosin polyvinylidene fluoride Proteins Protein Subunits Pyruvate Dehydrogenase Acetyl-Transferring Kinase Radioimmunoprecipitation Assay ROCK1 protein, human ROCK2 protein, human RUNX2 protein, human Saline Solution SDS-PAGE SLC2A1 protein, human Sodium Sodium Chloride Sodium Fluoride Sulfate, Sodium Dodecyl Tissue, Membrane Tissues Triton X-100 Tween 20 Ubiquitination Ultrasonics Valves, Aortic Western Blot

Top products related to «6-Phosphofructokinase»

1
Phosphofructokinase activity colorimetric assay kit by Merck Group
Sourced in United States, Switzerland
The Phosphofructokinase Activity Colorimetric Assay Kit is a laboratory instrument designed to measure the activity of the enzyme phosphofructokinase. The kit utilizes a colorimetric method to quantify the enzymatic activity.
2
Pfk activity colorimetric assay kit by Merck Group
Sourced in United States
The PFK Activity Colorimetric Assay Kit is a laboratory tool used to measure the activity of the enzyme phosphofructokinase (PFK) in biological samples. The kit utilizes a colorimetric detection method to quantify PFK activity, providing a reliable and efficient way to assess this key enzyme in various research and diagnostic applications.
3
Phosphofructokinase activity colorimetric assay kit by Abcam
Sourced in United States
The Phosphofructokinase Activity Colorimetric Assay Kit is a laboratory tool used to measure the activity of the enzyme phosphofructokinase. Phosphofructokinase is a key regulatory enzyme in the glycolytic pathway, which is responsible for converting glucose into energy. The assay kit provides a colorimetric method to quantify phosphofructokinase activity in samples.
4
Ab136957 by Abcam
Sourced in United Kingdom
Ab136957 is a rabbit monoclonal antibody that recognizes an epitope within the C-terminus of the human beta-amyloid precursor protein (APP). The antibody is intended for research use only.
5
Phosphofructokinase pfk activity colorimetric assay kit by Merck Group
Sourced in Italy
The Phosphofructokinase (PFK) Activity Colorimetric Assay Kit is a laboratory test kit used to measure the activity of the enzyme phosphofructokinase. Phosphofructokinase is a key enzyme involved in glycolysis, the metabolic pathway that converts glucose into energy. The kit uses a colorimetric method to quantify the activity of this enzyme in biological samples.
6
Pyruvate dehydrogenase pdh by Cell Signaling Technology
Sourced in United States
Pyruvate dehydrogenase (PDH) is a multi-subunit enzyme complex that catalyzes the oxidative decarboxylation of pyruvate to acetyl-CoA, a key step in aerobic cellular metabolism. PDH plays a central role in the conversion of carbohydrates to energy in the form of ATP.
7
Lambda 25 uv vis spectrophotometer by PerkinElmer
Sourced in United States, Italy
The Lambda 25 UV-Vis spectrophotometer is a compact, high-performance instrument designed for accurate and reliable absorbance measurements in the ultraviolet and visible light spectrum. It features a dual-beam optical system and a broad wavelength range for a variety of analytical applications.
8
Rneasy kit by Qiagen
Sourced in Germany, United States, United Kingdom, Spain, Netherlands, Canada, France, Japan, China, Italy, Switzerland, Australia, Sweden, India, Singapore, Denmark, Belgium
The RNeasy kit is a laboratory equipment product that is designed for the extraction and purification of ribonucleic acid (RNA) from various biological samples. It utilizes a silica-membrane-based technology to efficiently capture and isolate RNA molecules.
9
Ab155898 by Abcam
Sourced in United Kingdom
Ab155898 is a laboratory equipment product. It is used for sample handling and preparation purposes in a research setting. The core function of this product is to facilitate the handling and processing of samples during laboratory experiments and analyses.
10
Glucose assay kit by Abcam
Sourced in United States, United Kingdom, Australia, Canada
The Glucose assay kit is a quantitative colorimetric/fluorometric assay designed to measure glucose concentrations in a variety of biological samples. The kit utilizes an enzymatic reaction to produce a colored or fluorescent product proportional to the amount of glucose present in the sample.

More about "6-Phosphofructokinase"

6-Phosphofructokinase, also known as PFK, is a crucial enzyme involved in the glycolytic pathway, responsible for the irreversible conversion of fructose-6-phosphate to fructose-1,6-bisphosphate.
This enzymatic reaction plays a critical role in regulating cellular energy metabolism, making it a key target for researchers studying cellular bioenergetics and metabolic processes.
Researchers can maximize their 6-Phosphofructokinase studies by utilizing PubCompare.ai, an AI-driven platform that enhances the reproducibility and accuracy of their research.
PubCompare.ai allows researchers to discover protocols from literature, preprints, and patents, and utilize intelligent comparisons to identify the best methodologies and products for their 6-Phosphofructokinase experiments.
In addition to 6-Phosphofructokinase, researchers can also explore related enzymes and assays, such as the Phosphofructokinase (PFK) Activity Colorimetric Assay Kit, which provides a convenient and sensitive method for measuring PFK activity in biological samples.
The Pyruvate dehydrogenase (PDH) enzyme, which is also involved in glucose metabolism, can be studied in conjunction with 6-Phosphofructokinase to gain a more comprehensive understanding of cellular energy production.
To enhance their research, scientists can utilize tools like the Lambda 25 UV-Vis spectrophotometer for accurate absorbance measurements, the RNeasy kit for RNA extraction, and the Glucose assay kit for quantifying glucose levels.
By combining these resources with the insights and tools provided by PubCompare.ai, researchers can boost their research efficiency, reproduce their findings with confidence, and advance the understanding of 6-Phosphofructokinase and its role in cellular metabolism.
Whether you are studying the kinetics, regulation, or distribution of 6-Phosphofructokinase, PubCompare.ai can help you maximize your research efforts and stay at the forefront of this important field of study.