ABCB1 protein, human

Venous blood samples will be collected for serum, plasma, DNA, and RNA extraction. Identifying biomarkers relevant to the course of depression is an area of research that is evolving rapidly. Thus, based on an ongoing critical literature review, the search for and analysis of specific biomarkers may change during the study period. Currently, the blood biomarkers include inflammation parameters (e.g., high sensitivity CRP) [61 (link), 62 (link)] and neurotrophic factors (e.g., BDNF and S100B) [63 , 64 (link)].
DNA from blood samples will be used for microarray-based genotyping of MDD candidate genes, genes of relevance for MDD (e.g., rs41271330, 5-HTTLPR, COMT, and BDNFval66met), drug metabolism (e.g., CYP2D6, CYP2C19, UGT1A1, ABCB1, ABCC1) and to compute polygenic risk scores in all participants after genome-wide genotyping in the future. DNA will also be used for epigenetic analysis, and circular extrachromosomal DNA, a form of decomposed free DNA [65 (link)], will be extracted and characterised. RNA will be extracted for gene transcription profiles using microarray or TAG-based methods (mRNA and microRNA).
DNA from blood samples will be used for microarray-based genotyping of MDD candidate genes, genes of relevance for MDD (e.g., rs41271330, 5-HTTLPR, COMT, and BDNFval66met), drug metabolism (e.g., CYP2D6, CYP2C19, UGT1A1, ABCB1, ABCC1) and to compute polygenic risk scores in all participants after genome-wide genotyping in the future. DNA will also be used for epigenetic analysis, and circular extrachromosomal DNA, a form of decomposed free DNA [65 (link)], will be extracted and characterised. RNA will be extracted for gene transcription profiles using microarray or TAG-based methods (mRNA and microRNA).
Gene analyses will be based on a priori models of genetic variations known to modulate pharmacotherapy and psychotherapy responses. The results will be used to calculate a polygenic risk score for diagnosis and treatment response and meta-analyses with established polygenic risk scores for MDD and those currently developed for anxiety and anxiety disorders, including treatment response [66 (link)].

Up to 30 mg of fresh frozen tumor tissue or 1x10⁷ cells were lysed in 600 µl RLT Plus buffer w/2 mM DTT using the QIAshredder homogenizer (Qiagen, Hilden, Germany). The instrument was operated for 2x4 min at a frequency of 30Hz. Homogenized lysate was passed through a QIAshredder spin column at 20000g for 30 s to remove debris. Genomic DNA and total RNA were simultaneously extracted from the lysates using the QIAcube instrument and the AllPrep DNA/RNA/miRNA Universal kit (all Qiagen).
To estimate the content of human and mouse DNA in each sample, we use the assay described previously (22 (link)). It is based on real-time qPCR using species-specific TaqMan probes conjugated with different fluorescent tags (human: tgctgcttctcattgtctcg (FAM) and mouse: cctgctgcttatcgtggctg (VIC)) along with common human/mouse forward (tacctgcagctgtacgccac) and reverse (gaccacctcattctcctggc) primers. The primer/probes detect the prostaglandin E receptor 2 (PTGER2) gene region, which is highly homologous between the two species and known not to be duplicated/deleted in disease. The standard curve (Ct values as a function of known amount of human and mouse DNA) were generated employing serially diluted DNA isolated from the human melanoma cell line WM115 and the mouse colon carcinoma cell line CT26. Real-time PCR was carried out on an BioRad CFX connect Real time System (Bio-Rad, Hercules, CA, USA) using 50 ng of total genomic DNA in 25 µl reaction mix containing 200 nM of each primer/probe (Applied Biosystems, Waltham, MA, USA) and 1x PerfeCTa qPCR ToughMix (Quanta Biosciences, Gaithersburg, MD, USA). The qPCR conditions were as follows: 5 min 95°C initial denaturation, 40 cycles of 15 s denaturation at 95°C and 30 s annealing/extension at 60°C. Quantifications were performed taking into account that one haploid mouse genome is approximately 2.9 pg, whereas one human haploid genome is approximately 3.33 pg. “Percent human (or mouse) DNA” was estimated as follows: [number of human (or mouse) genome]*100/[sum human+mouse genome].
To detect ABCB1 gene mRNA level, extracted total RNA was converted into cDNA using the qScript cDNA Synthesis Kit (Quanta Biosciences). PCR was carried out as specified above using 50 ng cDNA, ABCB1 forward (5’gaaatttagaagatctgatgtcaaaca’3) and reverse (5’actgtaataataggcatacctggtca’3) primers (Integrated DNA Technologies, Leuven, Belgium) and 10 µM probe #65 from Universal Probe Library (Roche Applied Science, Penzberg, Germany). The reference gene TBP was detected using the commercially available Applied BioSystems TaqMan Assay. Relative gene expression was calculated using the ΔΔ Ct method.

P-glycoprotein (P-gp/ABCB1) activity was determined by measuring the cellular accumulation of the efflux pump ligand rhodamine 123 (R123). BECs were seeded in 24-well plates and incubated in 10 µM R123 in Ringer-HEPES for 1 h at 37 °C after cytokine treatments. Cyclosporine A (1.6 µM), which blocks P-gp and breast cancer-resistant protein/ABCG2 was used as a reference inhibitor molecule. Following cytokine treatments and incubation with R123, BEC monolayers were washed 3 times with ice-cold PBS, then solubilized in 0.1 M NaOH. Fluorescence intensity indicating intracellular R123 concentration was measured in a 96-well plate (Fluostar Optima; excitation: 485 nm, emission: 520 nm).