Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > ACACA protein, human

ACACA protein, human

ACACA (acetyl-CoA carboxylase alpha) is a crucial enzyme involved in fatty acid biosynthesis.
It catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, a rate-limiting step in the synthesis of long-chain fatty acids.
ACACA plays a central role in energy metabolism and has been implicated in various metabolic disorders, including obesity, diabetes, and cancer.
Researchers studying ACACA can leverage PubCompare.ai, a leading AI-driven platform, to optimize their research by locating the best protocols from literature, pre-prints, and patents using AI-driven comparisons, enhancing reproducibility and acuaracy.

Most cited protocols related to «ACACA protein, human»

1
Accelerometer-based Non-wear Time Estimation
Accelerometer non-wear time was estimated on the basis of the standard deviation and the value range of each accelerometer axis, calculated for consecutive blocks of 30 minutes. A block was classified as non-wear time if the standard deviation was less than 3.0 mg (1 mg = 0.00981 m·s−2) for at least two out of the three axes or if the value range, for at least two out of three axes, was less than 50 mg. Thresholds were based on lab experiments in which thirty GENEA accelerometers were left motionless on a flat, stable surface for 30 minutes, showing that the standard deviation of an acceleration signal (which has some inherent noise) is 2.6 mg during non-motion. Therefore, the 3.0 mg threshold will allow a maximal increase of 0.4 mg in the standard deviation, which when expressed in angular orientation of the acceleration sensor corresponds to a standard deviation of 1.6 degrees [ ]. Phan et al. showed that the acceleration of the chest in a resting person resulting from the breathing movement alone has an amplitude of 10 mg, while the vibrations resulting from the heart beat have a peak-to-peak amplitude of 80 mg [16] (link). Therefore, even the tiniest wrist movements are likely to be picked up by the method as described above.
Participants for whom more than 50% of the wrist data was classified as non-wear were excluded from further analyses (two pregnant women from the Swedish study). For the remainder of the participants, non-wear time segments were labelled as missing.
Next, a simple summary measure was derived from the raw acceleration signals, involving a filtering stage to extract the accelerations related to body movement using a fourth-order Butterworth band pass filter (ω0: 0.2–15 Hz), followed by the calculation of the vector magnitude ( ). The resulting signal was then averaged over intervals of one second. Three basic approaches for the imputation of movement during non-wear segments were evaluated: i) no imputation, with non-wear time regarded as no movement (Acc0); ii) imputation of non-wear time by the average movement during wear time for that participant (Acc1); and iii) imputation of non-wear time using the available wear time data at similar times on other days for each participant (Acc2). Here, Acc2 is assumed to be best capable of dealing with large periods of missing data as it takes into account the 24-hour cycle of human behaviour. Finally, the average was calculated for each participant. All signal processing was done in R (http://cran.r-project.org) using package Signal.
van Hees V.T., Renström F., Wright A., Gradmark A., Catt M., Chen K.Y., Löf M., Bluck L., Pomeroy J., Wareham N.J., Ekelund U., Brage S, & Franks P.W. (2011). Estimation of Daily Energy Expenditure in Pregnant and Non-Pregnant Women Using a Wrist-Worn Tri-Axial Accelerometer. PLoS ONE, 6(7), e22922.
Full text: Click here
Publication 2011
ACACA protein, human Acceleration Chest Cloning Vectors Epistropheus Homo sapiens Movement Pregnant Women Pulse Rate Strains Vibration Wrist
2
Investigating AMPK Subunit Deficiency in Mice
Both Acc1–S79A KI and Acc2–S212A KI mice were generated by OzGene Pty Ltd, (Perth Australia). The targeting strategy is summarized in Supplementary Fig S1. The generation of Ampk–β1−/− and Ampk–β2−/− mice has previously been described39 (link),40 (link). All mice used in the study were bred on a C57Bl/6 background and were bred from heterozygous intercrosses. Male mice were used for all studies and housed in SPF micro–isolators and maintained on a 12 h light/dark cycle with lights on at 0700. Mice were maintained on either a chow (17% kcal from fat; Diet 8640, Harlan Teklad, Madison, WI) or HFD (45% kcal from fat, D12451, Research Diets; New Brunswick, NJ) starting at 6 weeks of age for 12 weeks. For HFD–metformin experiments, mice received 6 weeks of daily intraperitoneal injections of metformin (50 mg/kg) starting after 6 weeks of the HFD. Fasting and fed blood samples were collected for serum analyses via submandibular bleeding. The McMaster University (Hamilton, Canada) Animal Ethics Research Board and St. Vincent’s Hospital (Melbourne, Australia) Animal Ethics Committee approved all experimental protocols.
Fullerton M.D., Galic S., Marcinko K., Sikkema S., Pulinilkunnil T., Chen Z., O’Neill H.M., Ford R.J., Palanivel R., O’Brien M., Hardie D.G., Macaulay S.L., Schertzer J.D., Dyck J.R., van Denderen B.J., Kemp B.E, & Steinberg G.R. (2013). Single phosphorylation sites in Acc1 and Acc2 regulate lipid homeostasis and the insulin–sensitizing effects of metformin. Nature medicine, 19(12), 1649-1654.
Publication 2013
ACACA protein, human Animal Ethics Committees Animals BLOOD Diet FAT 17 Heterozygote Injections, Intraperitoneal Light Males Metformin Mice, House Serum Therapy, Diet
3
Evaluating Metabolic and Inflammatory Markers in Murine Tissues
Mice were sacrificed, and tissues were quickly removed, snap-frozen in liquid nitrogen and stored at −80°C. Total RNAs from liver and white adipose tissue were extracted using RNA Stat60 (Teltest). Complementary DNA was synthesized using the High Capacity cDNA Kit (Applied Biosystems). Primers for Tlr4 (ID: Mm0445273_m1), Socs3 (ID: Mm00545913_s1), Cd11c (ID: Mm00498698_m1), Foxo1 (ID: Mm00490672_m1), Pepck (ID: Mm00440636_m1), Acox1 (ID: Mm01246831_m1), CD68 (ID: Mm03047340_m1) and Tlr2 (ID: Mm00442346_m1) were purchased from Applied Biosystems. Primers sequences for other genes shown in the paper are listed as follows: Tnfα, forward, ctgaggtcaatctgcccaagtac, and reverse, cttcacagagcaatgactccaaag; Mcp1, forward, tttttgtcaccaagctcaagaga, and reverse, atttggttccgatccaggtt; IL-6, forward, tcgtggaaatgagaaaagagttg, and reverse, agtgcatcatcgttgttcataca; IL-1β, forward, tgacggaccccaaaagatg, and reverse, tggacagcccaggtcaaag; Cd11b, forward, atcaacacaaccagagtggattc, and reverse, gttcctcaagatgactgcagaag; Acc1, forward, tggacagactgatcgcagagaaag, and reverse, tggagagccccacacaca; Fas, forward, gctgcggaaacttcaggaaat, and reverse, agagacgtgtcactcctggactt; Scd1, forward, ccggagaccccttagatcga, and reverse, tagcctgtaaaagatttctgcaaacc; Arg1, forward, agaccacagtctggcagttg, and reverse, ccacccaaatgacacatagg; Mrc1, forward, tgattacgagcagtggaagc, and reverse, gttcaccgtaagcccaattt; Clec10a, forward, ctctggagagcacagtggag, and reverse, acttccgagccgttgttct. mRNA contents were normalized to 18s mRNA levels. All assays were performed using an ABI Prism 7900HT sequence detection system (Applied Biosystems). The relative amounts of all mRNAs were calculated using the ΔΔCT assay.
Jia L., Vianna C., Fukuda M., Berglund E., Liu C., Tao C., Sun K., Liu T., Harper M., Lee C.E., Lee S., Scherer P.E, & Elmquist J.K. (2014). Hepatocyte Toll-like Receptor 4 Regulates Obesity-Induced Inflammation and Insulin Resistance. Nature communications, 5, 3878.
Publication 2014
ACACA protein, human arginase-1, human Biological Assay CCL2 protein, human DNA, Complementary Freezing Genes Interleukin-1 beta ITGAM protein, human Liver Mus Nitrogen Oligonucleotide Primers Phosphoenolpyruvate Carboxylase prisma RNA, Messenger Tissues TLR2 protein, human Tumor Necrosis Factor-alpha White Adipose Tissue
4
Adipose Tissue Gene Expression Analysis
We analyzed the relative basal mRNA expression levels of lipogenic and lipolytic genes in epiploic visceral adipose tissue (VAT) and abdominal subcutaneous adipose tissue (SAT). Five grams of VAT and SAT were obtained during bariatric surgery in the morbidly obese patients [1] (link), [32] (link). The biopsy samples were washed in physiological saline and immediately frozen in liquid nitrogen. Biopsy samples were maintained at −80°C until analysis. Frozen adipose tissue was homogenized with an Ultra-Turrax 8 (Ika, Staufen, Germany). Total RNA was extracted using RNeasy lipid tissue midi kit (QIAGEN Science, Hilden, Germany), and total RNA was treated with 55URNasefree deoxyribonuclease (QIAGEN) following the manufacturer's instructions. The purity of the RNA was determined by the absorbance260/absorbance280 ratio on the Nanodrop. The integrity of total purified RNA was checked by denaturing agarose gel electrophoresis and ethidium bromide staining. Total RNA was reverse transcribed to cDNA by using a high-capacity cDNA reverse transcription kit with RNase inhibitor (Applied Biosystems, Foster City, CA). The cDNA was used for quantitative real-time PCR with duplicates. We analyzed the relative basal mRNA expression levels of peroxisome proliferator-activated receptor-ã (PPARã) (Hs00234592_m1, RefSeq. NM_005037.5, NM_015869.4, NM_138711.3 and NM_138712.3), acyl Coenzyme A:cholesterol acyltransferase (DGAT1) (Hs00201385_m1, RefSeq. NM_012079.4), aquaporin 7 (AQP7) (Hs00357359_m1, RefSeq. NM_001170.1), acetyl-CoA carboxylase 1 (ACC1) (Hs00167385_m1, RefSeq. NM_198834.1, NM_198836.1, NM_198837.1, NM_198838.1 and NM_198839.1), acetyl-CoA synthetase short-chain family member 2 (ACSS2) (Hs00218766_m1, RefSeq. NM_001076552.2, NM_018677.3 and NM_028046.1), ATP citrate lyase (ACL) (Hs00982738_m1, RefSeq. NM_001096.2 and NM_198830.1), phosphoenolpyruvate carboxykinase (PEPCK) (Hs00159918_m1, RefSeq. NM_002591.3), glycerol kinase (GyK) (Hs02340011_g1, RefSeq. NM_000167.4 and NM_203391.2), adipose triglyceride lipase (ATGL) (Hs00386101_m1, RefSeq. NM_020376.3), hormone-sensitive lipase (HSL) (Hs00193510_m1, RefSeq. NM_005357.2), and perilipin (Hs00160173_m1, RefSeq. NM_001145311.1 and NM_002666.4). We choose these genes because, previously, we have study the association between these lipogenic and lipolitic genes with basal anthropometric and biochemical variables [1] (link). The cycle threshold (Ct) value for each sample was normalized with the expression of PPIA (Hs99999904_m1). There is no variation in the expression of this housekeeping gene in the condition tested. Real-time quantitative PCR was performed on a 7900HT Fast real-time PCR system using commercial Taqman assays (Applied Biosystems) [33] (link). SDS software 2.3 and RQ Manager 1.2 (Applied Biosystems) were used to analyze the results with the comparative Ct method (2−ΔΔCt). All data were expressed as an n-fold difference relative to the calibrator (a mixture of the SAT and VAT tissues was used as calibrator sample).
Garrido-Sánchez L., Vendrell J., Fernández-García D., Ceperuelo-Mallafré V., Chacón M.R., Ocaña-Wilhelmi L., Alcaide J., Tinahones F.J, & García-Fuentes E. (2012). De Novo Lipogenesis in Adipose Tissue Is Associated with Course of Morbid Obesity after Bariatric Surgery. PLoS ONE, 7(2), e31280.
Full text: Click here
Publication 2012
ACACA protein, human Acetate-CoA Ligase ACSS2 protein, human Acyl Coenzyme A ATP-Dependent Phosphoenolpyruvate Carboxykinase ATP Citrate (pro-S)-Lyase Bariatric Surgery Biological Assay Biopsy Deoxyribonucleases DNA, Complementary Electrophoresis, Agar Gel Endoribonucleases Ethidium Bromide Freezing Genes Genetic Diversity Glycerol Kinase Lipase Lipids Lipogenesis Lipolysis Nitrogen Obesity Patients Perilipin-1 Peroxisome Proliferator-Activated Receptors physiology Real-Time Polymerase Chain Reaction Reverse Transcription RNA, Messenger Saline Solution Sterol Esterase Sterol O-Acyltransferase Subcutaneous Fat Subcutaneous Fat, Abdominal Tissue, Adipose Tissues Visceral Fat Water Channel
5
Analyzing Hepatic Lipid Metabolism Genes
The total RNA was isolated from frozen tissue samples and cultured hepatocytes. RNA isolation and real-time RT-PCR were conducted as previously described [35] . The mRNA levels were analyzed for SREBP1c, carbohydrate responsive element-binding protein (ChREBP), ACC1, FAS, CPT1a, VLDLr, glucokinase, glucose-6-phosphatase, TNFα, and/or IL-6.
Guo X., Li H., Xu H., Halim V., Zhang W., Wang H., Ong K.T., Woo S.L., Walzem R.L., Mashek D.G., Dong H., Lu F., Wei L., Huo Y, & Wu C. (2012). Palmitoleate Induces Hepatic Steatosis but Suppresses Liver Inflammatory Response in Mice. PLoS ONE, 7(6), e39286.
Full text: Click here
Publication 2012
ACACA protein, human carbohydrate-binding protein carnitine palmitoyltransferase 1A, human Freezing Glucokinase Glucose 6-Phosphatase Hepatocyte isolation Real-Time Polymerase Chain Reaction RNA, Messenger Sterol Regulatory Element Binding Protein 1c Tissues Tumor Necrosis Factor-alpha VLDLR protein, human

Most recents protocols related to «ACACA protein, human»

1
Constructing Resveratrol-Producing Yeast Strains
For the construction of resveratrol-producing strains, Pc4CL (P14912.1) from Petroselinum crispum, VvSTS (P28343.2) from Vitis vinifera, RtPAL/TAL (P11544) from Rhodotorula toruloides (Synonyms R. gracilis), AtCPR1 (NP_194183.1) and AtC4H (NP_180607.1) from Arabidopsis thaliana were codon-optimized for expression in S. cerevisiae and synthesized by Sangon Biotech (Shanghai, China). SeACSL641P (MP052228.1) and selective marker cassettes (HIS3, LEU2 and URA3) were also synthesized by Sangon Biotech (Shanghai, China). Integration homologous arms (about 500 bp), ScACC1, ScARO4, ScARO7, and ScARO2 were amplified from the genome of BY4742. LYS2 including its homologous arms was amplified from the genome of W303-1A. EcAROL was amplified from the genome of E. coli. Mutants of ACC1, ARO4 and ARO7 were created by overlap PCR according to the previous report. Expression cassettes with promoters, terminators and genes were assembled to plasmid G418 using Minerva Super Fusion Cloning Kit (Yuheng Biotech, Suzhou, China). The plasmids pCas with specific gRNA sequences used for CRISPR/Cas9 editing were obtained according to the standard Quick-Change Site-Directed Mutagenesis protocol. The gRNA sequences of sites cit2, lpp1, pha2, and dpp1 were designed using online tool E-CRISP [37 (link)], and the gRNA sequences of other sites were reported in the previous study [38 (link)]. Recombinant plasmids were confirmed by DNA sequencing. The detailed information of plasmids (Additional file 1: Table S2) and the primers (Additional file 1: Table S3) used in our study were listed in supplementary information.
Meng L., Diao M., Wang Q., Peng L., Li J, & Xie N. (2023). Efficient biosynthesis of resveratrol via combining phenylalanine and tyrosine pathways in Saccharomyces cerevisiae. Microbial Cell Factories, 22, 46.
Full text: Click here
Publication 2023
2-(5-(3-fluorophenyl)-1H-pyrazol-3-yl)-5-methylphenol ACACA protein, human antibiotic G 418 Arabidopsis thalianas Arm, Upper Clustered Regularly Interspaced Short Palindromic Repeats Codon Escherichia coli Genes Genome Gracilis Muscle Mutagenesis, Site-Directed Oligonucleotide Primers Petroselinum crispum Plasmids Resveratrol Rhodotorula toruloides Saccharomyces cerevisiae Strains Vitis
2
Quantitative RT-PCR Analysis of Gene Expression
RNA was extracted with the RNeasy RNA isolation kit (Qiagen, cat# 74106). Reverse transcriptase reactions were performed using a SuperScript First‐strand Synthesis System (Invitrogen, cat# 12574026). Real‐time PCR reactions were performed on an ABI Prism 7500 system with the following primers: human CXCL14, 5′‐CGCTACAGCGACGTGAAGAA‐3′ and 5′‐GTTCCAGGCGTTGTACCAC‐3′; human BRG1, 5′‐TCATGTTGGCGAGCTATTTCC‐3′ and 5′‐GGTTCCGAAGTCTCAACGATG‐3′; mouse Cxcl14, 5′‐GAAGATGGTTATCGTCACCACC‐3′ and 5′‐CGTTCCAGGCATTGTACCACT‐3′; mouse Brg1, 5′‐CAAAGACAAGCATATCCTAGCCA‐3′ and 5′‐CACGTAGTGTGTGTTAAGGACC‐3′; mouse Il1b, 5′‐GCAACTGTTCCTGAACTCAACT‐3′ and 5′‐ATCTTTTGGGGTCCGTCAACT‐3′; mouse Il6, 5′‐TGGGGCTCTTCAAAAGCTCC‐3′ and 5′‐AGGAACTATCACCGGATCTTCAA‐3′; mouse Tnfa, 5′‐CTGGATGTCAATCAACAATGGGA‐3′ and 5′‐ACTAGGGTGTGAGTGTTTTCTGT‐3′; mouse Nos2, 5′‐GTTCTCAGCCCAACAATACAAGA‐3′ and 5′‐GTGGACGGGTCGATGTCAC‐3′; mouse Mcp1, 5′‐AAAACACGGGACGAGAAACCC‐3′ and 5′‐ACGGGAACCTTTATTAACCCCT‐3′; mouse Fasn, 5′‐GGAGGTGGTGATAGCCGGTAT‐3′ and 5′‐TGGGTAATCCATAGAGCCCAG‐3′; mouse Scd1, 5′‐ACTGTGGAGACGTGTTCTGGA‐3′ and 5′‐ACGGGTGTCTGGTAGACCTC‐3′; mouse Acc1, 5′‐GCGGCTACAGGGACTATACTG‐3′ and 5′‐CGGAAGTAAGAGCTACTAGCGG‐3′; mouse Srebp1, 5′‐TGACCCGGCTATTCCGTGA‐3′ and 5′‐CTGGGCTGAGCAATACAGTTC‐3′. Ct values of target genes were normalized to the Ct values of house keeping control gene (18 s, 5′‐CGCGGTTCTATTTTGTTGGT‐3′ and 5′‐TCGTCTTCGAAACTCCGACT‐3′ for both human and mouse genes) using the ΔΔCt method and expressed as relative mRNA expression levels compared to the control group which is arbitrarily set as 1.
Li N., Liu H., Xue Y., Xu Z., Miao X., Guo Y., Li Z., Fan Z, & Xu Y. (2023). Targetable Brg1‐CXCL14 axis contributes to alcoholic liver injury by driving neutrophil trafficking. EMBO Molecular Medicine, 15(3), e16592.
Full text: Click here
Publication 2023
ACACA protein, human Anabolism CCL2 protein, human CXCL14 protein, human FASN protein, human Genes Genes, Housekeeping Homo sapiens Interleukin-1 isolation Mus Nitric Oxide Synthase Type II Oligonucleotide Primers prisma RNA, Messenger RNA-Directed DNA Polymerase SMARCA4 protein, human SREBF1 protein, human TNF protein, human
3
PCR and Sanger Sequencing of PKD Genes
Primers for PKD1 and PKD2 target genes were designed using the Premier 6.0 software. The primer sequences were as follows: PKD1-F2: GTGGTGGAGATGGACGTAGAGT; PKD1-R2: CGGAAATAGGGCAGGATTAGCG; PKD1-F3: ACACA GTGGAGCATGTGTACC; PKD1-R3: GACCTTGATGTCCGTGAC CA; PKD1-F4: CGAGTCACCATCACGGATGGT; PKD1-R4: ACCCAGGCAGGCACTATGAGA; PKD2-F3: AATGGTGGTGGAGATGG ACGTA; PKD2-R3: CCCCAGATGTACTCTTTCACTCTAA; GANAB-F1: GAATGTATGAAGGATGACCCAA; GANAB-R: CGCAGGTGAATACTCCAATC. The reaction conditions and PCR system were as follows: 1.5 μl of DNA template (200 ng/μl), 1 μl of each upstream and downstream primer (10 μmol/l), 2 μl of dNTP mix, 1 μl of PrimeSTAR GXL DNA polymerase (TAKARA), 10 μl of 5× PrimeSTAR GXL buffer Mg2+, 4 μl of dNTP mixture, and up to 50 μl of nucleic acid-free water; amplification of the PCR reaction: 3 min predenaturation at 95°C, 30 s denaturation at 94°C, 15 s annealing temperature, 30 s extension at 72°C, 35 cycles, 5 min extension at 72°C, and storage at 4°C. After electrophoresis on a 1% agarose gel at 110 V for 30 min and staining, PCR products were detected with a gel imager. Sequencing reactions were prepared using a BigDye® Terminator kit (Applied Biosystems), and reaction products were sequenced using the ABI 3500Dx Genetic Analyzer (Applied Biosystems, Forster City, USA). Sanger sequencing was performed by Tsingke Biotechnology Co., Ltd.
Wu R., Bai B., Li F., Bai R., Zhuo Y., Zhu Z., Jia R., Li S., Chen Y, & Lan X. (2023). Phenotypes and genetic etiology of spontaneous polycystic kidney and liver disease in cynomolgus monkey. Frontiers in Veterinary Science, 10, 1106016.
Full text: Click here
Publication 2023
ACACA protein, human Adjustment Disorders Buffers DNA-Directed DNA Polymerase Electrophoresis, Agar Gel Genes Nucleic Acids Oligonucleotide Primers Potter Type III Polycystic Kidney Disease Reproduction
4
MLST Genotyping of Candida albicans
MLST of C. albicans strains was performed by amplifying and sequencing seven C. albicans housekeeping genes (AAT1a, ACC1, ADP1, MPIb, SYA1, VPS13, and ZWF1b) as described previously (25 (link)). The distinct alleles of seven gene loci were identified and assigned to genotypes by reference to the MLST C. albicans database (https://pubmlst.org/organisms/candida-albicans). A diploid sequence type (DST) of each strain was also characterized by defining unique combinations of genotypes. To evaluate the genetic relatedness between the investigated strains, DNA sequences were concatenated, and a dendrogram was constructed based on the unweighted pair group method by using average linkages for cluster analysis and clade definition using MEGA software (http://www.megasoftware.net/), as described in reference 25 (link).
Xiang Z., Wakade R.S., Ribeiro A.A., Hu W., Bittinger K., Simon-Soro A., Kim D., Li J., Krysan D.J., Liu Y, & Koo H. (2023). Human Tooth as a Fungal Niche: Candida albicans Traits in Dental Plaque Isolates. mBio, 14(1), e02769-22.
Full text: Click here
Publication 2023
ACACA protein, human Alleles Base Pairing Candida albicans Diploidy DNA Sequence Genes, Housekeeping Genetic Linkage Analysis Genetic Loci Genotype Reproduction
5
Comprehensive Gene Expression Analysis of Metabolic Pathways
For cDNA synthesis, 1000 ng of intact RNA was reversed to cDNA with a reverse transcription kit (YEASEN, Shanghai, China) with the concentration detected. The synthesized cDNA was diluted to 200 ng/μL as a template for RT-qPCR. To detect carbohydrate metabolism, the expression of genes related to glycogen synthesis (ugp2b, gys2), glycogen degradation (pygl), gluconeogenesis (pck1, pcxb), glycolysis (gck), TCA cycle pathway (idh), and pentose phosphate pathway (g6pd) were evaluated. The expression of genes related to lipid synthesis (fasn, acaca, aclyb) and decomposition (acadl, acaa1, lpl) were determined to illustrate the influence on lipid metabolism, and the expression of genes related to the urea cycle (gs, cps3, otc, ass, asl, and arg1) was also detected. The qPCR was performed in Jena qTOWER3G system using the real-time quantitative PCR detection kit EvaGreen 2 × qPCR Master mix (YEASEN, Shanghai, China): pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 10 s; annealing and extension at 60 °C for 30 s; and PCR reaction step running 40 cycles. After RT-qPCR, melting curves were analyzed to ensure the specificity of the reaction. Using 18s as the internal reference gene, the relative quantitative data analysis was performed by the 2−ΔΔCt method. RT-qPCR data were analyzed using GraphPad Prism 6. The primers used in the present study are shown in Table 1.
Zou J., Hu P., Wang M., Chen Z., Wang H., Guo X., Gao J, & Wang Q. (2023). Liver Injury and Metabolic Dysregulation in Largemouth Bass (Micropterus salmoides) after Ammonia Exposure. Metabolites, 13(2), 274.
Full text: Click here
Publication 2023
ACACA protein, human Anabolism arginase-1, human Carbohydrate Metabolism Citric Acid Cycle DNA, Complementary FASN protein, human Gene Expression Genes Gluconeogenesis Glucosephosphate Dehydrogenase Glycogen Glycogenolysis Glycolysis Lipid Metabolism Lipogenesis Oligonucleotide Primers Pentose Phosphate Pathway prisma Real-Time Polymerase Chain Reaction Reverse Transcription Urea

Top products related to «ACACA protein, human»

1
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
2
Rneasy mini kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway
The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.
3
Trizol by Thermo Fisher Scientific
Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines
TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.
4
Primescript rt reagent kit by Takara Bio
Sourced in Japan, China, United States, France, Germany, Switzerland, Canada, Sweden, Italy, Puerto Rico, Singapore
The PrimeScript RT reagent kit is a reverse transcription kit designed for the synthesis of first-strand cDNA from RNA templates. The kit includes RNase-free reagents and enzymes necessary for the reverse transcription process.
5
High capacity cdna reverse transcription kit by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Japan, Lithuania, France, Italy, China, Spain, Canada, Switzerland, Poland, Australia, Belgium, Denmark, Sweden, Hungary, Austria, Ireland, Netherlands, Brazil, Macao, Israel, Singapore, Egypt, Morocco, Palestine, State of, Slovakia
The High-Capacity cDNA Reverse Transcription Kit is a laboratory tool used to convert RNA into complementary DNA (cDNA) molecules. It provides a reliable and efficient method for performing reverse transcription, a fundamental step in various molecular biology applications.
6
β actin by Merck Group
Sourced in United States, United Kingdom, Germany, China, Canada, Japan, Macao, Italy, Sao Tome and Principe, Israel, Spain, Denmark, France, Finland, Australia, Morocco, Ireland, Czechia, Sweden, Uruguay, Switzerland, Netherlands, Senegal
β-actin is a protein that is found in all eukaryotic cells and is involved in the structure and function of the cytoskeleton. It is a key component of the actin filaments that make up the cytoskeleton and plays a critical role in cell motility, cell division, and other cellular processes.
7
β actin by Cell Signaling Technology
Sourced in United States, United Kingdom, China, Germany, Japan, Canada, Morocco, Sweden, Netherlands, Switzerland, Italy, Belgium, Australia, France, India, Ireland
β-actin is a cytoskeletal protein that is ubiquitously expressed in eukaryotic cells. It is an important component of the microfilament system and is involved in various cellular processes such as cell motility, structure, and integrity.
8
Pvdf membrane by Merck Group
Sourced in United States, Germany, China, United Kingdom, Morocco, Ireland, France, Italy, Japan, Canada, Spain, Switzerland, New Zealand, India, Hong Kong, Sao Tome and Principe, Sweden, Netherlands, Australia, Belgium, Austria
PVDF membranes are a type of laboratory equipment used for a variety of applications. They are made from polyvinylidene fluoride (PVDF), a durable and chemically resistant material. PVDF membranes are known for their high mechanical strength, thermal stability, and resistance to a wide range of chemicals. They are commonly used in various filtration, separation, and analysis processes in scientific and research settings.
9
Anti acc1 by Cell Signaling Technology
Sourced in United States
Anti-ACC1 is a primary antibody that recognizes acetyl-CoA carboxylase 1 (ACC1), a key enzyme involved in fatty acid synthesis. It is used for the detection and analysis of ACC1 in various sample types, such as cell lysates, using techniques like Western blotting.
10
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

More about "ACACA protein, human"

ACC1, acetyl-CoA carboxylase, fatty acid synthesis, malonyl-CoA, energy metabolism, obesity, diabetes, cancer, TRIzol, RNeasy, RT-PCR, Western blot, FBS