> Chemicals & Drugs > Amino Acid > Acetylcholinesterase

Acetylcholinesterase

Acetylcholinesterase is an enzyme that plays a crucial role in the regulation of cholinergic neurotransmission.
It catalyzes the hydrolysis of the neurotransmitter acetylcholine, terminating its action at cholinergic synapses.
This enzyme is found in various tissues, including the nervous system, muscles, and red blood cells.
Acetylcholinesterase is an important target for pharmacological interventions, as its inhibition can be used to treat conditions such as myasthenia gravis, glaucoma, and Alzheimer's disease.
Reserach into Acetylcholinserase is vital for understanding its function and developing effective therapies.
PubCompare.ai can help optimize your Acetylcholinesterase research by allowing you to easily locate and identify the best protocols from literature, pre-prits, and patents, and compare multiple methods side-by-side to ensure reproducibility and find the most effective products for your experiments.

Most cited protocols related to «Acetylcholinesterase»

Histological Mapping of Mouse Brain

Cited 33 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2020

Acetylcholinesterase Antibodies Brain Brain Mapping Immunohistochemistry Microscopy, Fluorescence

Preparation and Staining of Brain Sections

Cited 33 times

Animals were anesthetized with a lethal dose of ketamine (40 mg/100 g body weight, i.p.) and xylazine (2 mg/100 g body weight, i.p.). When a deep anesthetic state marked by a complete loss of the flexor reflex at all limbs was reached, animals were perfused transcardially with 20 mL of phosphate buffered saline (0.1 M PBS, pH 7.4) supplemented with 0.1 % heparin followed by 200 mL of 4 % PFA (in 0.05 M PBS, pH 7.4). The brains were postfixed in the skull with 4 % PFA (in 0.05 M PBS, pH 7.4) at 4 °C for at least 7 days before removal to best preserve the brain shape.
Brains were cryo-protected in 22.5 % sucrose in PBS (0.05 M, pH 7.4) overnight and cut in a cryostat (LEICA CM 3050S) into four series of 40 µm thick frontal sections. The sections were directly mounted on gelatine-coated slides and dried overnight. Alternating section series were stained on-slide either for cells (Nissl) or for myelin (Gallyas 1979 (link)). The brains additionally processed for chemo- and immunoarchitecture were stained for cytochrome oxidase, acetylcholine-esterase (AChE), NADPH-diaphorase, calcium-binding proteins (parvalbumin, calbindin and calretinin) and neurofilament protein (SMI-32) in various combinations. Sections were imaged with a virtual slide microscope (VS120 S1, Olympus BX61VST, Olympus-Deutschland, Hamburg, Germany) at 10× magnification using the proprietary software dotSlide^® (Olympus).

Radtke-Schuller S., Schuller G., Angenstein F., Grosser O.S., Goldschmidt J, & Budinger E. (2016). Brain atlas of the Mongolian gerbil (Meriones unguiculatus) in CT/MRI-aided stereotaxic coordinates. Brain Structure & Function, 221(Suppl 1), 1-272.

Full text: Click here

Publication 2016

Acetylcholinesterase Anesthetics Animals Body Weight Brain Calbindins Calcium-Binding Proteins Calretinin Cells Cranium Gelatins Heparin Ketamine Microscopy Myelin Sheath NADPH Dehydrogenase Neurofilament Proteins Oxidase, Cytochrome-c Parvalbumins Phosphates Saline Solution Sucrose Xylazine

Exosome Isolation from Murine Brains

Cited 33 times

Fresh or previously frozen murine hemi-brains were dissected and treated with 20 units/ml papain (Worthington) in Hibernate E solution (3 ml/hemi-brain; BrainBits, Springfield, IL) for 15 min at 37 °C. The brain tissue was gently homogenized in 2 volumes (6 ml/hemi-brain) of cold Hibernate E solution. The brain homogenate was sequentially filtered through a 40-μm mesh filter (BD Biosciences) and a 0.2-μm syringe filter (Thermo Scientific). Exosomes were isolated from the filtrate as described previously (15 ). Briefly, the filtrate was sequentially centrifuged at 300 × g for 10 min at 4 °C, 2000 × g for 10 min at 4 °C, and 10,000 × g for 30 min at 4 °C to discard cells, membranes, and debris. The supernatant was centrifuged at 100,000 × g for 70 min at 4 °C to pellet exosomes. The exosome pellet was resuspended in 60 ml of cold PBS (Invitrogen), and the exosome solution was centrifuged at 100,000 × g for 70 min at 4 °C. The washed exosome pellet was resuspended in 2 ml of 0.95 m sucrose solution and inserted inside a sucrose step gradient column (six 2-ml steps starting from 2.0 m sucrose up to 0.25 m sucrose in 0.35 m increments, with the 0.95 m sucrose step containing the exosomes). The sucrose step gradient was centrifuged at 200,000 × g for 16 h at 4 °C. One-ml fractions were collected from the top of the gradient, and fractions flanking the interphase separating two neighboring sucrose layers were pooled together for a total of seven fractions (a, top 1-ml fraction; b, 2-ml; c, 2-ml; d, 2-ml; e, 2-ml; f, 2-ml; and g, bottom 1-ml fraction). These fractions were diluted in cold PBS and centrifuged at 100,000 × g at 4 °C for 70 min. Sucrose gradient fraction pellets were resuspended in 20 μl of cold PBS. Two μl were used to measure acetylcholine esterase (AChE) activity, and 2-μl were used for EM. Exosome lysate was prepared by mixing 16 μl of the leftover solution with an equal volume of 2× radioimmune precipitation assay lysis buffer supplemented with a mixture of protease inhibitors. We used 2 μl of the lysate to quantify exosomal protein content (BCA protein assay kit, Pierce) and 10 μl of the lysate (31% of the exosome lysate total volume) for protein analysis by Western blotting.

Perez-Gonzalez R., Gauthier S.A., Kumar A, & Levy E. (2012). The Exosome Secretory Pathway Transports Amyloid Precursor Protein Carboxyl-terminal Fragments from the Cell into the Brain Extracellular Space. The Journal of Biological Chemistry, 287(51), 43108-43115.

Publication 2012

Acetylcholinesterase Biological Assay Brain Buffers Cells Cold Temperature Exosomes Freezing Interphase Mus Papain Pellets, Drug Protease Inhibitors Proteins Sucrose Syringes Tissue, Membrane Tissues Western Blot

Multimodal Tracer Injections for Cortical Circuits

Cited 17 times

Injections were made using an image-guided stereotaxic system (Brainsight Frameless, Rogue Research, Montreal, Canada). The target area was identified on the monkey’s magnetic resonance imaging (MRI) using sulcal landmarks in a 3D reconstruction of the monkey brain and a coronal, parasagittal, or horizontal plane (Frey et al., 2004 (link)). The Brainsight system monitors injection position online and to within a few millimeters range. Injections of the fluorescent Fast blue and Diamidino yellow tracers (0.2–0.3 μl) spanning the full depth of the cortex were made into V1, V2, V4, TEO, TEpd, MT, 7a, STPc, DP, 8m, and 8L. Injection sites can be viewed in Markov et al. (2013 ).
The spatial extent of labeling and the percentages of double-labeled neurons in supragranular vs. infragranular layers (in V2, V3, MT, TEO, and TE) were computed after paired parallel longitudinal injection of 3–5 μl of the two tracers in V1 in one brain and in V4 in another brain. These paired injections, 2–3 mm apart, were used to quantify the divergence of terminal arbors and the degree of scatter in projection topology, and were made at a shallow angle to the cortical surface spanning the entire thickness of the cortical sheet. The tracer was injected while the Hamilton microsyringe was withdrawn from the cortex so as to form parallel longitudinal injection sites restricted to the cortical gray matter.
In order to quantify the frequency of single neurons sending projections to both V1 and V4, simultaneous injections were made in these two areas. In one animal, massive injections were made by multiple injection of Diamidino yellow in the opercular part of V1 and, in the same hemisphere, Fast blue was massively injected in V4 between the lunate sulcus and the superior temporal sulcus. Both sets of injections involved corresponding regions representing the lower part of the central visual field (Gattass et al., 1987 (link), 1988 (link)).
Following a 10–13 day survival period, to allow retrograde transport of the tracers, the animals were deeply anesthetized and perfused through the heart with 2.7% saline, followed by 4–8% paraformaldehyde, 0.05% glutaraldehyde in 0.1 M phosphate buffer (PB) (pH 7.4), and 10–30% sucrose in PB. The brains were then blocked in the coronal, sagittal, or horizontal plane, and 40-μm-thick sections were cut on a freezing microtome. One in three sections was immediately mounted from saline solution onto 3% gelatin-coated slides. Selected sections at regular intervals from those not used for counting were reacted for cytochrome oxidase, acetylcholinesterase (AChE) activity (Barone et al., 2000 (link)), and SMI-32 (Hof et al., 1996 (link)). Sections were observed with a Leitz or Leica DMRE fluorescence microscope equipped with a D-filter set (355–425 nm). A computer-assisted program (ExploraNova) was used with a motorized microscope stage so as to trace out sections electronically and record neuron positions with high precision (±10 μm).

Markov N.T., Vezoli J., Chameau P., Falchier A., Quilodran R., Huissoud C., Lamy C., Misery P., Giroud P., Ullman S., Barone P., Dehay C., Knoblauch K, & Kennedy H. (2013). Anatomy of hierarchy: Feedforward and feedback pathways in macaque visual cortex. The Journal of Comparative Neurology, 522(1), 225-259.

Full text: Click here

Publication 2013

Acetylcholinesterase Animals Brain Buffers Cortex, Cerebral diamidino yellow Fast Blue Gelatins Glutaral Gray Matter Heart Lunate Sulcus Microscopy Microscopy, Fluorescence Microtomy Monkeys Neurons Opercular Cortex Oxidase, Cytochrome-c paraform Phosphates Reconstructive Surgical Procedures Saline Solution Sucrose Temporal Sulcus Vascular Access Ports

Post-Mortem Tissue Processing and Analysis

Cited 8 times

Five to seven days after surgery, animals were given a lethal dose of sodium pentobarbital (80mg/kg intravenously) and perfused with phosphate-buffer (PB; pH 7.4), followed by 2% paraformaldehyde in PB, and finally 2% paraformaldehyde in PB with 10% sucrose. After the brains were removed, the cortex was separated from underlying brain structures. The cortex from the intact hemisphere was flattened and used for another study (Baldwin and Kaas, 2012 (link)). The thalamus and brainstem were then placed in 30% sucrose solution for cryoprotection and stored at 4°C for 20 to 48 hours.
The thalamus and brainstem were cut in the coronal plane using a freezing microtome at a thickness of 40 μm. The tissue was saved in 5 series. One to three series were processed for anatomical tracers such as CTB using a histological procedures described in Baldwin et al., (2011) (link), or WGA-HRP using procedures of Gibson et al. (1984), or were immediately mounted onto glass slides for fluorescent analysis of FR. Remaining series were processed for two to three of the following stains: cytochrome oxidase, CO (Wong-Wiley, 1979 (link)), acetylcholinesterase, AChE (Geneser-Jensen and Blackstand, 1971 ), vesicular glutamate transporter 2, VGLUT2 (mouse monoclonal anti-VGLUT2 from Millipore, Billerica, MA: 1:5000). For one case, two series of tissue were processed for VGLUT2 mRNA using previously described in situ hybridization techniques (Balaram et al., 2011 (link)). Table 1 lists all antibodies used. The CTB antibody was tested on galago brain tissue with no CTB injections and this control failed to label any cells or patches of axon terminals. The VGLUT antibody was tested against galago brain tissue using standard western blot techniques (Baldwin et al., 2011 (link)) and showed a single band at 56 kDa (Fig. 1), the known molecular weight of VGLUT2 (Aihara et al., 2000).

Baldwin M.K., Balaram P, & Kaas J.H. (2013). Projections of the superior colliculus to the pulvinar in prosimian galagos (Otolemur garnettii) and VGLUT2 staining of the visual pulvinar. The Journal of comparative neurology, 521(7), 1664-1682.

Publication 2012

Acetylcholinesterase Animals Antibodies Brain Brain Stem Buffers Bush Babies Cells Cortex, Cerebral Histological Techniques Immunoglobulins In Situ Hybridization Mice, House Microtomy Oxidase, Cytochrome-c Pain paraform Pentobarbital Sodium Phosphates Presynaptic Terminals RNA, Messenger Staining Sucrose Thalamus Tissues Vesicular Glutamate Transport Protein 2 Western Blotting Wheat Germ Agglutinin-Horseradish Peroxidase Conjugate

Most recents protocols related to «Acetylcholinesterase»

Longitudinal Gene Expression Analysis in Honey Bees

A total of five genes were investigated in this study, namely: 1- vitellogenin (Vg), 2- major royal jelly protein 1 (mrjp1), 3- acetylcholine esterase 2 (AChE-2), 4- superoxide dismutase-like (Rsod) and 5- thioredoxin 1 (Trx-1). Sequences of the primers and their amplicon sizes are given in Table 1. Two-step reverse transcription quantitative PCR (RT-qPCR) using BioRad iTaq SYBER Green Supermix 2X was conducted on three biological and technical replicates per sample on five time points enabling a greater longitudinal analysis of gene regulation. cDNA was synthesized from RNA extractions using BioRad iScript Kit following the manufacturer’s protocol. Target genes were normalized against two housekeeping genes (GAPDH, RPS18) known for their stability in honey bee tissues^{38 (link),62 (link)}.Table 1

Target genes investigated in this study, housekeeping genes, primer sequences, amplicon size and NCBI accession numbers.

Gene	Description	F/R	bp	NCBI Accession
Target
AChE-2	Acetylcholinesterase-2	GACGCGAAGACCATATCCGT TCTGTGTCCTTGAAGTCCGC	140	NM_001040230.1
Mrjp1	Major royal jelly protein 1	TGACCAATGGCATGATAAG GACCACCATCACCGACCT	98	NM_001011579.1
Vg	Vitellogenin	AACGCTTTTACTGTTCGCGG TATGCACGTCCGACAGATCG	128	NM_001011578.1
Rsod	Superoxide dismutase-like	GGAGCAGTATCTGCAATGGGA CGCTACAAAACGTGGTGGTT	141	XM_006558333.2
Trx-1	Thioredoxin-1	AATGCACCGGCTCAAGAACA CATGCGACAAGGATTGCACC	138	XM_393603.7
Housekeeping
GAPDH	Glyceraldehyde-3-phosphate dehydrogenase 2	TACCGCTTTCTGCCCTTCAA GCACCGAACTCAATGGAAGC	142	XM_393605.7
RPS18	40S ribosomal protein S18	AATTATTTGGTCGCTGGAATTG TAACGTCCAGCAGAATGTGGTA	238	XM_625101.6

Alburaki M., Madella S, & Cook S.C. (2023). Non-optimal ambient temperatures aggravate insecticide toxicity and affect honey bees Apis mellifera L. gene regulation. Scientific Reports, 13, 3931.

Full text: Click here

Publication 2023

Acetylcholinesterase Biopharmaceuticals DNA, Complementary GAPDH protein, human Gene Expression Regulation Genes Genes, Housekeeping Genes, vif Honey Oligonucleotide Primers Oxidoreductase Phosphates Proteins Reverse Transcription Ribosomal Proteins royal jelly Superoxide Dismutase Thioredoxin 1 Vitellogenins

Sublethal Toxicity Biomarkers in Shrimp

A selection of
sublethal end points related to, e.g., neurological impacts, lipid
metabolism, and oxidative responses of shrimp were addressed in the
study. Validated protocols were used to analyze the following parameters:
acetylcholinesterase activity (AChE) in gills and muscle tissues to
assess neurotoxicity; AcylCoA (acyl coenzyme A) oxidase activity (ACOX),
involved in different aspects of lipid homeostasis in the digestive
gland; antioxidant response and oxidative damage in digestive gland
by total oxyradical scavenging capacity (TOSC assay toward peroxyl
and hydroxyl radicals); and lipid peroxidation (malondialdehyde levels).
The parameters described above were analyzed in tissues at the end
of exposure (day 4) and at the end of the recovery period (day 14).
Analytical methods are described in the SI.

Arnberg M., Refseth G.H., Allan I.J., Benedetti M., Regoli F., Tassara L., Sagerup K., Drivdal M., Nøst O.A., Evenset A, & Carlsson P. (2023). Acute and Sublethal Effects of Deltamethrin Discharges from the Aquaculture Industry on Northern Shrimp (Pandalus borealis Krøyer, 1838): Dispersal Modeling and Field Investigations. Environmental Science & Technology, 57(9), 3602-3611.

Full text: Click here

Publication 2023

Acetylcholinesterase Acyl CoA Oxidase Acyl Coenzyme A Antioxidants Biological Assay Digestive System Gills Homeostasis Hydroxyl Radical Lipid Peroxidation Lipids Malondialdehyde Muscle Tissue Neurotoxicity Syndromes Oxidative Damage Pain Tissues

Cholinergic Marker Immunolabeling in Rat Brain

For analysis of cholinergic markers, rats were deeply anesthetized (5% isoflurane) followed by intracardiac perfusion with clearing solution (0.1 M phosphate buffer, 0.5 mM EDTA, 0.05% NaNO₂) followed by ice cold 0.1 M phosphate buffer (PB, pH 7.4) containing 4% paraformaldehyde. Brains were removed and placed in 4% paraformaldehyde (0.1 M PB, pH 7.4) to postfix at 4°C. Coronal sections containing the basal forebrain and the amygdala plus hippocampus were cut at 50 μm on a vibratome (VT1000S, Leica, Nussloch, Germany) and stored at 4°C in 0.1 M phosphate buffer until staining. For longer term storage, sections were transferred to Anti‐freezing solution (30% Sucrose in 0.1 M phosphate buffer with 30% ethylene glycol), then stored at −20°C.
Immunofluorescence labeling for ChAT and VAChT used methods described in Tryon et al., (2022).⁴⁷ For ChAT immunolabeling, sections were washed three times in Tris buffer (TBS) for 10 min, blocked in TBS containing 0.5% Triton X‐100 and 10% normal donkey serum for 30 min at room temperature, washed in TBS then incubated with goat polyclonal anti‐choline acetyltransferase antibodies (1:1000; Millipore Cat# AB144P, RRID:AB_2079751;used previously in⁴⁷) in TBS containing 0.5% Triton X‐100 and 2% normal donkey serum for 2 days at room temperature. Sections were then incubated in donkey‐anti goat conjugated to Alexa Fluor 647 (1:400; Jackson ImmunoResearch Labs Cat# 705‐605‐147, RRID:AB_2340437) in TBS with 0.5% Triton X‐100 and 2% normal donkey serum for 3 h at room temperature. To detect labeling of vesicular acetylcholine transporter (VAChT), separate sections were washed three times in TBS then blocked for 30 min at room temperature in TBS containing 0.5% Triton X‐100 and 10% normal donkey serum, after which they were washed three times in TBS. Sections were incubated in TBS containing goat anti‐vesicular acetylcholine transporter antibodies (1:1000; Millipore Cat# ABN100, RRID:AB_2630394), 0.5% Triton X‐100 and 2% normal donkey serum overnight at room temperature. Sections were washed three times in TBS then incubated in TBS containing donkey‐anti goat conjugated to Alexa Fluor 555 (1:500; Molecular Probes Cat# A‐21432, RRID:AB_141788), 0.5% Triton X‐100 and 2% normal donkey serum. Sections labeled for ChAT were coverslipped in Vectashield Vibrance Antifade Mounting Media (Vector Laboratories Cat#H‐1700, Burlingame, CA) and sections labeled for VAChT were coverslipped in Prolong Gold Antifade Mountant (Thermo Fisher Scientific, Waltham, MA) and stored at 4°C until imaging.
Coronal sections including the BF, BLA and hippocampus were also stained for acetylcholinesterase (ACHE) activity. As described previously, sections were incubated in a solution of 0.2 M Tris maleate buffer (pH 5.7), 0.1 M sodium citrate, 0.03 M cupric sulfate, 5 mM potassium ferricyanide, and 1.7 mM acetylthiocholine iodide for ~60 min at room temperature followed by a 70% ethanol rinse and coverslipping.⁴⁸, ⁴⁹

Tryon S.C., Sakamoto I.M., Kaigler K.F., Gee G., Turner J., Bartley K., Fadel J.R, & Wilson M.A. (2023). ChAT::Cre transgenic rats show sex‐dependent altered fear behaviors, ultrasonic vocalizations and cholinergic marker expression. Genes, Brain, and Behavior, 22(1), e12837.

Publication 2023

Acetylcholinesterase Acetylcholine Transporters, Vesicular acetylthiocholine iodide Alexa Fluor 555 Alexa Fluor 647 Amygdaloid Body Anti-Antibodies Basal Forebrain Brain Buffers Choline O-Acetyltransferase Cholinergic Agents Cloning Vectors Cold Temperature Edetic Acid Equus asinus Ethanol Fluorescent Antibody Technique Glycol, Ethylene Goat Gold Isoflurane maleate Molecular Probes paraform Perfusion Phosphates potassium ferricyanide Rattus Seahorses Serum Sodium Citrate Sucrose Sulfate, Copper Triton X-100 Tromethamine

Assessing Acetylcholinesterase Activity

The assessment of the acetylcholinesterase activity was carried out based on a previously published procedure (Pohanka et al., 2011 (link)).

Jadhav R, & Kulkarni Y.A. (2023). Effects of baicalein with memantine on aluminium chloride-induced neurotoxicity in Wistar rats. Frontiers in Pharmacology, 14, 1034620.

Full text: Click here

Publication 2023

Acetylcholinesterase

Cholinesterase Enzyme Assay Protocol

Acetylcholinesterase from electric eel type VI-S, butyrylcholinesterase from equine serum, acetylthiocholine iodide (ATCI), butyrylthiocholine iodide (BTCI), 5,5′-dithiobis[2-nitrobenzoic acid] (DTNB), bovine serum albumin (BSA), tris buffer, and galantamine were purchased from Sigma–Aldrich. The organic solvents (methanol and ethanol) and reagents used in the analysis were of analytical grades.

S.u.c.i.a.t.i., Laili E.R., Ekasari W., K.u.a.t.m.a.n., Nuengchamnong N, & Suphrom N. (2023). Chemical Profiles and In Vitro Cholinesterase Inhibitory Activities of the Flower Extracts of Cassia spectabilis. Advances in Pharmacological and Pharmaceutical Sciences, 2023, 6066601.

Full text: Click here

Publication 2023

Acetylcholinesterase acetylthiocholine iodide Butyrylcholinesterase Butyrylthiocholine Dithionitrobenzoic Acid Electric Eel Equus caballus Ethanol Galantamine Iodides Methanol Nitrobenzoic Acids Serum Serum Albumin, Bovine Solvents Tromethamine

Top products related to «Acetylcholinesterase»

Acetylcholinesterase by Merck Group

Sourced in United States, Germany, Italy, Chile, Spain

Acetylcholinesterase is an enzyme that catalyzes the breakdown of the neurotransmitter acetylcholine in the synaptic cleft. It is an important component in the regulation of nerve impulse transmission.

Acetylthiocholine iodide by Merck Group

Sourced in United States, Germany, United Kingdom, Spain, Italy, China, Sao Tome and Principe, Canada, India, Thailand, Japan, Switzerland, France, Argentina, Portugal

Acetylthiocholine iodide is a chemical compound used as a substrate in enzymatic assays. It is commonly employed in the measurement of the activity of the enzyme acetylcholinesterase.

5 5 dithiobis 2 nitrobenzoic acid by Merck Group

Sourced in United States, Germany, India, China, Italy, United Kingdom, Japan, Spain, Israel, Canada, Argentina

5,5′-dithiobis(2-nitrobenzoic acid) is a chemical compound used in various laboratory applications. It is a solid, crystalline substance with a specific chemical structure and formula. The primary function of this compound is to serve as a reagent in analytical and biochemical procedures, without further interpretation of its intended use.

5 5 dithiobis 2 nitrobenzoic acid dtnb by Merck Group

Sourced in United States, Germany, China, Italy, India, Switzerland, Spain, United Kingdom, Sao Tome and Principe

5,5′-dithiobis(2-nitrobenzoic acid) (DTNB) is a chemical compound used in various laboratory applications. It is a water-soluble, yellow-colored reagent that is commonly employed for the determination of thiol groups in proteins and other biological samples.

Gallic acid by Merck Group

Sourced in United States, Germany, Italy, Spain, France, India, China, Poland, Australia, United Kingdom, Sao Tome and Principe, Brazil, Chile, Ireland, Canada, Singapore, Switzerland, Malaysia, Portugal, Mexico, Hungary, New Zealand, Belgium, Czechia, Macao, Hong Kong, Sweden, Argentina, Cameroon, Japan, Slovakia, Serbia

Gallic acid is a naturally occurring organic compound that can be used as a laboratory reagent. It is a white to light tan crystalline solid with the chemical formula C6H2(OH)3COOH. Gallic acid is commonly used in various analytical and research applications.

Amplex red acetylcholine acetylcholinesterase assay kit by Thermo Fisher Scientific

Sourced in United States, Germany

The Amplex® Red Acetylcholine/Acetylcholinesterase Assay Kit is a fluorometric assay kit used to measure acetylcholine levels and acetylcholinesterase activity. The kit utilizes Amplex Red reagent to detect hydrogen peroxide, which is produced as a byproduct of the acetylcholine-acetylcholinesterase reaction.

Butyrylcholinesterase by Merck Group

Sourced in Germany, United States, Italy

Butyrylcholinesterase is an enzyme that catalyzes the hydrolysis of the neurotransmitter acetylcholine. It is found in various tissues and plays a role in the regulation of cholinergic neurotransmission.

Dimethyl sulfoxide (dmso) by Merck Group

Sourced in United States, Germany, United Kingdom, China, Italy, Sao Tome and Principe, France, Macao, India, Canada, Switzerland, Japan, Australia, Spain, Poland, Belgium, Brazil, Czechia, Portugal, Austria, Denmark, Israel, Sweden, Ireland, Hungary, Mexico, Netherlands, Singapore, Indonesia, Slovakia, Cameroon, Norway, Thailand, Chile, Finland, Malaysia, Latvia, New Zealand, Hong Kong, Pakistan, Uruguay, Bangladesh

DMSO is a versatile organic solvent commonly used in laboratory settings. It has a high boiling point, low viscosity, and the ability to dissolve a wide range of polar and non-polar compounds. DMSO's core function is as a solvent, allowing for the effective dissolution and handling of various chemical substances during research and experimentation.

2 2 diphenyl 1 picrylhydrazyl (dpph) by Merck Group

Sourced in United States, Germany, Italy, India, China, Spain, Poland, France, United Kingdom, Australia, Brazil, Singapore, Switzerland, Hungary, Mexico, Japan, Denmark, Sao Tome and Principe, Chile, Malaysia, Argentina, Belgium, Cameroon, Canada, Ireland, Portugal, Israel, Romania, Czechia, Macao, Indonesia

DPPH is a chemical compound used as a free radical scavenger in various analytical techniques. It is commonly used to assess the antioxidant activity of substances. The core function of DPPH is to serve as a stable free radical that can be reduced, resulting in a color change that can be measured spectrophotometrically.

Quercetin by Merck Group

Sourced in United States, Germany, Italy, India, Spain, United Kingdom, France, Poland, China, Sao Tome and Principe, Australia, Brazil, Macao, Switzerland, Canada, Chile, Japan, Singapore, Ireland, Mexico, Portugal, Sweden, Malaysia, Hungary

Quercetin is a natural compound found in various plants, including fruits and vegetables. It is a type of flavonoid with antioxidant properties. Quercetin is often used as a reference standard in analytical procedures and research applications.

What is Acetylcholinesterase and what are its key functions?

Acetylcholinesterase is an essential enzyme that plays a crucial role in the regulation of cholinergic neurotransmission. It catalyzes the hydrolysis of the neurotransmitter acetylcholine, thereby terminating its action at cholinergic synapses. This enzyme is found in various tissues, including the nervous system, muscles, and red blood cells. Acetylcholinesterase is a key target for pharmacological interventions, as its inhibition can be used to treat conditions like myasthenia gravis, glaucoma, and Alzheimer's disease.

What are the different variations or types of Acetylcholinesterase?

Acetylcholinesterase can exist in different forms or variants, each with its own unique structural and functional characteristics. The main types include the globular (G) and the asymmetric (A) forms, which can be further classified based on their oligomeric structure and cellular localization. These variations can impact the enzyme's activity, stability, and distribution within the body, which is important to consider when studying or targeting Acetylcholinesterase for specific applications.

How can PubCompare.ai help in Acetylcholinesterase research?

PubCompare.ai is a powerful tool that can greatly assist in optimizing Acetylcholinesterase research. The platform allows you to efficintly screen protocol literature and leverage AI to pinpoint critical insights. By comparing multiple methods side-by-side, PubCompare.ai can help researchers identify the most effective protocols related to Acetylcholinesterase for their specific research goals. The platform's AI-driven analysis can highlight key differences in protocol effectiveness, enabling you to choose the best option for reproducibility and accuracy, ultimately streamlining your Acetylcholinesterase research.

What are some common applications of Acetylcholinesterase?

Acetylcholinesterase has a wide range of applications in both research and clinical settings. It is an important target for the treatment of conditions like myasthenia gravis, where its inhibition can help improve neuromuscular transmission. Acetylcholinesterase inhibitors are also used to manage symptoms of Alzheimer's disease by increasing the availability of acetylcholine in the brain. Additionally, Acetylcholinesterase plays a role in the regulation of intraocular pressure, making it a potential target for glaucoma treatments. Understanding the diverse applications of Acetylcholinesterase is crucial for developing effective therapies and advancing research in related fields.

What are some common usage challenges associated with Acetylcholinesterase?

One of the key challenges in working with Acetylcholinesterase is the potential for off-target effects and unintended consequences. Since the enzyme is involved in various physiological processes, inhibiting or modulating its activity can lead to a range of side effects, depending on the specific application. Additionally, the complexity of Acetylcholinesterase's structure and function, as well as its variability across different tissue types and species, can make it difficult to develop selective and effective interventions. Careful optimization of dosage, delivery, and targeting strategies is crucial to maximize the therapeutic potential of Acetylcholinesterase-based treatments while minimizing adverse effects.

More about "Acetylcholinesterase"

Acetylcholinesterase (AChE) is a crucial enzyme involved in the regulation of cholinergic neurotransmission.
It catalyzes the hydrolysis of the neurotransmitter acetylcholine (ACh), effectively terminating its action at cholinergic synapses.
This enzyme is found in various tissues, including the nervous system, muscles, and red blood cells.
AChE is an important target for pharmacological interventions, as its inhibition can be used to treat conditions such as myasthenia gravis, glaucoma, and Alzheimer's disease.
Research into AChE is vital for understanding its function and developing effective therapies.
Acetylthiocholine iodide (ATChI) is a commonly used substrate for the measurement of AChE activity, while 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB), also known as Ellman's reagent, is a chromogenic compound used to detect the products of the AChE-catalyzed hydrolysis of ATChI.
Gallic acid and Quercetin are compounds that have been studied for their potential inhibitory effects on AChE.
The Amplex® Red Acetylcholine/Acetylcholinesterase Assay Kit is a fluorometric tool used to measure AChE activity, while Butyrylcholinesterase (BChE) is a related enzyme that can also be targeted in some research and therapeutic applications.
DMSO and DPPH are commonly used solvents and reagents in AChE-related experiments.
PubCompare.ai can help optimize your AChE research by allowing you to easily locate and identify the best protocols from literature, pre-prints, and patents, and compare multiple methods side-by-side to ensure reproducibility and find the most effective products for your experiments.