Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > Acyltransferase

Acyltransferase

Acyltransferases are a class of enzymes that catalyze the transfer of acyl groups from one compound to another.
They play crucial roles in various metabolic pathways, including lipid biosynthesis, protein modification, and xenobiotic metabolism.
Acyltransferases are involved in a wide range of biological processes, such as membrane biogenesis, signal transduction, and energy production.
Understanding the structure, function, and regulation of acyltransferases is essential for elucidating their role in health and disease, as well as for developing targeted therapies.
This MeSH term provides a concise, informative overview of this important group of enzymes.

Most cited protocols related to «Acyltransferase»

1
SMURF: Fungal Genome Mining for Secondary Metabolites
Cited 57 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2010
Acyltransferase Amino Acids Anabolism brevianamide F CSF2RB protein, human Dehydrogenase, Aminoadipate-Semialdehyde Dimethylallyltranstransferase Enzymes Genes Genes, Fungal Genome Genome, Fungal Hybrids Lyngbya Toxins Nitric Oxide Synthase non-ribosomal peptide synthase Proteins Protein Subunits SET Domain short chain trans-2-enoyl-CoA reductase Synthase, Polyketide tryptophan dimethylallyltransferase Tyrosine Vertebral Column
2
Construction of Acyltransferase Overexpression Mutants in Yarrowia lipolytica
Cited 5 times
For the construction of the single acyltransferase overexpression mutants (LRO1, ARE1, DGA1, DGA2), the genes were placed under the control of the yeast TEF constitutive promoter (Muller et al. 1998 (link)). Acyltransferase genes were amplified by PCR using Y. lipolytica W29 genomic DNA as the template and the corresponding primer pairs (Table 2) as described in the previous section. Acyltransferase-coding genes were then inserted between the BamHI-AvrII sites of the expression vector pTEF, JMP62 (JME 803) containing the selective marker URA3 (Nicaud et al. 2002 (link)). Plasmids were digested with NotI and used to transform the quadruple mutant Y. lipolytica strain JMY1877 by the lithium acetate method (Barth et al. 2003 ). Transformants were selected on YNBcasa medium. A schematic representation of the strains constructed is depicted in Fig. 1.

Genes involved in storage lipid synthesis in Y. lipolytica and S. cerevisiae. S. cerevisiae gene names and Enzyme Commission numbers, Y. lipolytica orthologs (gene name), and corresponding functions

GeneSC nameYL nameEC numberFunction
SCT1YBL011wYALI0C00209gEC 2.3.1.15Glycerol-3-phosphate acyltransferase
SLC1YDL052cYALI0E18964gEC 2.3.1.511-acyl-sn-glycerol-3-phosphate acyltransferase
PAPYMR165CEC 3.1.3.4Phosphatidate phosphatase
DGA1YOR245cYALI0E32769gEC 2.3.1.20Diacylglycerol acyltransferase (DGAT2)
LRO1YNR008wYALI0E16797gEC 2.3.1.158Phospholipid:diacylglycerol acyltransferase
TGL3YMR313cYALI0D17534gEC 3.1.1.3Triacylglycerol lipase
TGL4YKR089cYALI0F10010gEC 3.1.1.3Triacylglycerol lipase
TGL5YOR081cEC 3.1.1.3Triacylglycerol lipase
ARE1YCR048wYALI0F06578gEC 2.3.1.26Acyl-CoA:sterol acyltransferase
ARE2YNR019wEC 2.3.1.26Acyl-CoA:sterol acyltransferase
DGA2YALI0D07986gDiacylglycerol acyltransferase (DGAT1)
TGL1YKL140wYALI0E32035gEC 3.1.1.13Cholesterol esterase

Bioinformatic data were obtained from the Saccharomyces Genome Database (http://www.yeastgenome.org/) and the Genolevures database (http://cbi.labri.fr/Genolevures/)

Beopoulos A., Haddouche R., Kabran P., Dulermo T., Chardot T, & Nicaud J.M. (2011). Identification and characterization of DGA2, an acyltransferase of the DGAT1 acyl-CoA:diacylglycerol acyltransferase family in the oleaginous yeast Yarrowia lipolytica. New insights into the storage lipid metabolism of oleaginous yeasts. Applied Microbiology and Biotechnology, 93(4), 1523-1537.
Publication 2011
Acyltransferase Cloning Vectors Diacylglycerol Enzymes Genes Genome Glycerin Lipogenesis lithium acetate Oligonucleotide Primers Phosphate Acetyltransferase Plasmids Saccharomyces Saccharomyces cerevisiae Sterols Strains Yarrowia lipolytica
3
Recombinant Production of Modular PKS Enzymes
Cited 5 times
The construction of plasmids encoding module 3 (pRSG34) and module 6 (pRSG54) with thioesterase (TE) domain covalently attached has been previously described [21 (link)]. Module 3/AT°+TE: To inactivate the acyltransferase domain of module 3+TE (pRSG34), the AT active site Ser was mutated into Ala using primers 5′- GCGGTCGTGGGGCACGCGCAGGGCGAGATCG -3′and 5′-CGATCTCGCCCTGCGCGTGCCCCACGACCGC -3′ to yield plasmid pAYC136. Module 6/AT°+TE: Similarly, primers 5′- GCCGTCATCGGCCATGCGCAGGGCGAGATCG -3′and 5′-CGATCTCGCCCTGCGCATGGCCGATGACGGC -3′ were used to inactivate the AT domain of module 6+TE (pRSG54) to yield plasmid pAYC138. The plasmids, along with pRSG34 and pRSG54, were transformed into E. coli BAP1 [22 (link)] to produce the desired holo-proteins with pantetheinylated ACP domains [23 (link)]. Proteins were expressed and purified using the previously described protocol [11 (link)].
Wong F.T., Chen A.Y., Cane D.E, & Khosla C. (2010). Protein-Protein Recognition between Acyltransferases and Acyl Carrier Proteins in Multimodular Polyketide Synthases. Biochemistry, 49(1), 95-102.
Publication 2009
Acyltransferase Escherichia coli Oligonucleotide Primers Plasmids Protein Domain Proteins
4
Cholesterol Efflux Capacity Assay
Cited 4 times
Cholesterol efflux capacity was performed as described elsewhere [19 (link),39 (link)]. J774.2 cells (Sigma-Aldrich, Darmstadt, Germany) were cultured in Dulbecco’s modified Eagle’s medium (Life Technologies, Carlsbad, California, USA) in the presence of 10% fetal bovine serum and 1% penicillin/streptomycin. A total of 300,000 cells per well were plated on 48-well plates (Greiner Bio-One, Kremsmünster, Austria), cultured for 24 h, and labelled with 0.5 µCi/mL radiolabeled [3H]-cholesterol (Hartmann Analytic, Braunschweig, Germany) in Dulbecco’s modified Eagle’s medium supplemented with 2% fetal bovine serum and 1% penicillin/streptomycin in the presence of 0.3 mM 8-(4-chlorophenylthio)-cyclic adenosine monophosphate (Sigma-Aldrich, Darmstadt, Germany) overnight. Cyclic adenosine monophosphate was used to upregulate ATP-binding cassette transporter A1. The day after labelling, cells were rinsed with serum-free Dulbecco’s modified Eagle’s medium containing 1% penicillin/streptomycin and equilibrated with serum-free Dulbecco’s modified Eagle’s medium containing 1% penicillin/streptomycin and 2 mg/mL bovine serum albumin (Sigma-Aldrich, Darmstadt, Germany) for 2 h. Subsequently, [3H]-cholesterol efflux was determined by incubating cells for 3 h with 2.8% apoB-depleted serum. Cholesterol efflux capacity was expressed as the radioactivity in the medium relative to total radioactivity in medium and cells. All steps were performed in the presence of 2 µg/mL of the acyl- coenzyme A cholesterol acyltransferase inhibitor Sandoz 58-035 (Sigma-Aldrich, Darmstadt, Germany).
Stadler J.T., Lackner S., Mörkl S., Trakaki A., Scharnagl H., Borenich A., Wonisch W., Mangge H., Zelzer S., Meier-Allard N., Holasek S.J, & Marsche G. (2021). Obesity Affects HDL Metabolism, Composition and Subclass Distribution. Biomedicines, 9(3), 242.
Full text: Click here
Publication 2021
A 300 ABCA1 protein, human Acyl Coenzyme A Acyltransferase Anticholesteremic Agents Apolipoproteins B Cells Cholesterol Cyclic AMP Eagle Fetal Bovine Serum Penicillins Radioactivity SAN 58035 Serum Serum Albumin, Bovine Streptomycin
5
Cholesterol Efflux Capacity in Atrial Fibrillation
Cited 3 times
To assess the association between the pathophysiology in AF and HDL functionality, we measured three types of HDL CECs by using serum of patients with AF who were about to undergo catheter ablation. Global CEC, ABCA1 CEC, and Non-ABCA1 CEC of HDL were measured using methods previously described with modifications39 (link). Apolipoprotein B (apoB)-depleted serum was prepared by adding 40 μL of 20% polyethylene glycol 6000 (Sigma-Aldrich, St. Louis, MI, USA) in 200 mM glycine (pH 7.4) to 100 μL of serum and then centrifugation at 8,000 × g for 30 min. The supernatants were stored at -80 °C until use. J774.1 murine macrophage-like cells, obtained from Japanese Collection of Research Bioresources (JCRB) Cell Bank (Osaka, Japan), were seeded in 48-well plates at 75,000 cells per well and then labeled with [3H]-cholesterol (1 μCi/mL, PerkinElmer, Waltham, MA, USA) for 24 h at 37 °C in RPMI1640 medium (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 5% fetal bovine serum (FBS), acyl-CoA:cholesterol acyltransferase (ACAT) inhibitor Sandoze 58–035 (2 μg/mL, Sigma-Aldrich), and 50 μg/mL acetylated LDL (Ac-LDL, Alfa Aesar, Ward Hill, MA, USA) to enrich the cells with free cholesterol. The cells were equilibrated for 24 h in RPMI1640 medium supplemented with 0.2% bovine serum albumin (Roche, Basel, Switzerland) and 2 μg/mL ACAT inhibitor in the presence (Global CEC) or absence (Non-ATP-binding cassette transporter A1 (ABCA1 CEC) of cyclic-3′,5′-AMP (CTP-cAMP, Cayman Chemical Company, Ann Arbor, MI, USA) to induce ABCA1 expression. Efflux media containing 2.8% apoB-depleted serum was added for 4 h. The CEC of HDL was calculated as the percentage of radioactivity recovered from the medium to total radioactivity count. Three types of CECs were finally normalized with the CEC value of pooled control serum collected from healthy volunteers (age range, 27–32 years old, n = 4) on each plate to be presented as CEC indexes. ABCA1 CEC was calculated by subtracting the Non-ABCA1 CEC from Global CEC.
Minami-Takano A., Iwata H., Miyosawa K., Shiozawa T., Hayashi H., Funamizu T., Ishii K., Nozaki Y., Tabuchi H., Sekita G., Shimada K., Sumiyoshi M., Nakazato Y., Daida H, & Minamino T. (2021). The association between impairment of HDL cholesterol efflux capacity and atrial remodeling in atrial fibrillation. Scientific Reports, 11, 3547.
Full text: Click here
Publication 2021
ABCA1 protein, human acetyl-LDL Acyl Coenzyme A Acyltransferase Adenosine Monophosphate Apolipoproteins B Caimans Catheter Ablation Cells Centrifugation Cholesterol Fetal Bovine Serum Glycine Healthy Volunteers Japanese Macrophage Mus Patients Polyethylene Glycol 6000 Radioactivity Serum Serum Albumin, Bovine Sterol O-Acyltransferase

Most recents protocols related to «Acyltransferase»

1
Isolation and Genomic Characterization of Deep-Sea Micromonospora Strains
Micromonospora strains AKA109 and AKA38 were isolated from deep sea water collected in Shizuoka, Japan, maintained as TP-A0907 and TP-A0908, respectively, in Toyama Prefectural University, and have been deposited to and are available from the NBRC culture collection as NBRC 113680 and NBRC 113681, respectively. The 16S rRNA genes were amplified by PCR using 9F and 1541R primers. The amplicons were sequenced by the method described in our previous report [19 (link)]. Type strains showing high 16S rRNA gene sequence similarities to AKA109 and AKA38 were searched using the EzBioCloud web server [20 (link)]. Phylogenetic trees based on 16S rRNA gene and DNA gyrase subunit B gene (gyrB) sequences were reconstructed by the neighbor-joining method using ClustalX 2.1. Whole genomes were sequenced using PacBio, as reported [21 (link)]. Draft genome sequences of strains AKA109 and AKA38 were deposited to DDBJ under the accession numbers of BNEH01000001–BNEH01000007 and BNEI01000001–BNEI01000011, respectively. A phylogenomic tree was reconstructed using the TYSG server [22 (link)]. DNA–DNA relatedness was calculated by digital DNA–DNA hybridization (DDH) using the Genome-to-Genome Distance Calculator 2.1 (GGDC) [23 (link)], and DDH estimates by the Formula 2 were employed. PKS and NRPS gene clusters in the whole genome were searched, and their domains were determined using antiSMASH [24 (link)]. The products were predicted by reviewing module numbers and domain organizations in PKSs and NRPSs, the substrates of acyltransferase (AT) and adenylation (A) domains, and orthologs searched by BLAST, in addition to results of ClusterBlast in antiSMASH.
Komaki H., Tamura T, & Igarashi Y. (2023). Taxonomic Positions and Secondary Metabolite-Biosynthetic Gene Clusters of Akazaoxime- and Levantilide-Producers. Life, 13(2), 542.
Full text: Click here
Publication 2023
Acyltransferase Crossbreeding DNA Gyrase Fingers Genes Genome Micromonospora Oligonucleotide Primers Protein Subunits Ribosomal RNA Genes RNA, Ribosomal, 16S Strains Trees
2
Liver and Gonadal Fat Gene Expression Analysis
RNA was extracted from one female and one male liver or gonadal fat sample from each litter using the TRIzol® reagent (Thermo Scientific, Grand Island, NY, USA). Reverse transcription was conducted using the High-Capacity cDNA Reverse Transcription kit (Thermo Scientific) following the manufacturer’s instructions. Gene transcript abundance was analyzed by quantitative real-time PCR with SYBR green detection using the CFX384 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) as previously described. Data were expressed as the fold difference of the gene of interest relative to the housekeeping gene, beta-actin (Actb), using the 2-ΔΔCt method [33 (link)]. All primers were designed using GeneRunner Version 3.01 (http://www.softpedia.com, accessed on 1 January 2022) (Supplementary Table S1). Expression of the following genes was analyzed: Acer2 (alkaline ceramidase 2), Agps (peroxisomal alkyldihydroxyacetonephosphate synthase), Ccl2 [MCP-1/chemokine (C-C motif) ligand 2], Cers2 (ceramide synthase 2), Col1a1 (COL1A1 collagen type I alpha 1 chain); Cybb (cytochrome b-245 beta), Elovl1 (elongation of very long chain fatty acids 1), Fads2 (fatty acid desaturase 2), Far1 (fatty acyl-CoA reductase 1), Gnpat (glyceronephosphate O-acyltransferase), Gpx4 (glutathione peroxidase 4), Mfsd2a (mammalian family super domain 2 a), Sod (superoxide dismutase), and Tnfa (tumor necrosis factor alpha).
Korsmo H.W., Kadam I., Reaz A., Bretter R., Saxena A., Johnson C.H., Caviglia J.M, & Jiang X. (2023). Prenatal Choline Supplement in a Maternal Obesity Model Modulates Offspring Hepatic Lipidomes. Nutrients, 15(4), 965.
Full text: Click here
Publication 2023
ACER2 protein, human Acyltransferase alkylglycerone-phosphate synthase beta-Actin CCL2 protein, human Chemokine COL1A1 protein, human CYBB protein, human cytochrome b245 Dehydrogenase, Acyl-CoA dihydroceramide desaturase DNA, Complementary Fatty Acid Desaturases Fatty Acids Females Gene Expression Genes Genes, Housekeeping Gonads Ligands Liver Males Mammals Oligonucleotide Primers Orosomucoid Peroxisome Phospholipid Hydroperoxide Glutathione Peroxidase Real-Time Polymerase Chain Reaction Reverse Transcription Superoxide Dismutase SYBR Green I TNF protein, human Touch trizol Tumor Necrosis Factor-alpha
3
Identification of BAHD Acyltransferases
For the identification of BAHD acyltransferases from the genomes analyzed in this study (Supplementary File 3) we followed the same approach used previously (Kruse et al., 2022 (link)), specifically, using the PFAM domain PF02458 with the HMMER software (Potter et al., 2018 (link)). After identification, we gathered additional genomic information from the respective general feature format (GFF) files for each species using custom Python scripts.
Kruse L.H., Fehr B., Chobirko J.D, & Moghe G.D. (2023). Phylogenomic analyses across land plants reveals motifs and coexpression patterns useful for functional prediction in the BAHD acyltransferase family. Frontiers in Plant Science, 14, 1067613.
Full text: Click here
Publication 2023
Acyltransferase Genome Python
4
Immunohistochemical staining of tissue arrays
COC1021 tissue arrays (Pantomics, Inc.), which have defined clinical diagnosis and clinicopathological information, were used for immunohistochemical staining (49 (link)). Firstly, tissue arrays with 4 µm core thickness were deparaffinated and hydrated using routine protocols. Antigen retrieval was performed by steaming in Tris-EDTA buffer (pH 9.0) for 20 min, and arrays were then blocked in 1.5% (v/v) Normal Horse Serum Blocking Solution (Vector Laboratories, Inc.) for 2 h at room temperature. The specific target protein was immunodetected using an adequate primary antibody concentration [ubiquitin-conjugating enzyme E2 N (UBE2N): anti-Ube2N, cat. no. ab117090, dilution 1:20, Abcam; inosine monophosphate dehydrogenase 1 (IMPDH1): anti-IMPDH1, cat. no. ab84957, 1:20, Abcam; dynein cytoplasmic 1 light intermediate chain 1 (DYNC1LI1): anti-DLC-A, cat. no. ab154251, 1:20, Abcam; phospholipase A and acyltransferase 2 (HRASLS2): anti-HRASLS2, cat. no. bs-6013R, 1:1,000, Thermo Fisher Scientific, Inc.] in the blocking solution mentioned above at 4˚C overnight. Endogenous peroxidases in tissue sections were removed by incubation with 0.3% H2O2 for 15 min, and these peroxidase-free arrays were further incubated with a biotinylated secondary antibody (either goat anti-rabbit, cat. no. BA-1000-1.5, 1:200, Vector Laboratories, Inc. or rabbit anti-goat immunoglobulin G, cat. no. BA-5000-1.5, 1:200, Vector Laboratories, Inc.) at room temperature for 60 min. The VECTASTAIN ABC system and DAB Substrate kit (both from Vector Laboratories, Inc.) were used to develop the secondary antibodies captured on arrays, according to the manufacturer's instructions. Following hematoxylin (GHS3; 50 ml, Merck KGaA) counterstaining at room temperature for 5 min and slide mounting with Malinol (Muto Pure Chemicals, Co., Ltd.), images were digitalized using a high-resolution scanner (Mirax Scan, Carl Zeiss AG) at the Taiwan Mouse Clinic (Academia Sinica, Taipei City, Taiwan). Two independent pathologists reviewed and evaluated the imaging results. QuPath (Version 0.3.0; https://qupath.github.io) was employed to produce the cell densities of immunoreactive cells per mm2 for all target proteins (50 (link)).
Chen Y.N., Shih C.Y., Guo S.L., Liu C.Y., Shen M.H., Chang S.C., Ku W.C., Huang C.C, & Huang C.J. (2023). Potential prognostic and predictive value of UBE2N, IMPDH1, DYNC1LI1 and HRASLS2 in colorectal cancer stool specimens. Biomedical Reports, 18(3), 22.
Publication 2023
Acyltransferase Antibodies Antibodies, Anti-Idiotypic Antigens Cells Cloning Vectors Cytoplasm Diagnosis Dynein Light Intermediate Chains Edetic Acid Equus caballus Goat Hematoxylin Immunoglobulins inosine monophosphate dehydrogenase 1, human Mus Pathologists Peroxidase Peroxidases Peroxide, Hydrogen Phospholipases A Proteins Protein Targeting, Cellular Rabbits Radionuclide Imaging Serum Super C resin Technique, Dilution Tissues Tromethamine UBE2N protein, human
5
Regulation of Amidase Enzyme by Guanidine-I Riboswitch
We identified a ykkC-ykkD or Guanidine-I [26 (link)] antisense-acting riboswitch in the Paenibacillus polymyxa SC2 genome that regulates the ppm-PPSC2_12215 gene that encodes an amidase protein, AmyE (Fig 2A). This enzyme, better known as 4-guanidinobutanamide amidohydrolase, is involved in the arginine metabolism pathway catalyzing the conversion reaction from 4-guanidinobutanamide into 4-guanidinobutanoate, resulting in the conversion of an amide into a carboxylic acid functional group.
Arginine is the core compound of this pathway, and it acts as a precursor in the biosynthesis of several polyamines, such as putrescine and spermidine, which are essential in several physiological processes. It can also be a poor nitrogen source [27 (link)]. Furthermore, arginine is the only amino acid with a guanidine group in its composition, despite the fact that it comprises compounds that are prominent within bacterial cells, including creatinine and secondary metabolites such as streptomycin [28 (link)–30 (link)].
The antisense-acting riboswitch identified at the 3´ end of the ppm-PPSC2_12215 gene would enable the synthesis of the 4-guanidinobutanamide amidohydrolase enzyme when guanidine is present; in this case, its availability allows the progression along the pathway while being a part of 4-guanidinobutanamide, a compound that is catabolized into butanoate and urea in a subsequent step. On the other hand, when the riboswitch senses no guanidine available, the pathway is interrupted to maintain the transient guanidine levels while being a part of the 4-guanidinobutanamide compound.
As expected, the genes in this group that are regulated by active antisense-acting riboswitches are those that encode enzymes with transferase activities such as aminotransferases, phosphatases, acyltransferases, synthetases, and dehydrogenases. The regulation of the antisense-acting riboswitches of this group inhibits the synthesis of their corresponding target genes when they detect low concentrations of the substrates involved. The most important families of active antisense riboswitches in this group mainly include the cobalamin, TPP, T-box, SAM, FMN, and MOCO riboswitches (see S3 Table).
Serrano-Gutiérrez M, & Merino E. (2023). Antisense-acting riboswitches: A poorly characterized yet important model of transcriptional regulation in prokaryotic organisms. PLOS ONE, 18(2), e0281744.
Full text: Click here
Publication 2023
11-dehydrocorticosterone Acyltransferase amidase Amides Amidohydrolases Amino Acids Anabolism Arginine Bacteria Carboxylic Acids Cardiac Arrest Cells Conversion Disorder Creatinine Disease Progression enzyme activity Enzymes Genes Genome Guanidine Ligase Metabolism Nitrogen Oxidoreductase Paenibacillus polymyxa Phosphoric Monoester Hydrolases Physiological Processes Polyamines Proteins Putrescine Riboswitch Spermidine Streptomycin Synthetic Genes Transaminases Transferase Transients Urea Vitamin B12

Top products related to «Acyltransferase»

1
3h cholesterol by PerkinElmer
Sourced in United States, China, United Kingdom, Germany
[3H]-cholesterol is a radioactively labeled form of cholesterol, containing the tritium (3H) isotope. It is used as a tracer in various research applications to study cholesterol metabolism and related biological processes.
2
8 4 chlorophenylthio cyclic amp by Merck Group
Sourced in Germany
8-(4-chlorophenylthio)-cyclic AMP is a chemical compound used in laboratory research. It functions as a cyclic AMP analog, a class of molecules that can be used to study cellular signaling processes.
3
Bovine serum albumin (bsa) by Merck Group
Sourced in United States, Germany, United Kingdom, China, Italy, Japan, France, Sao Tome and Principe, Canada, Macao, Spain, Switzerland, Australia, India, Israel, Belgium, Poland, Sweden, Denmark, Ireland, Hungary, Netherlands, Czechia, Brazil, Austria, Singapore, Portugal, Panama, Chile, Senegal, Morocco, Slovenia, New Zealand, Finland, Thailand, Uruguay, Argentina, Saudi Arabia, Romania, Greece, Mexico
Bovine serum albumin (BSA) is a common laboratory reagent derived from bovine blood plasma. It is a protein that serves as a stabilizer and blocking agent in various biochemical and immunological applications. BSA is widely used to maintain the activity and solubility of enzymes, proteins, and other biomolecules in experimental settings.
4
1 2 3h cholesterol by PerkinElmer
Sourced in United States, Italy
[1,2-3H]-cholesterol is a radiolabeled form of cholesterol, where the hydrogen atoms at positions 1 and 2 are replaced with the radioactive tritium (3H) isotope. This product is commonly used as a tracer compound in research applications to study the metabolism, distribution, and interactions of cholesterol in biological systems.
5
Aminoglutethimide by Merck Group
Sourced in United States
Aminoglutethimide is a laboratory chemical used as a reagent in various analytical and research applications. It is a white crystalline solid with the chemical formula C13H16N2O2. The core function of Aminoglutethimide is to serve as a chemical intermediate and building block in synthetic organic chemistry.
6
Primescript rt reagent kit by Takara Bio
Sourced in Japan, China, United States, France, Germany, Switzerland, Canada, Sweden, Italy, Puerto Rico, Singapore
The PrimeScript RT reagent kit is a reverse transcription kit designed for the synthesis of first-strand cDNA from RNA templates. The kit includes RNase-free reagents and enzymes necessary for the reverse transcription process.
7
J774.2 cells by Merck Group
Sourced in Germany
J774.2 cells are a type of macrophage cell line derived from BALB/c mice. They are commonly used in cell culture experiments and research applications.
8
Radiolabeled 3h cholesterol by Hartmann Analytic
Sourced in Germany
Radiolabeled [3H]-cholesterol is a laboratory reagent used for research purposes. It contains the cholesterol molecule labeled with the radioactive isotope tritium (3H). This product can be utilized in various biochemical and cell biology experiments that require the tracking or quantification of cholesterol.
9
Fugene 6 transfection reagent by Promega
Sourced in United States, United Kingdom, Japan, France, China, Sweden
FuGENE 6 is a non-liposomal transfection reagent used to deliver nucleic acids into eukaryotic cells. It facilitates the uptake of DNA, RNA, or proteins into cells through a proprietary formulation.
10
Luria broth by HiMedia
Sourced in India, United States
Luria broth is a commonly used microbiology culture medium. It provides nutrients essential for the growth of various bacterial species.

More about "Acyltransferase"

Acyltransferases are a class of enzymes that play a crucial role in various metabolic pathways, including lipid biosynthesis, protein modification, and xenobiotic metabolism.
These versatile enzymes catalyze the transfer of acyl groups from one compound to another, facilitating essential biological processes such as membrane biogenesis, signal transduction, and energy production.
Acyltransferases are involved in a wide range of activities, including the conversion of [3H]-cholesterol to cholesterol esters, the utilization of 8-(4-chlorophenylthio)-cyclic AMP as a substrate, and the modification of proteins through the addition of lipid moieties.
These enzymes can be found in a variety of cellular environments, from the cytosol to the endoplasmic reticulum, and their activity is often regulated by factors such as Bovine serum albumin and [1,2-3H]-cholesterol.
Understanding the structure, function, and regulation of acyltransferases is crucial for elucidating their role in health and disease, as well as for developing targeted therapies.
Researchers may utilize techniques such as Aminoglutethimide treatment, PrimeScript RT reagent kit, and FuGENE 6 transfection reagent to study these enzymes in various cellular and animal models, including J774.2 cells.
Acyltransferases are an esential part of lipid metabolism, and their dysregulation has been implicated in a variety of pathological conditions, such as cardiovascular disease, metabolic disorders, and cancer.
By leveraging the insights gained from Radiolabeled [3H]-cholesterol studies and other related research, scientists can gain a deeper understanding of these enzymes and their potential as therapeutic targets.