Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > Antibodies, Anti-Idiotypic

Antibodies, Anti-Idiotypic

Antibodies, Anti-Idiotypic: Antibodies that are directed against the idiotypic determinants (unique antigenic determinants) of other antibodies.
Anti-idiotypic antibodies can be used to regulate immune responses and may have potential therapeutic applications in autoimmune diseases, cancer, and infectious diseases.
These antibodies can also be used as immunological probes to study the immune system and to identify the antigen-binding sites of other antibodies.
Anti-idiotypic antibodies are a unique class of antibodies that mimic the original antigen and can potentially be used as vaccines or to modulate immune responses.

Most cited protocols related to «Antibodies, Anti-Idiotypic»

1
Immunostaining for viral antigen detection
Cited 865 times
The streptavidin alkaline phosphatase method was adapted to detect the viral antigen using a polyclonal anti-ZIKV antibody produced at the Evandro Chagas Institute2 (link). The biotin-streptavidin peroxidase method was used for immunostaining of tissues with antibodies specific for each marker studied. First, the tissue samples were deparaffinized in xylene and hydrated in a decreasing ethanol series (90%, 80%, and 70%). Endogenous peroxidase was blocked by incubating the sections in 3% hydrogen peroxide for 45 min. Antigen retrieval was performed by incubation in citrate buffer, pH 6.0, or EDTA, pH 9.0, for 20 min at 90 °C. Nonspecific proteins were blocked by incubating the sections in 10% skim milk for 30 min. The histological sections were then incubated overnight with the primary antibodies diluted in 1% bovine serum albumin (Supplementary Table S1). After this period, the slides were immersed in 1 × PBS and incubated with the secondary biotinylated antibody (LSAB, DakoCytomation) in an oven for 30 min at 37 °C. The slides were again immersed in 1X PBS and incubated with streptavidin peroxidase (LSAB, DakoCytomation) for 30 min at 37 °C. The reactions were developed with 0.03% diaminobenzidine and 3% hydrogen peroxide as the chromogen solution. After this step, the slides were washed in distilled water and counterstained with Harris hematoxylin for 1 min. Finally, the sections were dehydrated in an increasing ethanol series and cleared in xylene.
Azevedo R.S., de Sousa J.R., Araujo M.T., Martins Filho A.J., de Alcantara B.N., Araujo F.M., Queiroz M.G., Cruz A.C., Vasconcelos B.H., Chiang J.O., Martins L.C., Casseb L.M., da Silva E.V., Carvalho V.L., Vasconcelos B.C., Rodrigues S.G., Oliveira C.S., Quaresma J.A, & Vasconcelos P.F. (2018). In situ immune response and mechanisms of cell damage in central nervous system of fatal cases microcephaly by Zika virus. Scientific Reports, 8, 1.
Full text: Click here
Publication 2018
Alkaline Phosphatase Antibodies Antibodies, Anti-Idiotypic Antigens Antigens, Viral azo rubin S Biotin Buffers Citrates Edetic Acid Ethanol Hematoxylin Immunoglobulins Milk, Cow's Peroxidase Peroxide, Hydrogen Peroxides Proteins Serum Albumin, Bovine Streptavidin Tissues Tritium Xylene Zika Virus
2
Immunohistochemical Staining of Tumor Tissue
Cited 269 times
Standard IHC protocol was followed to stain the tumor tissue samples using the mouse monoclonal antibody against hNIS (human Sodium Iodide Symporter) (Abcam, ab17795), ER (Estrogen Receptor) (Abcam, ab16660, ab288). Briefly, 5 µm sized paraffin embedded tissue sections were de-paraffinized with xylene and endogenous peroxidase activity was quenched with 3% H2O2 in methanol for 30 minutes in the dark. Tissue sections were dehydrated through graded alcohols and subjected to antigen retrieval using 10mM sodium citrate. Sections were washed with TBST (Tris Borate Saline Tween-20) and then blocked with 5% BSA (Bovine Serum Albumin) for one hour. Slides were incubated with the respective mouse monoclonal primary antibody diluted with TBS. Slides were then washed for 5 minutes in TBST and incubated for 1 hour with the respective HRP (Horse Raddish Peroxidase) conjugated anti-mouse secondary antibody diluted with TBS in a ratio of 1∶200. After washing, slides were incubated with DAB (3,3′-diaminobenzidine tetrahydrochloride) (Sigma) and immediately washed under tap water after color development. Slides were then counter stained with hematoxylin. Slides were mounted with DPX (dibutyl phthalate xylene) and were then observed under a light microscope (Carl Zeiss).
Varghese F., Bukhari A.B., Malhotra R, & De A. (2014). IHC Profiler: An Open Source Plugin for the Quantitative Evaluation and Automated Scoring of Immunohistochemistry Images of Human Tissue Samples. PLoS ONE, 9(5), e96801.
Full text: Click here
Publication 2014
Antibodies, Anti-Idiotypic Antigens Borates Equus caballus estrogen receptor alpha, human Ethanol Homo sapiens Light Microscopy Methanol Monoclonal Antibodies Mus Neoplasms Paraffin Peroxidase Peroxide, Hydrogen Phthalate, Dibutyl Saline Solution Serum Albumin, Bovine SLC5A5 protein, human Sodium Citrate Stains Tissues Tromethamine Tween 20 Xylene
3
Evaluating Novel SLE Classification
Cited 247 times
To assess the performance of the new classification rule, we obtained detailed data regarding a new set of 690 additional patients. Sites were again asked to submit information on patients diagnosed with SLE, and on an approximately equal number of controls with the following diagnoses: rheumatoid arthritis, undifferentiated connective tissue disease, primary antiphospholipid antibody syndrome, vasculitis, chronic cutaneous lupus, scleroderma, Sjögren syndrome, myositis, psoriasis, fibromyalgia, alopecia areata and sarcoidosis. These data were collected on standardized case report forms and sent to the coordinating site. Information included a demographics summary, a clinical scenario, specification of ACR criteria that were met and not met, specification of SLICC criteria met and not met, auto-antibody titers and complement titers.
In addition, serum from each patient was sent to the coordinating site and analyzed at the Rheumatology Diagnostic Laboratory (Los Angeles, CA) for anti-dsDNA by ELISA, Crithidia and Farr assays, anti-Smith antibody and complement C3 and C4 levels. A second set of blood samples were tested for antiphospholipid antibodies (lupus anticoagulant, ELISA assay for IgG, IgM and IgA isotypes of anticardiolipin antibodies and anti-beta2 glycoprotein1 antibodies) at the laboratory of Joan Merrill, M.D. (Oklahoma Medical Research Foundation). Direct Coombs was done at each center's own laboratory or at Quest Diagnostics. A short description of each patient (“patient scenario”) was generated containing the submitted information and the updated auto-antibody and complement profiles.
Petri M., Orbai A.M., Alarcón G.S., Gordon C., Merrill J.T., Fortin P.R., Bruce I.N., Isenberg D., Wallace D.J., Nived O., Sturfelt G., Ramsey-Goldman R., Bae S.C., Hanly J.G., Sanchez-Guerrero J., Clarke A., Aranow C., Manzi S., Urowitz M., Gladman D., Kalunian K., Costner M., Werth V.P., Zoma A., Bernatsky S., Ruiz-Irastorza G., Khamashta M.A., Jacobsen S., Buyon J.P., Maddison P., Dooley M.A., van Vollenhoven R.F., Ginzler E., Stoll T., Peschken C., Jorizzo J.L., Callen J.P., Lim S.S., Fessler B.J., Inanc M., Kamen D.L., Rahman A., Steinsson K., Franks AG J.r., Sigler L., Hameed S., Fang H., Pham N., Brey R., Weisman M.H., McGwin G J.r, & Magder L.S. (2012). Derivation and Validation of Systemic Lupus International Collaborating Clinics Classification Criteria for Systemic Lupus Erythematosus. Arthritis and rheumatism, 64(8), 2677-2686.
Publication 2012
Alopecia Anti-Antibodies Antibodies, Anti-Idiotypic Antiphospholipid Antibodies Antiphospholipid Syndrome Biological Assay BLOOD Complement 3 Crithidia Dermatosclerosis Diagnosis Direct Coombs Test DNA, Double-Stranded Enzyme-Linked Immunosorbent Assay Fibromyalgia Immunoglobulin Isotypes Immunoglobulins Lupus Coagulation Inhibitor Lupus Erythematosus, Chronic Cutaneous Myositis Patients Psoriasis Radioimmunoprecipitation Assay Rheumatoid Arthritis Sarcoidosis Serum Sjogren's Syndrome Undifferentiated Connective Tissue Diseases Vasculitis
4
Hindbrain Whole-Mount Endomucin Staining
Cited 164 times
Hindbrains were dissected clean from surrounding tissue followed by fixation steps, dehydration and rehydration steps as described [3] (link), prior to being whole-mount stained using a rat anti endomucin antibody (Santa Cruz Biotechnology). Samples were analysed from the ventricular side. Several overlapping photographs were taken of each hindbrain imaged using an epifluorescence microscope (CellR, Olympus). Images were assembled using Photoshop software.
Zudaire E., Gambardella L., Kurcz C, & Vermeren S. (2011). A Computational Tool for Quantitative Analysis of Vascular Networks. PLoS ONE, 6(11), e27385.
Full text: Click here
Publication 2011
Antibodies, Anti-Idiotypic Dehydration Endomucins Heart Ventricle Hindbrain Microscopy Rehydration Tissues
5
Genome-wide Chromatin Profiling of Mouse Embryonic Development
Cited 66 times
Embryonic forebrain, midbrain and limb tissue was isolated from mouse embryos at E11.5. Cross-linking, chromatin isolation, sonication and immuno-precipitation using an anti-p300 antibody were performed as previously described40 (link),46 (link). ChIP DNA was further sheared by sonication, end-repaired, ligated to sequencing adapters and amplified by emulsion PCR as previously described47 (link). Gel-purified amplified ChIP DNA between 300 and 500 bp was sequenced on the Illumina Genome Analyzer II platform to generate 36-bp reads.
Sequence reads were aligned to the mouse reference genome (mm9) using BLAT48 (link). Uniquely aligned reads were extended to 300 bp in the 3′ direction and used to determine the read coverage at individual nucleotides at 25-bp intervals throughout the mouse genome. p300-enriched regions (peaks) with an estimated FDR of ≤ 0.01 were identified by comparison with a random distribution of the same number of reads. Candidate peaks mapping to repetitive regions were removed as probable artefacts.
Candidate regions for transgenic testing were selected based on ChIP-seq results and cover a wide spectrum of conservation. Enhancer candidate regions were amplified by PCR from human genomic DNA and cloned into an Hsp68-promoter-LacZ reporter vector as previously described6 (link),31 (link). Transgenic mouse embryos were generated and evaluated for reproducible LacZ activity at E11.5 as previously described6 (link).
Total RNA from E11.5 whole embryos and forebrain tissue was hybridized to GeneChip Mouse Genome 430 2.0 arrays (Affymetrix) and analysed according to the manufacturer's recommendations. Forebrain- and whole-embryo-enriched genes were identified as having at least 2.5-fold greater expression in one data set compared with the other, and a minimum signal intensity of 100. Limb-enriched genes were identified by comparison with publicly available wild-type E11.5 proximal hindlimb gene expression data (Gene Expression Omnibus (GEO) series GSE10516, samples GSM264689, GSM264690 and GSM264691)49 (link).
Visel A., Blow M.J., Li Z., Zhang T., Akiyama J.A., Holt A., Plajzer-Frick I., Shoukry M., Wright C., Chen F., Afzal V., Ren B., Rubin E.M, & Pennacchio L.A. (2009). ChIP-seq accurately predicts tissue-specific activity of enhancers. Nature, 457(7231), 854-858.
Publication 2009
Animals, Transgenic Antibodies, Anti-Idiotypic Chromatin Chromatin Immunoprecipitation Sequencing Cloning Vectors DNA Chips Embryo Emulsions EP300 protein, human Gene Chips Gene Expression Genes Genome Genome, Human Hindlimb Immunoprecipitation isolation LacZ Genes Mesencephalon Mice, Laboratory Mice, Transgenic Nucleotides Prosencephalon Repetitive Region Tissues

Most recents protocols related to «Antibodies, Anti-Idiotypic»

1
PD-1/PD-L1 Blocking Antibody Assay
Not available on PMC !

Example 10

This example provides in vitro IC50 data for the blocking of the interaction between recombinant human PD-1 (PD-1-Fc Chimera; Sino Biologics) and human PD-L1 expressed CHO cells by anti-PD-L1 antibody G12. Here, CHO cells expressing PD-L1 were pre-incubated with G12 prior to the addition of rhPD-1-Fc chimeric protein. After incubation and washing, PD-1 binding to cell surface expressed PD-L1 was detected using an Alexa-Fluor 647 tagged anti-PD-1 antibody by flow cytometry (Intellicyt HTFC; FL-4H). This example shows that anti-PD-L1 monoclonal antibody G12 was able to inhibit efficiently the binding of PD-1 to PD-L1 expressed on the surface of CHO cells.

Results: As shown in FIG. 8 and Table 4, the IC50 for blocking of the PD-1/PD-L1 cellular interaction by G12 is 1.76E-09 M. Data was collected on the Intellicyt HTFC flow cytometer, processed using FlowJo software, and analyzed and plotted in Graph Pad Prizm using non-linear regression fit. Data points are shown as the median fluorescence detected in the FL-4H channel+/−Std Error.

TABLE 4
G12
Inhibition of PD-1/PD-L1CHO-PD-L1/1.76E−09
Interaction IC50 (M)rhPD-1-Fc

US11878058B2. Antigen binding proteins that bind PD-L1 (2024-01-23). Sorrento Therapeutics, Inc. [US]. Inventors: Heyue Zhou [US], Randy Gastwirt [US], Barbara A. Swanson [US], John Dixon Gray [US], Gunnar F. Kaufmann [US].
Full text: Click here
Patent 2024
Alexa Fluor 647 Antibodies, Anti-Idiotypic Antigens Binding Proteins Biological Factors CD274 protein, human Cell Communication Cells Chimera CHO Cells Flow Cytometry Fluorescence Homo sapiens Immunoglobulins isononanoyl oxybenzene sulfonate Monoclonal Antibodies Proteins Psychological Inhibition
2
Evaluation of CDA1 Constructs in Tg32 Mice
Not available on PMC !

Example 6

Tg32 mice were homozygous, 8 week old, males. There were 4 mice per test article group. The test articles included CDA1-WT, CDA1-FcMut008, and CDA1-FcMut015. The mice were dosed at 10 mg/Kg by IV administration. Data were collected at thirteen time points (1 h, 8 h, 1 d, 2 d, 3 d, 4 d, 6 d, 8 d, 10 d, 13 d, 16 d, 19 d, and 22 d). Human IgG was quantified by ELISA using an anti-hIgG polyclonal antibody.

Tg32 is a human FcRn transgenic mouse model that can be used in drug discovery for early assessment and prediction of human pharmacokinetics of monoclonal antibodies. Monoclonal antibody clearance in Tg32 homozygous mice has the strongest correlation to monoclonal antibody clearance in humans (Avery et al. MAbs. 2016; 8(6):1064-78).

CDA1 (actoxumab) is known to have a half-life of >25 days in human. In vivo evaluation with additional mAbs in Tg32 model was performed. The different constructs can also be evaluated on Tg276 mice which are reported to have increased half-life differences between IgG variants. The results are shown in Table 2 and FIG. 10. FcMut015 increased the half-life of CDA1 in Tg32 mice.

TABLE 2
Half-Lives of Exemplary Antibody Molecules
in Tg32 Homozygous Mice
CmaxClastAUCinf
Groupt1/2 (hr)(ug/ml)(ug/ml)(hr * ug/ml)Rsq
WT261.17116.0315.4024108.030.99
FcMut008231.92131.3315.7425687.390.99
FCMut015436.69151.8227.6942735.90.93

US11858980B2. Engineered polypeptides and uses thereof (2024-01-02). VISTERRA, INC. [US]. Inventors: Karthik Viswanathan [US], Boopathy Ramakrishnan [US], Brian Booth [US], Kristin Narayan [US], Andrew M. Wollacott [US].
Full text: Click here
Patent 2024
actoxumab Animals, Transgenic Antibodies, Anti-Idiotypic Drug Kinetics Enzyme-Linked Immunosorbent Assay hippuryl-glycyl-glycine Homo sapiens Homozygote Immunoglobulins Males Menopause Mice, House Mice, Laboratory Mice, Transgenic Monoclonal Antibodies
3
Investigating Virus Infectivity's Role in Plaque Size
Not available on PMC !

Example 3

Investigation of Virus Infectivity as a Factor that Determines Plaque Size.

With the revelation that plaque formation is strongly influenced by the immunogenicity of the virus, the possibility that infectivity of the virus could be another factor that determines plaque sizes was investigated. The uptake of viruses into cells in vitro was determined by measuring the amounts of specific viral RNA sequences through real-time PCR.

To measure total viral RNA, total cellular RNA was extracted using the RNEasy Mini kit (Qiagen), and complementary DNA synthesized using the iScript cDNA Synthesis kit (Bio-Rad). To measure total viral RNA, quantitative real-time PCR was done using a primer pair targeting a highly conserved region of the 3′ UTR common to all four serotypes of dengue; inter-sample normalization was done using GAPDH as a control. Primer sequences are listed in Table 5. Pronase (Roche) was used at a concentration of 1 mg/mL and incubated with infected cells for five minutes on ice, before washing with ice cold PBS. Total cellular RNA was then extracted from the cell pellets in the manner described above.

TABLE 5
PCR primer sequences.
Gene TargetPrimer Sequence
DENV LYL 3′UTRForward: TTGAGTAAACYRTGCTGCCTGTA
TGCC (SEQ ID NO: 24)
Reverse: GAGACAGCAGGATCTCTGGTCTY
TC (SEQ ID NO: 25)
GAPDH (Human)Forward: GAGTCAACGGATTTGGTCGT
(SEQ ID NO: 26)
Reverse: TTGATTTTGGAGGGATCTCG
(SEQ ID NO: 27)
CXCL10 (Human)Forward: GGTGAGAAGAGATGTCTGAATCC
(SEQ ID NO: 28)
Reverse: GTCCATCCTTGGAAGCACTGCA
(SEQ ID NO: 29)
ISG20 (Human)Forward: ACACGTCCACTGACAGGCTGTT
(SEQ ID NO: 30)
Reverse: ATCTTCCACCGAGCTGTGTCCA
(SEQ ID NO: 31)
IFIT2 (Human)Forward: GAAGAGGAAGATTTCTGAAG
(SEQ ID NO: 32)
Reverse: CATTTTAGTTGCCGTAGG
(SEQ ID NO: 33)
IFNα (Canine)Forward: GCTCTTGTGACCACTACACCA
(SEQ ID NO: 34)
Reverse: AAGACCTTCTGGGTCATCACG
(SEQ ID NO: 35)
IFNβ (Canine)Forward: GGATGGAATGAGACCACTGTCG
(SEQ ID NO: 36)
Reverse: ACGTCCTCCAGGATTATCTCCA
(SEQ ID NO: 37)

The proportion of infected cells was assessed by flow cytometry. Cells were fixed and permeabilised with 3% paraformaldehyde and 0.1% saponin, respectively. DENV envelope (E) protein was stained with mouse monoclonal 4G2 antibody (ATCC) and AlexaFluor488 anti-mouse secondary antibody. Flow cytometry analysis was done on a BD FACS Canto II (BD Bioscience).

Unexpectedly, despite DENV-2 PDK53 inducing stronger antiviral immune responses, it had higher rates of uptake by HuH-7 cells compared to DENV-2 16681 (FIG. 5). This difference continued to be observed when DENV-2 PDK53 inoculum was reduced 10-fold. In contrast, DENV-3 PGMK30 and its parental strain DENV-3 16562 displayed the same rate of viral uptake in host cells. Furthermore, DENV-2 PDK53 showed a higher viral replication rate compared to DENV-2 16681. This was determined by measuring the percentage of cells that harbored DENV E-protein, detected using flow cytometry. DENV-2 PDK53 showed a higher percentage of infected cells compared to DENV-2 16681 at the same amount of MOI from Day 1 to 3 (FIG. 6). In contrast, DENV-3 PGMK30 showed a reverse trend and displayed lower percentage of infected cells compared to DENV-3 16562. Results here show that successfully attenuated vaccines, as exemplified by DENV-2 PDK53, have greater uptake and replication rate.

Results above demonstrate that the DENV-2 PDK53 and DENV-3 PGMK30 are polarized in their properties that influence plaque morphologies. While both attenuated strains were selected for their formation of smaller plaques compared to their parental strains, the factors leading to this outcome are different between the two.

Accordingly, this study has demonstrated that successfully attenuated vaccines, as exemplified by DENV-2 PDK53 in this study, form smaller plaques due to induction of strong innate immune responses, which is triggered by fast viral uptake and spread of infection. In contrast, DENV-3 PGMK30 form smaller plaques due to its slower uptake and growth in host cells, which inadvertently causes lower up-regulation of the innate immune response.

Based on the results presented in the foregoing Examples, the present invention provides a new strategy to prepare a LAV, which expedites the production process and ensures the generation of effectively attenuated viruses fit for vaccine use.

US11865083B2. Rapid method of generating live attenuated vaccines (2024-01-09). NATIONAL UNIVERSITY OF SINGAPORE [SG]. Inventors: Eng Eong Ooi [SG], Kenneth Goh [SG], Swee Sen Kwek [SG], Choon Kit Tang [SG].
Full text: Click here
Patent 2024
Antibodies, Anti-Idiotypic Antigens, Viral Antiviral Agents Canis familiaris Cells Common Cold Cowpox virus Dengue Fever Dental Plaque DNA, Complementary DNA Replication Flow Cytometry GAPDH protein, human Genes Homo sapiens Immunity, Innate Infection Interferon-alpha Monoclonal Antibodies Mus Oligonucleotide Primers paraform Parent Pellets, Drug Pronase Proteins Real-Time Polymerase Chain Reaction Response, Immune RNA, Viral Saponin Senile Plaques Strains Vaccines Virus Virus Diseases Virus Replication
4
Evaluating PARG Inhibitor CHP20-25 Efficacy
Not available on PMC !

Example 8

The efficacy of CHP20-25 against PARG activity was examined by dot blot assays. PARG was incubated with PAR for 20 min at room temperature with or without inhibitors. PAR-digestion results were analyzed using dot blotting with anti-PAR antibody. IC50 values of CHP20-25 were measured by dot blotting with anti-PAR antibody in a dose course of CHP20-25. Colony formation assays were performed using HCC1937 (BRCA1-mutant breast cancer cells) and PARPi-resistant UWB1.289 (BRCA1-mutant ovarian cancer cells) with 2.5-20 μM PARG inhibitors (CHP20-25, FIG. 6A). The IC50 and EC50 values of CHP20-25 were summarized in the table (FIG. 6B).

US11858879B2. PARG inhibitors and method of use thereof (2024-01-02). City of Hope [US]. Inventors: Xiaochun Yu [US], Shih-Hsun Chen [US], Yate-Ching Yuan [US], Hongzhi Li [US], David Horne [US].
Full text: Click here
Patent 2024
Antibodies, Anti-Idiotypic Biological Assay BRCA1 protein, human Cells Cell Survival Digestion Dot Immunoblotting inhibitors Malignant Neoplasm of Breast Ovarian Cancer Psychological Inhibition
5
Inhibition of VEGF-Receptor Binding
Not available on PMC !

Example 2

Evaluation of the Capability of Monoclonal Antibodies to Inhibit Binding of VEGF to its Receptor

An anti-VEGF antibody binds to VEGF to block the binding of VEGF to its receptors, VEGFR-1 and/or VEGFR-2, to be able to inhibit signal transduction through mediation of VEGF.

KLHa505 and KLHb1501 were separated and purified from the culture supernatants of the two positive clones using Protein G.

Next, IgG Fc-VEGFR-1 or IgG Fc-VEGFR2 was immobilized on a 96-well ELISA plate. After blocking with 2% bovine serum albumin, a purified antibody mixed with rhVEGF was added to the plate, followed by reaction at room temperature for 1 hour. A solution was prepared by mixing with rhVEGF, and then washed 3 times with 0.05% TWEEN® 20-containing TBS (TBS: 50 mM Tris-HCl (pH7.4), 500 mM NaCl; hereafter, referred to as “TBS-T”). Thereafter, through color development using rabbit anti-human VEGF polyclonal antibody-HRP, the rhVEGF content was determined.

As a result, it was demonstrated that the KLHa505 antibody competitively inhibits binding of VEGF to VEGFR-1 and VEGFR-2, and the KLHb1501 antibody competitively inhibits binding of VEGF to VEGFR-2 (FIG. 1).

That is, it was demonstrated in this Example that the antibodies of the present invention, KLHa505 and KLHb1501, can block VEGF-associated signal transduction.

US11872271B2. High-affinity anti-VEGF antibody KLHa505 (2024-01-16). ORDER-MADE MEDICAL RESEARCH INC. [JP], SANTEN PHARMACEUTICAL CO., LTD. [JP]. Inventors: Yasufumi Murakami [JP], Shigeki Mukoubata [JP], Hirotada Akiyama [JP], Koji Konomi [JP].
Full text: Click here
Patent 2024
Antibodies Antibodies, Anti-Idiotypic Cardiac Arrest Clone Cells Enzyme-Linked Immunosorbent Assay FLT1 protein, human G-substrate Homo sapiens Immunoglobulins Monoclonal Antibodies Rabbits Serum Albumin, Bovine Signal Transduction Sodium Chloride Tromethamine Tween 20 Vascular Endothelial Growth Factor Receptor-2 Vascular Endothelial Growth Factors

Top products related to «Antibodies, Anti-Idiotypic»

1
Pvdf membrane by Merck Group
Sourced in United States, Germany, China, United Kingdom, Morocco, Ireland, France, Italy, Japan, Canada, Spain, Switzerland, New Zealand, India, Hong Kong, Sao Tome and Principe, Sweden, Netherlands, Australia, Belgium, Austria
PVDF membranes are a type of laboratory equipment used for a variety of applications. They are made from polyvinylidene fluoride (PVDF), a durable and chemically resistant material. PVDF membranes are known for their high mechanical strength, thermal stability, and resistance to a wide range of chemicals. They are commonly used in various filtration, separation, and analysis processes in scientific and research settings.
2
4 6 diamidino 2 phenylindole (dapi) by Merck Group
Sourced in United States, Germany, Japan, United Kingdom, China, Italy, Sao Tome and Principe, France, Macao, Canada, Switzerland, Spain, Australia, Denmark, India, Poland, Israel, Belgium, Sweden, Ireland, Netherlands, Panama, Brazil, Portugal, Czechia, Puerto Rico, Austria, Hong Kong, Singapore
DAPI is a fluorescent dye that binds strongly to adenine-thymine (A-T) rich regions in DNA. It is commonly used as a nuclear counterstain in fluorescence microscopy to visualize and locate cell nuclei.
3
4 6 diamidino 2 phenylindole (dapi) by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Japan, China, Canada, Italy, Australia, France, Switzerland, Spain, Belgium, Denmark, Panama, Poland, Singapore, Austria, Morocco, Netherlands, Sweden, Argentina, India, Finland, Pakistan, Cameroon, New Zealand
DAPI is a fluorescent dye used in microscopy and flow cytometry to stain cell nuclei. It binds strongly to the minor groove of double-stranded DNA, emitting blue fluorescence when excited by ultraviolet light.
4
Bovine serum albumin (bsa) by Merck Group
Sourced in United States, Germany, United Kingdom, China, Italy, Japan, France, Sao Tome and Principe, Canada, Macao, Spain, Switzerland, Australia, India, Israel, Belgium, Poland, Sweden, Denmark, Ireland, Hungary, Netherlands, Czechia, Brazil, Austria, Singapore, Portugal, Panama, Chile, Senegal, Morocco, Slovenia, New Zealand, Finland, Thailand, Uruguay, Argentina, Saudi Arabia, Romania, Greece, Mexico
Bovine serum albumin (BSA) is a common laboratory reagent derived from bovine blood plasma. It is a protein that serves as a stabilizer and blocking agent in various biochemical and immunological applications. BSA is widely used to maintain the activity and solubility of enzymes, proteins, and other biomolecules in experimental settings.
5
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
6
Triton x 100 by Merck Group
Sourced in United States, Germany, United Kingdom, Italy, China, Japan, France, Canada, Sao Tome and Principe, Switzerland, Macao, Poland, Spain, Australia, India, Belgium, Israel, Sweden, Ireland, Denmark, Brazil, Portugal, Panama, Netherlands, Hungary, Czechia, Austria, Norway, Slovakia, Singapore, Argentina, Mexico, Senegal
Triton X-100 is a non-ionic surfactant commonly used in various laboratory applications. It functions as a detergent and solubilizing agent, facilitating the solubilization and extraction of proteins and other biomolecules from biological samples.
7
Alexa fluor 488 by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, Japan, France, Italy, Canada, China, Spain, Switzerland, Denmark, Australia, Hungary, Belgium, Ireland, Israel, Netherlands, Moldova, Republic of, India, Austria, Czechia, Poland
Alexa Fluor 488 is a fluorescent dye used in various biotechnological applications. It has an excitation maximum at 495 nm and an emission maximum at 519 nm, producing a green fluorescent signal. Alexa Fluor 488 is known for its brightness, photostability, and pH-insensitivity, making it a popular choice for labeling biomolecules in biological research.
8
Facscalibur by BD
Sourced in United States, Germany, United Kingdom, China, Canada, Japan, Italy, France, Belgium, Switzerland, Singapore, Uruguay, Australia, Spain, Poland, India, Austria, Denmark, Netherlands, Jersey, Finland, Sweden
The FACSCalibur is a flow cytometry system designed for multi-parameter analysis of cells and other particles. It features a blue (488 nm) and a red (635 nm) laser for excitation of fluorescent dyes. The instrument is capable of detecting forward scatter, side scatter, and up to four fluorescent parameters simultaneously.
9
Protease inhibitor cocktail by Roche
Sourced in United States, Switzerland, Germany, China, United Kingdom, France, Canada, Japan, Italy, Australia, Austria, Sweden, Spain, Cameroon, India, Macao, Belgium, Israel
Protease inhibitor cocktail is a laboratory reagent used to inhibit the activity of proteases, which are enzymes that break down proteins. It is commonly used in protein extraction and purification procedures to prevent protein degradation.
10
Protease inhibitor cocktail by Merck Group
Sourced in United States, Germany, China, United Kingdom, Italy, Japan, Sao Tome and Principe, France, Canada, Macao, Switzerland, Spain, Australia, Israel, Hungary, Ireland, Denmark, Brazil, Poland, India, Mexico, Senegal, Netherlands, Singapore
The Protease Inhibitor Cocktail is a laboratory product designed to inhibit the activity of proteases, which are enzymes that can degrade proteins. It is a combination of various chemical compounds that work to prevent the breakdown of proteins in biological samples, allowing for more accurate analysis and preservation of protein integrity.

More about "Antibodies, Anti-Idiotypic"

Anti-idiotypic antibodies, also known as anti-ids, are a unique class of immunoglobulins that are directed against the idiotypic (antigen-binding) region of other antibodies.
These antibodies play a crucial role in regulating immune responses and have potential therapeutic applications in a variety of diseases, including autoimmune disorders, cancer, and infectious diseases.
Anti-ids can be used as immunological probes to study the structure and function of the immune system, as well as to identify the antigen-binding sites of other antibodies.
They can mimic the original antigen, potentially serving as vaccines or as a means to modulate immune responses.
In antibody research, anti-ids are often utilized in conjunction with other techniques and materials, such as PVDF membranes for protein transfer, DAPI for nuclear staining, bovine serum albumin (BSA) and fetal bovine serum (FBS) for blocking and dilution, Triton X-100 for cell permeabilization, Alexa Fluor 488 for fluorescent labeling, and FACSCalibur flow cytometry for analysis.
Protease inhibitor cocktails may also be employed to preserve the integrity of the antibodies during experimentation.
By leveraging the insights provided by anti-ids and integrating them with other cutting-edge tools and methodologies, researchers can advance the understanding of the immune system and develop innovative therapies to address a wide range of health conditions.
PubCompare.ai's AI-driven protocol optimization can enhance the reproducibility and efficiency of antibody research by identifying the best protocols from literature, preprints, and patents, and helping researchers locate the optimal anti-idiotypic products to advance their studies with confidence.