> Chemicals & Drugs > Amino Acid > ATF4 protein, human

ATF4 protein, human

ATF4 (Activating Transcription Factor 4) is a basic leucine zipper (bZIP) transcription factor that plays a crucial role in cellular stress response pathways.
It is involved in the regulation of genes related to amino acid metabolism, antioxidant response, and apoptosis.
ATF4 is activated in response to various stimuli, such as amino acid deprivation, endoplasmic reticulum (ER) stress, and oxidative stress.
This transcription factor helps cells adapt to these stressful conditions by inducing the expression of target genes that promote cell survival or, in some cases, programmed cell death.
ATF4 has been implicated in the pathogenesis of several diseases, including neurodegenerative disorders, cancer, and metabolic diseases, making it an important target for research and potential therapeutic interventions.
Understading the regulatory mechanisms and functional roles of ATF4 is crucial for elucidating the complex cellular stress response pathways and developing effective strategies to manage ATF4-related diseases.

Most cited protocols related to «ATF4 protein, human»

Probing the Integrated Stress Response

Cited 12 times

Cell treatment, lysate preparation, immunoprecipitation, and immunoblotting followed procedures described previously (Harding et al. 1999, Harding et al. 2000a,Harding et al. 2000b). Tunicamycin and thapsigargin were purchased from Calbiochem-Novabiochem and Sigma-Aldrich, respectively. The antisera for detecting total content of eIF2α and eIF2α phosphorylated on serine 51 have been described previously (Scorsone et al. 1987; DeGracia et al. 1997). The antisera reactive with total PERK and GCN2, and the activated, phosphorylated forms of the proteins have been described previously (Harding et al. 1999, Harding et al. 2000a,Harding et al. 2000b; Bertolotti et al. 2000). As described previously, CHOP (Wang et al. 1996) and ATF4 (Vallejo et al. 1993) were detected by immunoblot. GADD34, tagged at the NH₂ terminus with a FLAG epitope, was immunoprecipitated from cell lysates prepared in 1% Triton X-100–containing buffer (Harding et al. 2000b) using an anti-FLAG monoclonal antibody (Eastman Kodak Co.). Coprecipitating PP1 was detected by immunoblot using a rabbit anti–human PP1c antiserum (Santa Cruz Biotechnology, Inc.) at a dilution of 1:200.

Novoa I., Zeng H., Harding H.P, & Ron D. (2001). Feedback Inhibition of the Unfolded Protein Response by GADD34-Mediated Dephosphorylation of eIF2α. The Journal of Cell Biology, 153(5), 1011-1022.

Publication 2001

Antibodies, Anti-Idiotypic ATF4 protein, human Buffers Cells DDIT3 protein, human Epitopes Homo sapiens Immune Sera Immunoblotting Immunoprecipitation Proteins Rabbits Serine Technique, Dilution Thapsigargin Triton X-100 Tunicamycin

Quantitative RT-PCR Analysis of UPR Genes

Cited 11 times

Total cellular RNA was isolated either by RNeasy (Qiagen, Valencia, California, United States) or Trizol reagent (Invitrogen). For Xbp1 RT-PCR, the Titan One-Tube RT-PCR kit (Roche) was used along with primers flanking the Xbp1 intron to amplify both spliced and unspliced Xbp1. Real-time RT-PCR was performed by first generating cDNAs using the iScript kit (Bio-Rad), which uses random primers. cDNA was then diluted (the extent varied based on the amount of starting RNA) and amplified by PCR in an iCycler (Bio-Rad) using iQ SYBR Green Supermix (Bio-Rad). For each primer set used, a dilution series of cDNA was first established to verify that amplification efficiency was near 100%, and to establish the linear range for the primer pair. Reaction products were separated by DNA electrophoresis to confirm that the amplified product was the correct size. For real-time reactions, a melt-curve analysis was performed at the end of the reaction to confirm the amplification of a single product with no primer dimers. Real-time reactions also included a control where no reverse transcriptase was included in the cDNA synthesis reaction, to exclude amplification of genomic DNA. Each primer pair was designed to span an intron. Primer pairs used were: 18S rRNA: cgcttccttacctggttgat and gagcgaccaaaggaaccata; Chop: ctgcctttcaccttggagac and cgtttcctggggatgagata; Gadd34: gagattcctctaaaagctcgg and cagggacctcgacggcagc; β-actin: gatctggcaccacaccttct and ggggtgttgaaggtctcaaa; BiP: catggttctcactaaaatgaaagg and gctggtacagtaacaactg; Grp94: aatagaaagaatgcttcgcc and tcttcaggctcttcttctgg; Atf4: atggccggctatggatgat and cgaagtcaaactctttcagatccatt; p58^IPK: tcctggtggacctgcagtacg and ctgcgagtaatttcttcccc; and Uggt1: gctttggtgtgaaacgtg and cagtttgggctccttagtc. Although the absolute extent of up-regulation for any gene varied somewhat from experiment to experiment, the trends of their expression changes were consistent.

Rutkowski D.T., Arnold S.M., Miller C.N., Wu J., Li J., Gunnison K.M., Mori K., Sadighi Akha A.A., Raden D, & Kaufman R.J. (2006). Adaptation to ER Stress Is Mediated by Differential Stabilities of Pro-Survival and Pro-Apoptotic mRNAs and Proteins. PLoS Biology, 4(11), e374.

Publication 2006

Actins Anabolism ATF4 protein, human Cells DDIT3 protein, human DNA, Complementary Electrophoresis Genes Genome GRP94 Introns Oligonucleotide Primers Real-Time Polymerase Chain Reaction Reverse Transcriptase Polymerase Chain Reaction RNA, Ribosomal, 18S RNA-Directed DNA Polymerase SYBR Green I Technique, Dilution trizol X-box binding protein 1, human

Generating Tissue-Specific Knockout Mice

Cited 10 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2008

Alleles ATF4 protein, human Blastocyst Chimera Cloning Vectors Embryonic Stem Cells Genes HTR1B protein, human HTR2A protein, human Mice, Laboratory Mutation Neomycin Osteoblasts RUNX2 protein, human TPH1 protein, human villin

HeLa Cell Knockdown and Rescue Assay

Cited 9 times

For knockdowns, 2 × 10⁵ HeLa cells were seeded into six-well plates, and 24 h later the cells were transiently transfected using Dogtor (OZ Biosciences). For single factor knockdowns, 400 ng of pSUPERpuro plasmids expressing shRNAs against UPF1, SMG6, SMG7, or control plasmids were transfected. For the knockdown and rescue conditions, 400 ng pcDNA3-NG-UPF1-WT-Flag, pcDNA3-SMG6-FLAG, or pcDNA3-SMG7-Flag were included in the transfection mixtures. For double knockdown experiments, 400 ng of each pSUPERpuro plasmid was added and the rescue of each factor was achieved by including 400 ng of pcDNA3-SMG6-Flag or pcDNA3-SMG7-Flag accordingly. The cells were split into a T25-cm² cell culture flask and selected with puromycin at a concentration of 1.5 µg/µL. Twenty-four hours prior to harvesting the cells were washed with PBS and the puromycin-containing medium was exchanged with normal DMEM–FCS medium. Cells were harvested 4 d after transfection.
The shRNA target sequence for UPF1 and SMG6 were described in Paillusson et al. (2005) (link) and SMG7 was described in Metze et al. (2013) (link). Total RNA was extracted using the GenElute Mammalian Total RNA Miniprep Kit (Sigma-Aldrich).
Cell harvesting for protein samples (derived from the same sample as RNA preparation) and measurement of relative mRNA levels by reverse transcription quantitative polymerase chain reaction (RT-qPCR) were done as described in Nicholson et al. (2012) . Briefly, 2 × 10⁵ cell equivalents were analyzed on a 10% PAGE, and detection was performed using Anti-RENT1 (UPF1) (Bethyl, A300–038A), anti- EST1 (SMG6) (Abcam, ab87539), Anti-SMG7 (Bethyl, A302–170A), and Anti-CPSF73 (custom made) antibodies.
qPCR assays have been described elsewhere (Yepiskoposyan et al. 2011 (link)), except for the assays to measure the following genes: GAS5 (5′-GCACCTTATGGACAGTTG-3′, 5′-GGAGCAGAACCATTAAGC-3′); CDKN1A (5′-GACCAGCATGACAGATTTCTAC3′, 5′-CAAACTGAGACTAAGGCAGAAG); ΤΜΕΜ183Α (5′-TGCTCCGGCCGAGTGA-3′, 5′-ACCGCCGGATCCGAGTT-3′); RP9P (5′- CAAGCGCCTGGAGTCCTTAA-3′, 5′-AGGAGGTTTTTCATAACTCGTGATCT-3′); GADD45B (5′-TCAACATCGTGCGGGTGTCG-3′, 5′-CCCGGCTTTCTTCGCAGTAG-3′); ATF4 (5′-TCAACATCGTGCGGGTGTCG-3′, 5′-CCCGGCTTTCTTCGCAGTAG-3′).
A total of 33 samples were sequenced: control knockdowns (Ctrl) in six replicates, all other conditions in triplicates. The TruSeq Stranded mRNA kit (chemistry v3) was used in the preparation of the library and in the poly(A) enrichment step. The first batch was sequenced on an Illumina HiSeq2500 and the second on an Illumina HiSeq3000 machine. Reads are single-end and 100 bp long. The sequencing depth of every sample is reported in Supplemental Table S4.

Colombo M., Karousis E.D., Bourquin J., Bruggmann R, & Mühlemann O. (2017). Transcriptome-wide identification of NMD-targeted human mRNAs reveals extensive redundancy between SMG6- and SMG7-mediated degradation pathways. RNA, 23(2), 189-201.

Publication 2017

Antibodies ATF4 protein, human Biological Assay CDKN1A protein, human cDNA Library Cell Culture Techniques Cells Genes HeLa Cells Mammals Plasmids Poly A Proteins Puromycin Reverse Transcriptase Polymerase Chain Reaction RNA, Messenger Short Hairpin RNA Transfection

Immunohistochemical Analysis of Aortic Specimens

Cited 9 times

Mouse aorta and human specimens were fixed in 10% formalin, embedded in paraffin and sectioned at 5 µm thickness. Immunohistochemical staining was performed as described elsewhere 14, 15. Briefly, sections were treated with xylene to remove the paraffin and were rehydrated, incubated with 3% H₂O₂ for 10 min at room temperature and washed three times with phosphate‐buffered saline (PBS). Then the sections were blocked with serum for 30 min and incubated with primary antibodies against ATF4 (Abcam, Cambridge, MA, USA; 1:200 dilution), proliferating cell nuclear antigen (PCNA; Abcam; 1:200 dilution ), α‐smooth muscle actin (α‐SMA; Sigma; 1:500 dilution), CHOP (Santa Cruz Biotechnology, CA, and Cell Signaling Technology, Danvers, USA; 1:200 dilution), cleaved‐caspase 3 (Cell Signaling Technology; 1:300 dilution), F4/80 (Abcam; 1:100 dilution), Mac‐2 (Santa Cruz; 1:200 dilution) and immunoglobulin G (IgG) control (Santa Cruz), then the sections were incubated with the ChemMate^TM EnVision^TM System (Dako, Glostrup, Denmark). Images were captured and further analysed using ImageProPlus 3.0 (ECIPSE80i/90i).
For cryostat sections, mouse aorta samples were fixed in 4% paraformaldehyde, embedded in optimum cutting temperature (OCT) compound, frozen in liquid nitrogen and stored at −80 °C until sectioning. Apoptotic cells were identified using DeadEnd Fluorometric TUNEL (Promega, Madison, WI). TUNEL and α‐SMA or F4/80 double staining was performed to detect apoptotic SMCs or apoptotic macrophages before confocal fluorescence microscopy analysis (Leica Microsystems, Buffalo Grove, IL, USA).

Jia L., Zhang W., Zhang H., Li T., Wang Y., Qin Y., Gu H, & Du J. (2015). Mechanical stretch‐induced endoplasmic reticulum stress, apoptosis and inflammation contribute to thoracic aortic aneurysm and dissection. The Journal of Pathology, 236(3), 373-383.

Publication 2015

Actins Antibodies Aorta Apoptosis ATF4 protein, human Buffaloes Caspase 3 Cells DDIT3 protein, human Fluorescence Fluorometry Formalin Freezing Homo sapiens Immunoglobulin G In Situ Nick-End Labeling Macrophage Microscopy, Confocal Mus Nitrogen Paraffin Paraffin Embedding paraform Peroxide, Hydrogen Phosphates Proliferating Cell Nuclear Antigen Promega Saline Solution Serum Smooth Muscles Technique, Dilution Xylene

Most recents protocols related to «ATF4 protein, human»

Targeting ADAR1 in High Interferon Tumors

Not available on PMC !

Example 17

Since interferon signaling is spontaneously activated in a subset of cancer cells and exposes potential therapeutic vulnerabilities, it was tested whether there is evidence for similar endogenous interferon activation in primary human tumors. An IFN-GES threshold was computed to predict ADAR dependency across the CCLE cell lines and was determined to be a z-score above 2.26 (FIG. 66, panel A). This threshold was applied to The Cancer Genome Atlas (TCGA) tumors, to identify primary cancers with similarly high interferon activation. Restricting the analysis to the 4,072 samples analyzed by TCGA with at least 70% tumor purity as estimated by the ABSOLUTE algorithm (Carter et al. (2012) Nat. Biotechnol. 30:413-421), 2.7% of TCGA tumors displayed IFN-GESs above this threshold (FIG. 66, panel B and. GSEA of amplified genes in these high purity, high interferon tumors revealed the top pathway as “Type I Interferon Receptor Binding”, comprising 17 genes that all encode type I interferons and are clustered on chromosome 9p21.3 (FIG. 67).

Furthermore, analysis of TCGA copy number data showed that the interferon gene cluster including IFN-β (IFNβI), IFN-ε (IFNE), IFN-ω (IFNWI), and all 13 subtypes of IFN-α on chromosome 9p21.3, proximal to the CDKN2A/CDKN2B tumor suppressor locus, is one of the most frequently homozygously deleted regions in the cancer genome. The interferon genes comprise 16 of the 26 most frequently deleted coding genes across 9,853 TCGA cancer specimens for which ABSOLUTE copy number data are available (FIG. 66, panels C and D). Interferon signaling and activation, both in tumors with high IFN-GESs or deletions in chromosome 9p, therefore represent a biomarker to stratify patients who benefit from interferon modulating therapies.

In summary, specific cancer cell lines have been identified with elevated IFN-β signaling triggered by an activated cytosolic DNA sensing pathway, conferring dependence on the RNA editing enzyme, ADAR1. In cells with low, basal interferon signaling, the cGAS-STING pathway is inactive and PKR levels are reduced (FIG. 68, panel A). Upon cGAS-STING activation, interferon signaling and PKR protein levels are elevated but ADAR1 is still able to suppress PKR activation (FIG. 68, panel B). However, once ADAR1 is deleted, the abundant PKR becomes activated and leads to downstream signaling and cell death (FIG. 68, panel C). This is also shown in normal cells lines (e.g. A549 and NCI-H1437) once exogenous interferon is introduced (FIG. 68, panel D). ADAR1 deficiency in cell lines with high interferon levels, whether from endogenous or exogenous sources, led to phosphorylation and activation of PKR, ATF4-mediated gene expression, and apoptosis. Recent studies have shown that cGAS activation and innate interferon signaling, induced by cytosolic DNA released from the nucleus by DNA damage and genome instability (Mackenzie et al. (2017) Nature 548:461-465; Harding et al. (2017) Nature 548:466-470), led to elevated interferon-related gene expression signatures, which have been linked to resistance to DNA damage, chemotherapy, and radiation in cancer cells (Weichselbaum et al. (2008) Proc. Natl. Acad. Sci. USA 105:18490-18495). In high-interferon tumors, blocking ADAR1 might be effective to induce PKR-mediated apoptotic pathways while upregulating type I interferon signaling, which could contribute to anti-tumor immune responses (Parker et al. (2016) Nature 16:131-144). Alternatively, in tumors without activated interferon signaling, ADAR1 inhibition can be combined with localized interferon inducers, such as STING agonists, chemotherapy, or radiation. Generation of specific small molecule inhibitors targeting ADAR1 exploits this novel vulnerability in lung and other cancers and serves to enhance innate immunity in combination with immune checkpoint inhibitors.

US11873486B2. Modulating dsRNA editing, sensing, and metabolism to increase tumor immunity and improve the efficacy of cancer immunotherapy and/or modulators of intratumoral interferon (2024-01-16). Dana-Farber Cancer Institute, Inc. [US]. Inventors: Matthew Meyerson [US], William N. Haining [US], Jeffrey Ishizuka [US], Robert Manguso [US], Hugh Gannon [US].

Patent 2024

agonists Apoptosis ATF4 protein, human Biological Markers CDKN2A Gene Cell Death Cell Lines Cell Nucleus Cells Chromogranin A Chromosome Deletion Chromosomes, Human, Pair 3 Cytosol DNA Damage Electromagnetic Radiation Enzymes Gene, Cancer Gene Clusters Gene Expression Genes Genome Genomic Instability Homo sapiens IFNAR2 protein, human Immune Checkpoint Inhibitors Immunity, Innate inhibitors Interferon-alpha Interferon Inducers interferon omega 1 Interferons Interferon Type I Lung Malignant Neoplasms Neoplasms Oncogenes Patients Pharmacotherapy Phosphorylation Proteins Psychological Inhibition Response, Immune Tumor Suppressor Genes

Western Blot Analysis of Cellular Signaling

After the LPS and oridonin treatment for 24 h, cells from each group were collected and lysed on ice for 20 min by adding RIPA lysate (Solarbio). Next, the lysed cells were centrifuged at 10,000 rpm, 4 °C for 15 min to collect proteins and the protein concentrations were detected through a BCA kit (Solarbio). There was 30 μg of protein taken and denatured at 95 °C for 15 min with addition of the protein loading buffer. Later, the protein bands were separated by SDS PAGE electrophoresis, and then the protein was transferred to PVDF membranes and blocked in 5% skimmed milk blocking solution for 1–3 h. Subsequently, the membranes were washed three times in TBST buffer and then incubated overnight at 4 °C on a shaker with the addition of diluted primary antibodies (p65, ab16502, Abcam; p-p65, ab76302, Abcam; NLRP3, ab263899, Abcam; Caspase-1, ab138483, Abcam; GRP78, ab21685, Abcam; CHOP, #5554, CST; ATF4, ab184909, Abcam; ATF6, ab122897, Abcam; β-actin, ab6276, Abcam, UK). Afterwards, the membranes were washed with TBST twice, and diluted secondary antibody (Zhongshan Golden Bridge Biotechnology Co., Ltd., China) was added for 1-h incubation at ambient temperature. Again, the membranes were washed with TBST three times, and ECL hypersensitive luminescence solution (Solarbio) was added dropwise to develop the protein bands in a gel imager for photography. The protein bands were measured in grayscale employing Image J software and finally, the relative expression level of the target protein was analyzed with β-actin as an internal control.

Jiang J., Zhang N., Song H., Yang Y., Li J, & Hu X. (2023). Oridonin alleviates the inhibitory effect of lipopolysaccharide on the proliferation and osteogenic potential of periodontal ligament stem cells by inhibiting endoplasmic reticulum stress and NF-κB/NLRP3 inflammasome signaling. BMC Oral Health, 23, 137.

Publication 2023

Actins activating transcription factor 6, human Antibodies ATF4 protein, human Buffers Caspase 1 Cells DDIT3 protein, human Electrophoresis Glucose Regulated Protein 78 kDa Hypersensitivity Immunoglobulins Luminescence Milk, Cow's oridonin polyvinylidene fluoride Proteins Protein Targeting, Cellular Radioimmunoprecipitation Assay SDS-PAGE Staphylococcal Protein A Tissue, Membrane

Transcriptional Profiling of Erythroblast Development

Total RNAs were isolated from cultured erythroblast cells on days 6, 8 10, 12, and 14 using TRIzol reagent (Invitrogen) and converted intocomplementary DNAs (cDNAs) using SuperScript III reverse transcriptase with oligo-dT primer (Invitrogen).
The synthesized cDNAs were quantified with specific primers for HBS1L transcripts using SYBR master mix (Applied Biosystems) according to the manufacturer’s recommended conditions. Expression of α-, β-, and γ-globin was measured by SYBR green-based qPCR using primer sequences [19 (link)]. Quantitative PCR was performed on CFX96™ Real-Time system (Bio-Rad). The expression of α-, β-, and γ-globin mRNA in shNTC and shHBS1L transduced cells were calculated by 2^-ΔΔCt methods relative to untransduced (UNT) control as described below.
In comparison to untransduced cells, the abundance of the mRNAs for the following erythroid-related transcription factors, namely BCL11A, ZBTB7A, KLF1, GATA1, GATA2, MYB, and ATF4, was measured and displayed as a fold change [20 (link)]. The primer sequences utilized in this study are listed in S2 Table.

Chumchuen S., Sripichai O., Jearawiriyapaisarn N., Fucharoen S, & Peerapittayamongkol C. (2023). Induction of fetal hemoglobin: Lentiviral shRNA knockdown of HBS1L in β0-thalassemia/HbE erythroid cells. PLOS ONE, 18(3), e0281059.

Publication 2023

ATF4 protein, human BCL11A protein, human Cells Cultured Cells DNA DNA, Complementary Erythroblasts GATA1 protein, human GATA2 protein, human Globin KLF1 protein, human oligo (dT) Oligonucleotide Primers RNA RNA, Messenger RNA-Directed DNA Polymerase SYBR Green I trizol ZBTB7A protein, human

RASSF1 Luciferase Reporter Assay

HEK293FT cells were co‐transfected with the RASSF1 luciferase reporter plasmid, and pRK‐ATF4 expression plasmid [53 (link)] (a gift from Yihong Ye; Addgene plasmid # 26114; http://n2t.net/addgene:26114; RRID: Addgene_26114) or pRK‐ATF4 ΔC (1–275) expression plasmid [53 (link)] (a gift from Yihong Ye, Addgene plasmid # 26118; http://n2t.net/addgene:26118; RRID: Addgene_26118) using Lipofectamine 3000 transfection reagent (Invitrogen) according to the manufacturer's protocol. Luciferase activity in cell lysates was measured using luciferase assay system (Promega, Madison, MI, USA). Luciferase activity was normalized by the amount of the total protein.

Zhang Y., Huynh‐Dam K., Ding X., Sikirzhytski V., Lim C., Broude E, & Kiaris H. (2023). RASSF1 is identified by transcriptome coordination analysis as a target of ATF4. FEBS Open Bio, 13(3), 556-569.

Publication 2023

ATF4 protein, human Biological Assay Cells Lipofectamine Luciferases Plasmids Promega Proteins Transfection

Chromatin Immunoprecipitation (ChIP) Assay

Chromatin immunoprecipitation (ChIP) assay was performed using the ChIP kit (Abcam, Waltham, MA, USA; ab500) according to the supplied protocol. Briefly, HEK293FT cells were exposed to 5 μg·mL⁻¹ tunicamycin (Sigma‐Aldrich) for 5 h, cross‐linked with 1.1% formaldehyde (Thermo Scientific, Waltham, MA, USA; Cat# 28906) for 10 min at room temperature, and quenched in 0.125 m glycine. The cells were then incubated with lysis buffer and sonicated to produce 200–500 base pair DNA fragments. DNA fragments were immunoprecipitated from the cell lysates using anti‐ATF4 antibody (Abcam; ab184909) or rabbit IgG (Abcam; ab171870), and immunoprecipitates were recovered by the addition of DNA purifying slurry. After reverse crosslinking and washing, purified DNA was quantified by SYBR Green real‐time PCR (Bio‐Rad, Hercules, CA, USA) using specific primers (Table 2). The samples added rabbit IgG was used as a control. Data were expressed as the percentage of input.

Publication 2023

Antibodies, Anti-Idiotypic ATF4 protein, human Base Pairing Biological Assay Buffers Cells Formaldehyde Glycine Immunoprecipitation, Chromatin Oligonucleotide Primers Rabbits Real-Time Polymerase Chain Reaction SYBR Green I Tunicamycin

Top products related to «ATF4 protein, human»

Eif2α by Cell Signaling Technology

Sourced in United States, United Kingdom, China

EIF2α is a protein that plays a key role in the regulation of protein synthesis initiation. It functions as a subunit of the eukaryotic translation initiation factor 2 (eIF2) complex, which is involved in the binding of the initiator methionyl-tRNA to the 40S ribosomal subunit.

P eif2α by Cell Signaling Technology

Sourced in United States, United Kingdom, Germany

P-eIF2α is a phospho-specific antibody that detects phosphorylation of the eIF2α (Ser51) protein. eIF2α is a subunit of the eukaryotic translation initiation factor 2 complex, and its phosphorylation is a key regulatory mechanism in the cellular stress response.

β actin by Merck Group

Sourced in United States, United Kingdom, Germany, China, Canada, Japan, Macao, Italy, Sao Tome and Principe, Israel, Spain, Denmark, France, Finland, Australia, Morocco, Ireland, Czechia, Sweden, Uruguay, Switzerland, Netherlands, Senegal

β-actin is a protein that is found in all eukaryotic cells and is involved in the structure and function of the cytoskeleton. It is a key component of the actin filaments that make up the cytoskeleton and plays a critical role in cell motility, cell division, and other cellular processes.

Lipofectamine 2000 by Thermo Fisher Scientific

Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco

Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.

Trizol reagent by Thermo Fisher Scientific

Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand

TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.

P erk by Cell Signaling Technology

Sourced in United States, United Kingdom, China, Japan, Canada, Germany, Denmark, Macao

P-ERK is a phospho-specific antibody that recognizes the phosphorylated form of Extracellular Signal-Regulated Kinase (ERK). ERK is a key component of the MAPK signaling pathway, which plays a crucial role in cellular processes such as proliferation, differentiation, and survival. The P-ERK antibody can be used to detect the activated, phosphorylated state of ERK in various experimental applications.

Anti atf4 by Cell Signaling Technology

Sourced in United States, China

Anti-ATF4 is a primary antibody product that specifically binds to the activating transcription factor 4 (ATF4) protein. ATF4 is a transcription factor involved in the cellular stress response pathway.

Cleaved caspase 3 by Cell Signaling Technology

Sourced in United States, United Kingdom, China, Germany, Canada, Japan, Morocco, Denmark, Switzerland, France, Netherlands, Macao

Cleaved caspase-3 is an antibody that detects the activated form of caspase-3 protein. Caspase-3 is a key enzyme involved in the execution phase of apoptosis, or programmed cell death. The cleaved caspase-3 antibody specifically recognizes the active, cleaved form of the enzyme and can be used to monitor and quantify apoptosis in experimental systems.

Rneasy mini kit by Qiagen

Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway

The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.

Pvdf membrane by Merck Group

Sourced in United States, Germany, China, United Kingdom, Morocco, Ireland, France, Italy, Japan, Canada, Spain, Switzerland, New Zealand, India, Hong Kong, Sao Tome and Principe, Sweden, Netherlands, Australia, Belgium, Austria

PVDF membranes are a type of laboratory equipment used for a variety of applications. They are made from polyvinylidene fluoride (PVDF), a durable and chemically resistant material. PVDF membranes are known for their high mechanical strength, thermal stability, and resistance to a wide range of chemicals. They are commonly used in various filtration, separation, and analysis processes in scientific and research settings.

What is the role of the ATF4 protein in human cells?

The ATF4 protein is a transcription factor that plays a crucial role in the cellular stress response pathways in humans. It is involved in regulating genes related to amino acid metabolism, antioxidant response, and apoptosis. ATF4 helps cells adapt to various stressful conditions, such as amino acid deprivation, endoplasmic reticulum stress, and oxidative stress, by inducing the expression of target genes that promote cell survival or, in some cases, programmed cell death. ATF4 has been implicated in the pathogenesis of several diseases, including neurodegenerative disorders, cancer, and metabolic diseases, making it an important target for research and potential therapeutic interventions.

What are the different variations or types of ATF4 protein?

The ATF4 protein is a single gene product, and there are no known major variations or types of the ATF4 protein in humans. However, the activity and expression of ATF4 can be modulated by various post-translational modifications, such as phosphorylation, ubiquitination, and acetylation, which can affect its stability, localization, and transcriptional activity. Additionally, ATF4 can form heterodimers with other bZIP transcription factors, which can influence its binding specificity and target gene regulation.

What are the specific applications of the ATF4 protein in research and clinical settings?

The ATF4 protein has several important applications in research and clinical settings: 1. Understanding cellular stress response pathways: Studying the regulation and function of ATF4 helps elucidate the complex cellular mechanisms involved in responding to various stressors, such as nutrient deprivation, endoplasmic reticulum stress, and oxidative stress. 2. Disease pathogenesis and biomarker development: Given ATF4's involvement in the pathogenesis of diseases like neurodegenerative disorders, cancer, and metabolic diseases, it can serve as a potential biomarker and therapeutic target for these conditions. 3. Drug discovery and development: Modulators of ATF4 activity, such as small molecules or biologics, can be explored as potential therapeutic interventions for ATF4-related diseases. 4. Cell and tissue engineering: Understanding the role of ATF4 in regulating cellular stress response pathways can inform the development of engineered cells and tissues with improved resilience and survival under stressful conditions.

How can PubCompare.ai assist in the optimal use and comparison of ATF4 protein, human?

PubCompare.ai can assist in the optimal use and comparison of ATF4 protein, human in several ways: 1. Screeing protocol literature more efficiently: The platform's advanced search and analysis capabilities can help researchers quickly identify the most relevant protocols and studies related to ATF4 protein, human from the vast pool of scientific literature. 2. Leveraging AI to pinpoint critical insights: PubCompare.ai's AI-driven analysis can highlight key differences in protocol effectiveness, enabling researchers to choose the best option for reproducibility and accuracy in their ATF4 protein, human studies. 3. Identifying the most effective protocols: The platform can help researchers locate the most effective protocols and products related to ATF4 protein, human based on their specific research goals, ensuring they have access to the most reliable and up-to-date information. By utilizing PubCompare.ai, researchers can streamline their ATF4 protein, human research, improve the quality and reproducibility of their experiments, and accelerate the pace of their discoveries.

More about "ATF4 protein, human"

Discover the critical role of Activating Transcription Factor 4 (ATF4), a bZIP transcription factor, in cellular stress response pathways.
ATF4 is activated in response to various stimuli, such as amino acid deprivation, endoplasmic reticulum (ER) stress, and oxidative stress, and plays a crucial part in regulating genes related to amino acid metabolism, antioxidant response, and apoptosis.
Understand how ATF4 helps cells adapt to these stressful conditions by inducing the expression of target genes that promote cell survival or, in some cases, programmed cell death.
Explore the regulatory mechanisms and functional roles of ATF4, which has been implicated in the pathogenesis of several diseases, including neurodegenerative disorders, cancer, and metabolic diseases.
This makes ATF4 an important target for research and potential therapeutic interventions.
Discover how PubCompare.ai, an AI-driven platform, can optimize your ATF4 research by helping you locate the best protocols and products from literature, pre-prits, and patents.
Our advanced comparisons ensure reproducibility and accuracy, elevating your ATF4 studies.
Learn about the key molecules and techniques involved in ATF4 research, such as EIF2α, P-eIF2α, β-actin, Lipofectamine 2000, TRIzol reagent, P-ERK, Anti-ATF4, Cleaved caspase-3, and RNeasy Mini Kit.
Leverage these insights to design robust experiments and unlock new frontiers in the understanding of ATF4 and its role in cellular stress response pathways.