Avidin-horseradish peroxidase complex

Protein expression and purification. Recombinant Spike and RBD for ELISA were expressed and purified as previously described (Seow et al., 2020 (link)). Recombinant S1 (residues 1-530) and NTD (residues 1-310) expression and purification was described in Rosa et al. (Rosa et al., 2021 ). S2 protein was obtained from SinoBiological (Cat number: 40590-V08B).
For antigen-specific B cell sorting, Spike glycoprotein consisted of the pre-fusion S ectodomain (residues 1–1138) with a GGGG substitution at the furin cleavage site (amino acids 682–685), proline substitutions at amino acid positions 986 and 987, and an N-terminal T4 trimerization domain. Spike was cloned into a pHLsec vector containing Avi and 6xHis tags (Aricescu et al., 2006 (link)). Biotinylated Spike was expressed in 1L of HEK293F cells (Thermofisher Scientific) at a density of 1.5 × 10⁶ cells/mL. To achieve in vivo biotinylation, 480μg of Spike plasmid was co-transfected with 120μg of BirA (Howarth et al., 2008 (link)) and 12mg PEI-Max (1 mg/mL solution, Polysciences) in the presence of 200 μM biotin (final concentration). The supernatant was harvested after 7 days and purified using immobilized metal affinity chromatography and size-exclusion chromatography. Complete biotinylation was confirmed via depletion of protein using avidin beads.
Spike mutagenesis. SARS-CoV-2 mutants and the B.1.1.7 variant were previously reported (Rees-Spear et al., 2021 (link)). SARS-CoV-2 Spike D614G+ΔY144 (Forward primer CATAAGAACAACAAGAGC, Reverse primer ATAAACACCCAGGAAAGG) and B.1.1.7+E484K (Forward primer TAATGGCGTGAAGGGCTTCAATTGCTACTTC, Reverse primer CACGGTGTGCTGCCGGCC) were generated with Q5® Site-Directed Mutagenesis Kit (NEB, E0554) following the manufacturer’s instructions.
ELISA (S, RBD, NTD, S2 or S1). 96-well plates (Corning, 3690) were coated with S, S1, NTD, S2 or RBD at 3 μg/mL overnight at 4°C. The plates were washed (5 times with PBS/0.05% Tween-20, PBS-T), blocked with blocking buffer (5% skimmed milk in PBS-T) for 1 h at room temperature. Serial dilutions of serum, plasma, mAb or supernatant in blocking buffer were added and incubated for 2 h at room temperature. Plates were washed (5 times with PBS-T) and secondary antibody was added and incubated for 1 h at room temperature. IgM was detected using Goat-anti-human-IgM-HRP (horseradish peroxidase) (1:1,000) (Sigma: A6907) and IgG was detected using Goat-anti-human-Fc-AP (alkaline phosphatase) (1:1,000) (Jackson: 109-055-098). Plates were washed (5 times with PBS-T) and developed with either AP substrate (Sigma) and read at 405 nm (AP) or 1-step TMB (3,3',5,5'-Tetramethylbenzidine) substrate (Thermo Scientific) and quenched with 0.5 M H₂S0₄ before reading at 450 nm (HRP).
Fab/Fc ELISA. 96-well plates (Corning, 3690) were coated with goat anti-human Fc IgG antibody at 3 μg/mL overnight at 4°C. The above protocol was followed. The presence of IgG in supernatants was detected using Goat-anti-human-Fc-AP (alkaline phosphatase) (1:1,000) (Jackson: 109-055-098).
IgG digestion to generate F(ab’)₂. IgG were incubated with IdeS (Dixon, 2014 ) (4 μg of IdeS per 1 mg of IgG) in PBS for 1 h at 37°C. The Fc and IdeS were removed using a mix of Protein A Sepharose® Fast Flow (250 μL per 1 mg digested mAb; GE Healthcare Life Sciences) and Ni Sepharose 6 Fast Flow (50 μL per 1 mg digested mAb; GE Healthcare Life Sciences) which were washed twice with PBS before adding to the reaction mixture. After exactly 10 min the beads were removed from the F(ab’)₂-dilution by filtration in Spin-X tube filters (Costar®) and the filtrate was concentrated in Amicon® Ultra Filters (10k, Millipore). Purified F(ab’)₂ fragments were analyzed by SDS-PAGE.
F(ab’)₂and IgG competition ELISA. 96-well half area high bind microplates (Corning®) were coated with Spike protein at 3 μg/mL in PBS overnight at 4°C. Plates were washed (5 times with PBS/0.05% Tween-20, PBS-T) and blocked with 5% milk in PBS/T for 2 h at room temperature. Serial dilutions (5-fold) of F(ab’)₂, starting at 100-molar excess of the IC₈₀ of S binding, were added to the plates and incubated for 1 h at room temperature. Plates were washed (5 times with PBS-T) before competing IgG was added at their IC₈₀ of S binding and incubated at room temperature for 1 h. Plates were washed (5 times with PBS-T) and Goat-anti-human-Fc-AP (alkaline phosphatase) (1:1,000) (Jackson: 109-055-098) was added and incubated for 45 min at room temperature. The plates were washed (5 times with PBS-T) and AP substrate (Sigma) was added. Optical density was measured at 405 nm in 5-min intervals. The percentage competition was calculated as the reduction in IgG binding in the presence of F(ab’)₂ (at 100-molar excess of the IC₈₀) as a percentage of the maximum IgG binding in the absence of F(ab’)₂. Competition groups were determined using Ward2 clustering (R, Complex Heatmap package (Gu et al., 2016 (link))) for initial analysis and Groups were then arranged according to binding epitopes.
SARS-CoV-2 (wild-type and mutants) and SARS-CoV pseudotyped virus preparation. Pseudotyped HIV-1 virus incorporating the SARS-Cov-2 wild-type or mutants (D614G, N501Y, D614G+Δ69/70, D614G+ΔY144, B.1.1.7 and B.1.1.7+E484K) or SARS-CoV full-length Spike (Winstone et al., 2021 (link)) was produced in a 10 cm dish seeded the day prior with 5x10⁶ HEK293T/17 cells in 10 mL of complete Dulbecco’s Modified Eagle’s Medium (DMEM-C, 10% fetal bovine serum (FBS) and 1% Pen/Strep (100 IU/mL penicillin and 100 mg/mL streptomycin)). Cells were transfected using 90 μg of PEI-Max (1 mg/mL, Polysciences) with: 15 μg of HIV-luciferase plasmid, 10 μg of HIV 8.91 gag/pol plasmid (Zufferey et al., 1997 (link)) and 5 μg of SARS-CoV-2 spike protein plasmid (Grehan et al., 2015 (link); Thompson et al., 2020 ). Pseudotyped virus was harvested after 72 h, filtered through a 0.45mm filter and stored at −80°C until required.
Neutralization assay with SARS-CoV-2 (wild-type and mutants) and SARS-CoV pseudotyped virus. Neutralization assays were conducted as previously described (Carter et al., 2020 (link)). Serial dilutions of serum samples (heat inactivated at 56°C for 30mins) or mAbs were prepared with DMEM-C media and incubated with pseudotyped virus for 1 h at 37°C in 96-well plates. Next, HeLa cells stably expressing the ACE2 receptor (provided by Dr James Voss, Scripps Research, La Jolla, CA) were added (12,500 cells/50μL per well) and the plates were left for 72 h. The amount of infection was assessed in lysed cells with the Bright-Glo luciferase kit (Promega), using a Victor X3 multilabel reader (Perkin Elmer). Measurements were performed in duplicate and duplicates used to calculate the IC₅₀ or ID₅₀.
Infectious virus strain and propagation. Vero-E6 cells (Cercopithecus aethiops derived epithelial kidney cells, provided by Prof Wendy Barclay, Imperial College London) cells were grown in Dulbecco’s modified Eagle’s medium (DMEM, GIBCO) supplemented with GlutaMAX, 10% fetal bovine serum (FBS), 20 μg/mL gentamicin, and incubated at 37°C with 5% CO₂. SARS-CoV-2 Strain England 2 (England 02/2020/407073) was obtained from Public Health England. The virus was propagated by infecting 60%–70% confluent Vero E6 cells in T75 flasks, at an MOI of 0.005 in 3 mL of DMEM supplemented with GlutaMAX and 10% FBS. Cells were incubated for 1 h at 37°C before adding 15 mL of the same medium. Supernatant was harvested 72 h post-infection following visible cytopathic effect (CPE), and filtered through a 0.22 μm filter, aliquoted and stored at −80C. The infectious virus titer was determined by plaque assay using Vero E6 cells.
Infectious virus neutralization assay. Vero-E6 cells were seeded at a concentration of 20,000 cells/100uL per well in 96-well plates and allowed to adhere overnight. Serial dilutions of mAbs were prepared with DMEM media (2% FBS and 1% Pen/Strep) and incubated with authentic SARS-CoV-2 for 1 h at 37°C. The media was removed from the pre-plated Vero-E6 cells and the serum-virus mixtures were added to the Vero E6 cells and incubated at 37°C for 24 h. The virus/serum mixture was aspirated, and each well was fixed with 150μL of 4% formalin at room temperature for 30 min and then topped up to 300μL using PBS. The cells were washed once with PBS and permeabilized with 0.1% Triton-X in PBS at room temperature for 15 min. The cells were washed twice with PBS and blocked using 3% milk in PBS at room temperature for 15 min. The blocking solution was removed and an N-specific mAb (murinized-CR3009 (van den Brink et al., 2005 (link))) was added at 2 μg/mL (diluted using 1% milk in PBS) at room temperature for 45 min. The cells were washed twice with PBS and horse-anti-mouse-IgG-conjugated to HRP was added (1:2000 in 1% milk in PBS, Cell Signaling Technology, S7076) at room temperature for 45 min. The cells were washed twice with PBS, developed using TMB substrate for 30 min and quenched using 2M H₂SO₄ prior to reading at 450 nm. Measurements were performed in duplicate.
Antigen-specific B cell sorting. Fluorescence-activated cell sorting of cryopreserved PBMCs was performed on a BD FACS Melody. Sorting baits (SARS-CoV-2 Spike) were pre-complexed with the streptavidin fluorophore at a 1:4 molar ratio prior to addition to cells. PBMCs were stained with live/dead (fixable Aqua Dead, Thermofisher), anti-CD3-APC/Cy7 (Biolegend), anti-CD8-APC-Cy7 (Biolegend), anti-CD14-BV510 (Biolegend), anti-CD19-PerCP-Cy5.5 (Biolegend), anti-IgM-PE (Biolegend), anti-IgD-Pacific Blue (Biolegend) and anti-IgG-PeCy7 (BD) and Spike-Alexa488 (Thermofisher Scientific, S32354) and Spike-APC (Thermofisher Scientific, S32362). Live CD3/CD8^-CD14^-CD19⁺IgM^-IgD^-IgG⁺Spike⁺Spike⁺ cells were sorted into individual wells containing RNase OUT (Invitrogen), First Strand SuperScript III buffer, DTT and H₂O (Invitrogen) and RNA was converted into cDNA (SuperScript III Reverse Transcriptase, Invitrogen) using random hexamers (Bioline Reagents Ltd) following the manufacturer’s protocol.
Full-length antibody cloning and expression. The human Ab variable regions of heavy and kappa/lambda chains were PCR amplified using previously described primers and PCR conditions (Scheid et al., 2009 (link); Tiller et al., 2008 (link); von Boehmer et al., 2016 (link)). PCR products were purified and cloned into human-IgG (Heavy, Kappa or Lambda) expression plasmids (von Boehmer et al., 2016 (link)) using the Gibson Assembly Master Mix (NEB) following the manufacturer’s protocol. Gibson assembly products were directly transfected into HEK293T cells and transformed under ampicillin selection. Ab supernatants were harvested 3 days after transfection and IgG expression and Spike-reactivity determined using ELISA and concentrated 30-times for use in neutralization assays. Ab variable regions of heavy-light chain pairs that generated Spike reactive IgG were sequenced by Sanger sequencing.
IgG expression and purification. Ab heavy and light plasmids were co-transfected at a 1:1 ratio into HEK293F cells (Thermofisher) using PEI Max (1 mg/mL, Polysciences, Inc.) at a 3:1 ratio (PEI Max:DNA). Ab supernatants were harvested five days following transfection, filtered and purified using protein G affinity chromatography following the manufacturer’s protocol (GE Healthcare).
Monoclonal antibody binding to Spike using flow cytometry. HEK293T cells were plated in a 6-well plate (2x10⁶ cells/well). Cells were transfected with 1 μg of plasmid encoding full-length SARS-CoV or SARS-CoV-2 full-length Spike and incubated for 48 h at 37°C. Post incubation cells were resuspended in PBS and plated in 96-well plates (1x10⁵ cells/well). Monoclonal antibodies were diluted in FACS buffer (1x PBS, 2% FBS, 1 mM EDTA) to 25 μg/mL and incubated with cells on ice for 1 h. The plates were washed twice in FACS buffer and stained with 50 μl/well of 1:200 dilution of PE-conjugated mouse anti-human IgG Fc antibody (BioLegend, 409304) on ice in dark for 1 h. After another two washes, stained cells were analyzed using flow cytometry, and the binding data were generated by calculating the percent (%) PE-positive cells using FlowJo 10 software.
ACE2 competition measured by flow cytometry. To prepare the fluorescent probe, 3.5 times molar excess of Streptavidin-PE (Thermofisher Scientific, S21388) was added to biotinylated SARS-CoV-2 Spike on ice. Additions were staggered over 5 steps with 30 min incubation times between each addition. Purified mAbs were mixed with PE conjugated SARS-CoV-2 S in a molar ratio of 4:1 in FACS buffer (2% FBS in PBS) on ice for 1 h. HeLa-ACE2 and HeLa cells were washed once with PBS and detached using PBS containing 5mM EDTA. Detached cells were washed and resuspended in FACS buffer. 0.5 million HeLa-ACE2 cells were added to each mAb-Spike complex and incubated on ice for 30 m. The cells were washed with PBS and resuspended in 200 μL FACS buffer with 1 μL of LIVE/DEAD Fixable Aqua Dead Cell Stain Kit (Invitrogen). HeLa and HeLa-ACE2 cells alone and with SARS-CoV-2 Spike only were used as background and positive controls, respectively. The geometric mean fluorescence for PE was measured from the gate of singlet and live cells. The ACE2 binding inhibition percentage was calculated with this equation: (Rogers et al., 2020 (link)) $\text{\%}ACE2bindinginhibition=100\text{∗}\left(1-\frac{samplegeometricmean-geomatricmeanofbackground}{geometricmeanofpositivecontrol-geometricmeanofbackground}\right)$
Monoclonal antibody sequence analysis. The heavy and light chain sequences of SARS-CoV-2 specific mAbs were examined using IMGT/V-QUEST(http://www.imgt.org/IMGT_vquest/vquest) to identify the germline usages, percentage of SHM and CDR region lengths. To remove variation introduced through cloning using mixture of forward primers, 5 amino acids or 15 nucleotides were trimmed from the start and end of the translated variable genes.

Isolated fresh brains were sliced into 4-mm thick tissue sections using the coronal plane as a reference and fixed in 4% paraformaldehyde for 72 h. Then, the fixed brain tissues were sequentially dehydrated in 15–30% sucrose solution, sliced further into 40-µm thick sections using a SM2000R microtome (Leica, Germany), and stored in ethylene glycol at -20 °C.
Subsequently, the sections were subjected to immunohistochemical staining. The primary and secondary antibodies used in this study were listed in Supplementary Table 2. Briefly, hydrogen peroxide was used to quench the activity of endogenous peroxidase. Citrate buffer was used for antigen repair. The sections were incubated with primary antibodies at 4°C for 16 h and then with horseradish peroxidase (HRP) -labeled secondary antibodies. The avidin-biotin-peroxidase complex (prepared from VECTASTAIN ABC Reagent kit) and substrate chromogen 3,3’-diaminobenzidine tetrahydrochloride hydrate (DAB) were used to visualize the immune complex. The whole brain images were captured under a VS200 Virtual Slide Microscope (Olympus, Japan).

LV tissue sections were blocked with 10% horse serum in phosphate-buffered saline (PBS), incubated with 8-hydroxydeoxyguanosine (8-OHdG) antibody (MilliporeSigma, Burlington, MA) and then incubated with biotin-conjugated anti-goat IgG (Vector Laboratory, Burlingame, CA). The sections were then incubated with avidin and biotinylated horseradish peroxidase macromolecular complex (ABC, Vector Laboratory), and stained with 3-amino-9-ethylcarbazole (AEC) and hematoxylin (Vector Laboratory). The samples were examined under a light microscope (AX 10, Zeiss). The area and intensity of staining were blinded to score for quantification as we have described^{50 (link)}.