Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > AVP protein, human

AVP protein, human

Arginine vasopressin (AVP) protein is a crucial hormone involved in regulating water balance, blood pressure, and other physiological processes.
AVP is produced in the hypothalamus and released by the posterior pitutart gland, playing a key role in osmoregulation and cardiovascular function.
Resaerch on AVP proteins is critical for understanding conditions like diabetes insipidus, syndrome of inappropriate antidiuretic hormone secretion, and cardiovascular disorders.
PubCompare.ai can optimize your AVP protein studies by helping you locate reliable experimental protocols, compare research approaches, and enhance reproducibility and accuracy in your investigations.

Most cited protocols related to «AVP protein, human»

1
Antiviral Peptide Sequence Database
Cited 14 times
We have screened several hundred research articles and patents indexed in Pubmed and Patent Lens, respectively, to retrieve AVP sequences. From more than 80 relevant articles; we have extracted 1245 peptide sequences with a reported antiviral activity against human viruses like HIV, HCV, SARS and Influenza, etc. About 150 AVP of our collection were also present in the existing antimicrobial databases (21 (link),22 (link)). Nearly 91% of the collected peptides were from natural source and remaining have synthetic source. Identical peptides were removed to finally have 604 highly effective and 452 least or non-effective AVPs which were used in the training T544p+407n (544 positive and 407 negative) and validation V60p+45n (60 positive and 45 negative) data sets, respectively. Simultaneously, we have made another training T544p+544n* and validation V60p+60n* data sets where non-experimental negative peptides [as employed in earlier antimicrobial peptide prediction method (23 (link))] were used in place of experimentally verified negative data set.
Thakur N., Qureshi A, & Kumar M. (2012). AVPpred: collection and prediction of highly effective antiviral peptides. Nucleic Acids Research, 40(Web Server issue), W199-W204.
Publication 2012
Antimicrobial Peptide Antiviral Agents AVP protein, human HIV Homo sapiens Influenza Lens, Crystalline Microbicides Peptides Severe Acute Respiratory Syndrome
2
Differential β-arrestin1 Binding Assay
Cited 9 times
β-arrestin1 was incubated with either non-phosphorylated V2 vasopressin peptide (V2Rnp) or V2Rpp in a 1:3 molar ratio for 30 min at 25 °C. Subsequently, purified Fabs were added at a 1:2 molar ratio with β-arrestin1 and incubated for additional 30 min at 25 °C. Then, pre-washed Protein A beads (Pierce) were added to the reactions and incubated for 30 min at 25 °C. The final concentration of β-arrestin1 in the binding reaction was 10 nM. Beads were washed 4 times with 1 ml buffer (20 mM HEPES pH 7.4, 150 mM NaCl) and proteins were eluted with SDS-PAGE gel loading buffer. The eluted proteins were run on a 4-20% SDS-PAGE gel. Fab30 displayed the greatest difference in its ability to co-immunoprecipitate β-arrestin1 between V2Rnp and V2Rpp and was therefore chosen for further characterization (Reis & Lefkowitz, manuscript in preparation).
Shukla A.K., Manglik A., Kruse A.C., Xiao K., Reis R.I., Tseng W.C., Staus D.P., Hilger D., Uysal S., Huang L.Y., Paduch M., Tripathi-Shukla P., Koide A., Koide S., Weis W.I., Kossiakoff A.A., Kobilka B.K, & Lefkowitz R.J. (2013). Structure of active β-arrestin1 bound to a G protein-coupled receptor phosphopeptide. Nature, 497(7447), 137-141.
Publication 2013
AVP protein, human Buffers HEPES Molar Peptides Proteins SDS-PAGE Sodium Chloride Staphylococcal Protein A
3
Quantifying Oxytocin in Bodily Fluids
Cited 6 times
Previous research has used un-extracted CSF samples to estimate OT concentration in rodents [35] (link), in primates [22] (link), , in human neonates [36] (link), and vasopressin concentration in humans [3] (link). We also used this approach in the present study. All samples were assayed for OT by enzyme-linked immunosorbent assay (ELISA) using a commercially available kit (Enzo Life Sciences, Farmingdale, NY). The kits have a sensitivity of 11.7 pg/mL with less than 0.2% cross-reactivity with vasopressin. Instructions supplied with the OT ELISA kit were followed without modification, and CSF samples were directly assayed while plasma was extracted prior to testing [27] (link), [37] (link). Plasma was extracted using acetone and ether, and dried down using a Savant speedvac as outlined by Enzo Life Sciences technical support. Plasma samples were then rehydrated in assay buffer prior to testing. We examined serial dilutions and only extracted plasma produced linear concentration estimates (preliminary data).
Dal Monte O., Noble P.L., Turchi J., Cummins A, & Averbeck B.B. (2014). CSF and Blood Oxytocin Concentration Changes following Intranasal Delivery in Macaque. PLoS ONE, 9(8), e103677.
Full text: Click here
Publication 2014
Acetone AVP protein, human Biological Assay Buffers Cross Reactions Enzyme-Linked Immunosorbent Assay Ethyl Ether Homo sapiens Hypersensitivity Infant, Newborn Plasma Primates Rodent Technique, Dilution
4
Benchmarking Machine Learning Models for Antimicrobial Peptide Prediction
Cited 5 times
The data sets were obtained from the study by Thakur et al.[23] (link). 1,056 peptides were validated experimentally, containing 604 highly effective AVPs and 452 non-effective peptides; another 604 peptides without experimental validation were non-effective from the study by Lata et al.[32] . Each of the peptides in the data sets was different from one another.
Two training sample sets and two independent test sets were established based on the data described above. Here we followed the same nomenclature used in the study by Thakur et al.[23] (link). 10-fold cross-validation was performed in our analysis, where the training and validation sets came from either of the two sample sets T544P+407N and T544P+544N*. T544P+407N consisted of 544 highly effective AVPs and 407 non-effective experimental peptides; T544P+544N* contained the same 544 positive AVPs but different 544 non-experimental negative peptides. The independent test sets V60P+45N and V60P+60N* were used for the benchmark. V60P+45N consisted of 60 highly effective AVPs and 45 non-effective peptides; V60P+60N* contained 60 positive peptides and 60 non-experimental negative peptides.
Chang K.Y, & Yang J.R. (2013). Analysis and Prediction of Highly Effective Antiviral Peptides Based on Random Forests. PLoS ONE, 8(8), e70166.
Full text: Click here
Publication 2013
AVP protein, human latrunculin A Peptides
5
Vasopressin Gene Expression Analysis
Cited 5 times
Genomic DNA contamination of total RNA was controlled either using RT-PCR specific to the first intron of vasopressin gene (Genbank X59496) or RT minus control. Vasopressin gene amplification is carried out in the same reaction conditions as IL1a mRNA. 5'to 3' forward and reverse primers are as follows, AGCATGTGGTCTTTGGGAAGGTG and TAGGCTCAAATCTGGTCAGGTCAC generating a 107 bp DNA fragment.
Peinnequin A., Mouret C., Birot O., Alonso A., Mathieu J., Clarençon D., Agay D., Chancerelle Y, & Multon E. (2004). Rat pro-inflammatory cytokine and cytokine related mRNA quantification by real-time polymerase chain reaction using SYBR green. BMC Immunology, 5, 3.
Publication 2004
AVP protein, human DNA, A-Form DNA Contamination Gene Amplification Genome IL1A protein, human Introns Oligonucleotide Primers Reverse Transcriptase Polymerase Chain Reaction Training Programs

Most recents protocols related to «AVP protein, human»

1
Sensing Vasopressin and Sodium for Dehydration
Not available on PMC !

Example 3

With reference to FIG. 1, the sensor 120 senses vasopressin, and the sensor 124 senses Na+, which is an indicator of sweat generation rate. The sensor 124 could therefore provide a leading warning of possible dehydration before dehydration occurs as recorded by sensor 220, which measures changes in levels of vasopressin.

US11857313B2. Sweat biosensing companion devices and subsystems (2024-01-02). University of Cincinnati [US]. Inventors: Jason C. Heikenfeld [US].
Full text: Click here
Patent 2024
AVP protein, human Companions Dehydration Medical Devices Sweat
2
Dissociating PE Representations Using Computational Modeling
Because we are interested in whether PES or PEM representations depend on wf or not, we divided PES with (1-wf) and PEM with wf before entering them into the design matrix. As a result, the first PES value in the parametric modulator would always be PES = −1 if it was a high-shock outcome or PES = + 1 for a low-shock outcome, independently of the participant’s wf value. If signals covary with PES in a way that does not linearly depend on wf, the parameter estimate across participants (βPES) would violate H0:βPES = 0, but not H0:r(βPES = 0, wf)=0. If signals covary with PES in a way that does linearly depend on wf, it would violate both of these H0. Note that for outcomes, the coding was +1 for good outcomes (i.e., high money or low-shock) and −1 for bad outcomes (i.e., low money or high shock). EV and PE follow that polarity. The same was applied to EVS and EVM, which were divided by (1-wf) and wf, respectively. This approach is illustrated with an example in Supplementary Note §15.
Results were then analyzed in two ways. First, to improve reverse inference, we used two multivariate signatures the affective vicarious pain signature (AVPS24 (link)) and the reward signature (RS29 ) To explore if signals in this network covary with PES or PEM we then simply dot-multiplied the PES or PEM parameter estimate volume for each participant separately with the AVPS and RS, after having brought the AVPS and RS into our fMRI analysis space using ImageCalc. The result of the dot-multiplication indicates how much the covariance with PES or PEM loads on the AVPS or RS. We then brought these values into JASP, and compared them against zero and correlated them with wf. Because the loadings were normally distributed, we used parametric analyses. Second, we performed a similar analysis at the voxel level, by bringing the parameter estimate images for PES and PEM into a second-level linear regression using a constant and wf as the two predictors. A t test on the constant then reveals regions in which signals covary with PES or PEM after removing variance explained by wf. A t-test on the wf parameter estimate then reveals regions where the signals covary with PES or PEM in ways that depend on wf. To test if signals covary with 1-wf, we simply used a negative contrast in the t-test. Results were family-wise corrected at the cluster level using the established two-step procedure in SPM: (i) for cluster-cutting we visualized results at punc < 0.001 k = 10, and identified the FWEc minimum cluster-size for family-wise error correction from the results table, (ii) we reloaded the results at punc < .001 k = FWEc, so that all displayed results survive FWE at cluster-level. The same was done for EVS and EVM, but only reported in Supplementary Fig. 18. For contrasts not revealing significant clusters at that threshold, we also mention results that were cluster-cut at punc < 0.01, and then applied the FWEc that SPM calculates at that cluster-cutting threshold. However, it should be noted that cluster-extent corrections following such permissive cluster-cutting thresholds are more subject to false positives and should be interpreted with care52 (link).
Fornari L., Ioumpa K., Nostro A.D., Evans N.J., De Angelis L., Speer S.P., Paracampo R., Gallo S., Spezio M., Keysers C, & Gazzola V. (2023). Neuro-computational mechanisms and individual biases in action-outcome learning under moral conflict. Nature Communications, 14, 1218.
Full text: Click here
Publication 2023
AVP protein, human Constant-T Contrast Media fMRI Pain Shock
3
Evaluating Postpartum Depression Risk Factors
The normal distribution of variables in each group was assessed using the Kolmogorov–Smirnov test. A Chi-squared test was used for qualitative variables when comparing the groups. Mann–Whitney test and Independent-sample T-test were applied for non-normally and normally distributed variables, respectively. Binary logistic regression was employed to assess the possible association of PPD with the variables like plasma vasopressin levels, parity, BMI, maternal gender preference, type of delivery, parity, maternal age, history of abortion, women’s education level, husband’s education level and breastfeeding status. For all statistical tests, the level of significance was considered as P < 0.05. Data analysis was done using the SPSS software (ver. 21).
Kashkouli M., Jahanian Sadatmahalleh S., Ziaei S., Kazemnejad A., Saber A., Darvishnia H, & Azarbayjani K. (2023). Relationship between postpartum depression and plasma vasopressin level at 6–8 weeks postpartum: a cross-sectional study. Scientific Reports, 13, 3518.
Full text: Click here
Publication 2023
AVP protein, human Husband Mothers Obstetric Delivery Plasma Woman
4
Peptide Antibody Production and Purification
Peptides corresponding to the C-terminal region of the A. rubens asterotocin precursor (ArASTP; KERLLDALLRQP; Fig. 1a), corazonin-type precursor (ArCRZP; KLLDNVRLPQTERK; Fig. 1b) and luqin-type precursor (ArLQP; KGKVPATA; Fig. 1c) were custom synthesized by Peptide Protein Research Ltd (Fareham, UK). Naturally occurring lysine residues at the N-terminus of ArASTP and ArCRZP peptide antigens and an introduced lysine at the N-terminus of the ArLQP peptide antigen, replacing a naturally occurring cysteine residue (Fig. 1c), facilitated glutaraldehyde-mediated coupling to porcine thyroglobulin (Sigma-Aldrich, Gillingham, UK) as a carrier protein, using 5% glutaraldehyde (Sigma-Aldrich, Gillingham, UK) in phosphate buffer (0.1 M; pH 7.2). Then, antigen peptide-thyroglobulin conjugates were used for the immunisation of one rabbit per antigen peptide (70-day protocol; Charles River Biologics, Romans, France). Conjugates were emulsified in Freund’s complete adjuvant for primary immunisations (~100 nmol antigen peptide) and in Freund’s incomplete adjuvant for three booster immunisations (~50 nmol antigen peptide). The presence of antibodies to the antigen peptides in post-immunisation serum samples was assessed using an enzyme-linked immunosorbent assay (ELISA; see below), in comparison with pre-immune serum.

Amino acid sequences of a vasopressin/oxytocin-type (asterotocin) precursor (ArASTP), b corazonin-type precursor (ArCRZP) and c luqin-type precursor (ArLQP) in Asterias rubens. Predicted signal peptides are shown in blue, neuropeptides are shown in red but with C-terminal glycine residues that are substrates for amidation shown in orange, dibasic cleavage sites are shown in green and the neurophysin domain of ArASTP is shown in pink. The cysteine residues in ArASTP that form a disulphide bridge in the mature neuropeptide are underlined. The sequences of the C-terminal peptides that were used as antigens for antibody production are shown in bold yellow. Note, however, that the underlined cysteine residue in ArLQP was replaced with a lysine residue at the N-terminus of the antigen peptide to provide reactive sites for glutaraldehyde-mediated coupling to a carrier protein (thyroglobulin). GenBank Accession numbers: a ALJ99953.1 (Semmens et al. 2016 (link); Odekunle et al. 2019 (link)); b ALJ99955.1 (Semmens et al. 2016 (link); Tian et al. 2017 (link), 2016 (link)); c ALJ99961.1 (Semmens et al. 2016 (link); Yañez-Guerra et al. 2018 (link))

Antibodies to the antigen peptides were purified from the final bleed antiserum by affinity purification using the AminoLink Plus Immobilization Kit (Thermo Fisher Scientific, Waltham, MA), with bound antibodies eluted using glycine elution buffer (6.3 ml of 100 mM glycine [VWR Chemicals, Leicestershire, UK] and 0.7 ml of Tris [1 M, pH = 7.0]) and trimethylamine (TEA) elution buffer (6.3 ml of TEA [Sigma-Aldrich, Gillingham, UK] and 0.7 ml of Tris [1 M, pH = 7.0]). Eluates were dialysed and sodium azide (0.1%) was added for long-term storage of the affinity-purified antibodies at 4 °C. ArASTP, ArCRZP and ArLQP antibodies eluted with TEA were diluted in 5% normal goat serum (NGS; Sigma-Aldrich, Gillingham, UK)/PBST (phosphate-buffered saline containing 0.1% Tween-20) at 1:20, 1:15 and 1:15, respectively, and then used for immunohistochemistry (see below). The rabbit antisera to ArASTP, ArCRZP and ArLQP have been assigned the RRID numbers RRID:AB_2922389, RRID:AB_2922390 and RRID:AB_2922391, respectively.
Tinoco A.B., Egertová M, & Elphick M.R. (2023). Immunohistochemical localisation of vasopressin/oxytocin-type, corazonin-type and luqin-type neuropeptide expression in the starfish Asterias rubens using antibodies to the C-terminal region of precursor proteins. Cell and Tissue Research, 391(3), 441-456.
Full text: Click here
Publication 2023
Acids Antibodies Antibody Affinity Antibody Formation Antigens Asterias AVP protein, human Biological Factors Carrier Proteins Chromatography, Affinity corazonin protein, insect Cysteine Cytokinesis Disulfides Enzyme-Linked Immunosorbent Assay Freund's Adjuvant Glutaral Glycine Goat Immobilization Immune Sera Immunization Immunohistochemistry LUQIN Lysine Neuropeptides Neurophysins Oxytocin Peptides Phosphates Pigs polypeptide C Proteins Rabbits Rivers Ruthenium Ben Saline Solution Secondary Immunization Serum Signal Peptides Sodium Azide Thyroglobulin trimethylamine Tromethamine Tween 20 Vaccines, Peptide
5
Controlled Sodium Intake and Fluid Homeostasis
For 4 days before each experiment, all participants consumed a controlled mixed diet (2822 kcal per day; 16% protein, 55% carbohydrate, 29% fat). The food was handed out frozen, and the NaCl content of the diet, measured at Eurofins Stein's Laboratory in Denmark, was 55 to 75 mmol per day. NaCl was added to the diet to standardize daily intake at 2 mmol NaCl per kilogram of body weight per day. Twenty‐four‐hour urine was collected on the last day. Urinary sodium and potassium concentrations as well as pH were determined. Water intake was ad libitum, and strenuous physical activity was not allowed during the 4‐day period.
Participants arrived in the morning hours having fasted for 12 hours before the beginning of the experiments. The experimental setup is shown in Figure 1B. After confirmation of an empty bladder by ultrasound, participants remained supine throughout the experiments and were given tap water (14 mL/kg, maximum 1000 mL), which was ingested within 10 minutes to keep participants in surplus of free water and thus suppress and maintain plasma vasopressin concentration at a constant low level. Meanwhile, a forearm vein was catheterized with an 18‐gauge catheter (BD Venflon; 1.2 mm OD, length 45 mm; Becton Dickinson, Helsingborg, Sweden) for infusions as well as blood sampling. An intravenous infusion of 0.9% NaCl was administered (750 mL/h for ≈3 hours) to expand the extracellular fluid volume throughout the experiments, similar to our previous studies.5, 6
Haddock B., Kristensen K.B., Tayyab M., Larsson H.B., Lindberg U., Vestergaard M., Francis S., Jensen B.L., Andersen U.B, & Asmar A. (2023). GLP−1 Promotes Cortical and Medullary Perfusion in the Human Kidney and Maintains Renal Oxygenation During NaCl Loading. Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease, 12(3), e027712.
Publication 2023
AVP protein, human Body Weight Carbohydrates Catheters Diet Extracellular Fluid Food Forearm Freezing Intravenous Infusion Normal Saline Plasma Potassium Proteins Sodium Sodium Chloride Ultrasonography Urinary Bladder Urine Veins Water Consumption

Top products related to «AVP protein, human»

1
Vasopressin by Merck Group
Sourced in United States, Germany
Vasopressin is a synthetic hormone that is used in laboratory research and experiments. It functions as a neurotransmitter and plays a role in regulating blood pressure, water retention, and other physiological processes.
2
Arginine vasopressin by Merck Group
Sourced in United States
Arginine vasopressin is a peptide hormone that regulates water and salt balance in the body. It is used in laboratory applications for research and testing purposes.
3
Phenylephrine by Merck Group
Sourced in United States, United Kingdom, Germany, Japan, Sao Tome and Principe, Australia, Brazil, Switzerland, Italy, France, Czechia
Phenylephrine is a pharmaceutical product used as a laboratory reagent. It functions as a sympathomimetic amine, which means it stimulates the sympathetic nervous system. Phenylephrine is commonly used in various research and analytical applications.
4
Arg8 vasopressin elisa kit by Enzo Life Sciences
Sourced in United States
The Arg8-Vasopressin ELISA kit is a laboratory equipment product designed to detect and quantify the Arg8-Vasopressin (also known as Arginine Vasopressin) hormone in biological samples. The kit utilizes the Enzyme-Linked Immunosorbent Assay (ELISA) technique, a well-established method for the sensitive and specific measurement of target analytes.
5
Glucagon by Merck Group
Sourced in United States, Germany, Denmark
Glucagon is a laboratory reagent used for the detection and quantification of the hormone glucagon in biological samples. It functions as a standard or control material in analytical procedures.
6
Arg8 vasopressin acetate salt by Merck Group
Sourced in United States, United Kingdom
[Arg8]-Vasopressin acetate salt is a synthetic peptide that is structurally similar to the natural antidiuretic hormone vasopressin. It is commonly used as a laboratory reagent for research purposes.
7
Isoproterenol by Merck Group
Sourced in United States, Germany, Japan, United Kingdom, Sao Tome and Principe, Canada, France, Denmark, Italy, Sweden
Isoproterenol is a synthetic catecholamine used as a laboratory reagent. It acts as a non-selective beta-adrenergic agonist, stimulating both beta-1 and beta-2 adrenergic receptors. Isoproterenol is commonly used in research applications to study cardiovascular and respiratory function.
8
Serotonin hydrochloride by Bio-Techne
Sourced in United Kingdom
Serotonin hydrochloride is a chemical compound used in various research and laboratory applications. It serves as a neurotransmitter and is commonly used in the study of biological processes and neurological functions.
9
Syntocinin spray by Novartis
Sourced in United States
Syntocinin-Spray is a specialized lab equipment designed for the controlled delivery of chemical compounds. It is a precision spray applicator that can be used to apply specific substances onto targeted surfaces or samples during laboratory procedures. The core function of Syntocinin-Spray is to facilitate the accurate and consistent application of liquids or solutions in a controlled manner.
10
Prism 3 by GraphPad
Sourced in United States, Germany
Prism 3.0 is a data analysis and graphing software developed by GraphPad. It is designed to help researchers and scientists efficiently analyze and visualize data. Prism 3.0 provides a range of tools for curve fitting, statistical analysis, and creating publication-quality graphs.

More about "AVP protein, human"

Arginine vasopressin (AVP), also known as antidiuretic hormone (ADH) or vasopressin, is a crucial peptide hormone that plays a vital role in regulating various physiological processes, including water balance, blood pressure, and cardiovascular function.
Produced in the hypothalamus and released by the posterior pituitary gland, AVP is a key player in osmoregulation and cardiovascular homeostasis.
Research on AVP proteins is critical for understanding and managing a range of conditions, such as diabetes insipidus, syndrome of inappropriate antidiuretic hormone secretion (SIADH), and cardiovascular disorders.
These investigations often involve the use of related compounds like phenylephrine, arginine vasopressin acetate salt, isoproterenol, and serotonin hydrochloride, which can help researchers better understand the complex mechanisms and interactions involving AVP.
Optimizing AVP protein studies is crucial for advancing our knowledge and developing effective treatments.
Tools like PubCompare.ai can assist researchers in locating reliable experimental protocols, comparing research approaches, and enhancing the reproducibility and accuracy of their investigations.
By leveraging this innovative AI-driven platform, scientists can streamline their AVP protein research, leading to more robust and impactful findings.
Whether you're studying the role of AVP in water balance, blood pressure regulation, or cardiovascular function, PubCompare.ai can be a valuable resource in your research endeavors.
By providing access to a wealth of information, including protocols, pre-prints, and patents, this platform can help you optimize your experimental design, identify the most effective approaches, and ultimately, advance our understanding of this critical hormone and its associated physiological processes.