Biozym

The overview of the entire protocol is displayed in Figure 1. All steps are carried out at room temperature, except step II (37°C). Careful washing between each step is recommended.
I Preparation of ds-bio DNA probe {3 hours}:
Short single stranded DNA (25-30 nucleotides) can be ordered from various companies; we ordered non-modified oligonucleotides (Metabion) and 5' biotinylated complementary oligonucleotides (Biozym) independently. The sense and antisense oligonucleotides were diluted in annealing buffer (2 μM each) and heated in a water bath for 3 min at 95°C and left to cool down slowly to room temperature to construct the ds-bio DNA probe (2 μM). If longer ds-bio DNA fragments are desired, PCR with one 5' biotinylated primer is recommended [9 (link)]. The ds-bio DNA probe was stored at -20°C.
II DNA-binding to the streptavidin-coated plates {1 hour}:
The most informative results were gained with 2 pmol of ds-bio DNA in TBS-T added to each well and incubated at 37°C (60 μl per well).
Wash: 3 × 150 μl TBS-T
III Blocking of residual binding spots of the micro well plate {30 min.}:
Blocking was performed with either 5% non-fat dry milk (Roth) in TBS-T or α-His:HRP antibody specific blocking reagent (Qiagen) (100 μl per well).
Wash: 3 × 150 μl TBS-T (optional, but recommended)
IV Protein binding to immobilised ds-bio DNA {1 hour}:
Up to five different amounts of total protein extract in protein dilution buffer should be tested (e.g. 0.5 μg, 5 μg, 25 μg, 50 μg, 100 μg in 60 μl per well).
Wash: 3 × 150 μl PBS-T
V Antibody binding of protein bound to DNA {1 hour}
We recommend using an antibody that is directly conjugated with horseradish peroxidase for the immunological detection of the α-epitope. We used α-His-HRP antibody conjugate (Qiagen) diluted 1:1'000 in PBS-T (60 μl per well).
Wash: 2 × 150 μl PBS-T, 2 × 150 μl PBS.
VI Photometric detection (peroxidase reaction) via ELISA-reader {< 45 min.}: Plates were incubated with OPD-solution (60 μl per well) in the dark for max. 30 minutes. After adding an equal volume of stopping solution, the plate was kept for further 10 minutes in the dark under mild agitation (150 rpm). The extinction was measured at 492 nm using 650 nm (plate background) as a reference wavelength in the ELISA-reader. In the case of kinetic measurements no stopping solution was added and the absorbance was measured at 450 nm for 1 hour with an interval of 5 min.

Strain culturing. Both N2 and CB parental strains were homozygous. Strains were grown in 9-cm petri dishes at 15 °C or 20 °C on standard nematode growth medium with Escherichia coli strain OP50 as a food source and transferred to new dishes by a chunk of agar once a week. Recombinant inbred lines (RILs) were constructed by putting, on each of ten 6-cm dishes, one J4 hermaphrodite of strain N2 with five males of strain CB4856, and vice versa on each of ten other 6-cm dishes to avoid any maternal or paternal effects. Mating was considered to be successful if the ratio of males to hermaphrodites was approximately 1:1 in the F₁ hybrids. Approximately 1,500 F₁ hermaphrodites were transferred to individual dishes in 24-well multiplates and allowed to self-fertilize at 20 °C. This was repeated until F₂₀.
DNA isolation. For all lines, liquid cultures in S-basal (100 mM NaCl, 50 mM KH₂PO₄ [pH 6.0], 5 mg/l cholesterol) were started and allowed to develop for one week in 50-ml tissue-culture flasks at 20 °C. Cultures were transferred to 10-ml blue caps and centrifuged for 5 min at 4,000 rpm. Pelleted nematodes were transferred to a 1.5-ml Eppendorf tube, washed once with 1 ml M9 buffer, and centrifuged for 3 min at 8,000 rpm. After removal of the supernatant, 300 μl lysis buffer (20 mM Tris-HCl [pH 8.0], 2 mM EDTA, 2% Triton X-100) and 5 μl proteinase K (10 mg/ml) were added, and samples were left for 3 h at 65 °C in a rotary shaker. Samples were washed with 400 μl phenol:chloroform:isoamylalcohol (25:24:1) and centrifuged for 3 min at 14,000 rpm, after which the upper layer was transferred to a new tube. This step was repeated once. Next, 30 μl 3 M sodium acetate (pH 5.0) and 750 μl ice-cold isopropanol was added and samples were centrifuged for 3 min at 14,000 rpm. The DNA was washed once with 1 ml 70% ethanol and subsequently dissolved in 100 μl Milli-Q water. 1 μl RNase A was added and samples were incubated for 2–3 h at 37 °C, after which they were stored at 4 °C.
Genotyping RILs. All markers were selected on the C. elegans SNP data website, (http://www.genome.wustl.edu/genome/celegans/celegans_snp.cgi). For Chromosomes I, II, III, IV, and X, we selected 20 evenly spaced markers, for Chromosome V we selected 21 markers because this chromosome is larger than the other chromosomes. We selected easily detectable (i.e., with a common restriction enzyme) SNP markers with high P_snpvalues (P_snp ≥ 0.7), of which 75 were already confirmed.
PCR was performed on a Biozym MJ Research PTC-200 Peltier thermal cycler in thin-walled 200-μl reaction tubes under the following conditions: 4 min at 94 °C; 35 cycles of 45 s at 94 °C, 45 s at 56 °C, 45 s at 72 °C; 5 min at 72 °C. Total reaction volume was 10 μl, with 5 μl 20-fold diluted DNA sample, 1 μl 10× PCR buffer (100 mM Tris-HCl [pH 9.0], 15 mM MgCl₂, 500 mM KCl, 0.1% gelatin, 1% Triton X-100), 0.5 μl 50 mM MgCl₂, a final primer concentration (Gibco-BRL, www.invitrogen.com; Isogen, www.isogen-lifescience.com; or Proligo, http://www.proligo.com) for each of a 0.4 pmol/μl, a final dNTP (Gibco-BRL) concentration of 0.2 mM, and a final Supertaq polymerase (HT Biotechnology, http://www.sphaero-q.com/HTbiotechnology.html) concentration of 0.02 U/μl.
Subsequently, samples were digested by adding 1μl of restriction enzyme buffer and 3 U of the appropriate restriction enzyme (Boehringer; Invitrogen, http://www.invitrogen.com; New England Biolabs, http://www.neb.com) directly to the sample. BSA was added if necessary. Digestions were performed for 3 h at the appropriate temperature, after which samples were loaded on 1.5%–3% agarose gels (depending on the expected fragment sizes) and run for 1.5 h at 100 V. Suspected mistypings were checked for a second time.
Marker analysis. The order of markers was not based on a constructed linkage map but on their physical position in the sequenced genome. Physical and F2-derived genetic positions were obtained from Wormbase WS106 (http://www.wormbase.org). Marker segregation deviation (segregation distortion) from a 1:1 ratio was analyzed using a χ² test. To correct for Type I errors, we Bonferroni-corrected the significance level of these tests downwards with a factor of 12, which equals the estimated number of independent tests within our dataset: six for the chromosome number multiplied by two for the theoretical number of independent markers on each chromosome (the two outermost ones, which show approximately 50% recombination). Genetic distances between any two neighbouring markers were inferred from recombination fractions using the Kosambi mapping function. Recombination within one chromosome between neighbouring and nonneighbouring markers was analyzed by comparing the observed recombination using a χ² test in which the expected recombination was calculated with the inverse Kosambi function from twice the F2-derived distances between markers to correct for the multiple rounds of meiosis [30 (link)].
Association between any two markers on different chromosomes was analyzed for significant deviation from neutrality by comparing the overall number of associations and nonassociations (analogous to (non) recombinants if the markers were close to one another on the same chromosome) for any two markers with a calculated expected number using a χ² test. To obtain a model describing the expected fraction of association based on allele frequency, we performed nonlinear regression on data obtained from a simulation in which we determined the random association between two unlinked loci, each with two alleles, given a specific allele frequency for both alleles at both loci. The random association value finally used as input for the model was an average based on 1,020 replicates in which for each replicate, 80 marker-to-marker comparisons were randomly selected out of a total of 1,000.
Culturing. All recombinant inbred lines were reared on NGM agar plates seeded with the OP50 strain of E. coli as a food source. Stock cultures of OP50 were stored at −80 °C, and the bacterial cultures were grown in autoclaved LB medium (10 g peptone, 10 g yeast extract, 5 g NaCl/l water) for 16 h at 37 °C and shaken at 150 rpm. Populations were started with only nonmated hermaphrodites and screened regularly to remove any occurring males.
Synchronization. Experiments were carried out with nematodes belonging to the L3 life stage. To determine the entry into this stage at 16 °C and 24 °C, the size of the gonads and vulva were monitored. At 72 h of age, nematodes kept at 16 °C were at the L3 stage, whereas 40 h of age determined this life stage at 24 °C. Populations of each of the RILs were bleached (0.5 M NaOH, 1% hypochlorite) to collect synchronized eggs, which were then inoculated onto fresh dishes. Four replicate dishes of synchronized eggs for each RIL were kept in each of the two temperatures until L3 was reached. The nematodes were then collected and frozen in liquid nitrogen.
Probe construction and hybridization. The parental N2 and CB4856 strains differ in their genome sequence by up to one per 873 bp of aligned sequence [19 (link)]. Koch et al. reported that 85% of the SNPs were found in noncoding DNA [31 (link)]. In an attempt to minimize hybridization differences based on SNPs, 60-mer oligonucleotide microarrays were used in this study. The frozen nematode samples were ground and RNA was extracted using the Trizol method, and cleaned up with the RNeasy Micro kit (Qiagen, http://www1.qiagen.com/). RNA concentration and quality was measured with a NanoDrop spectrophotometer (http://www.nanodrop.com). cDNA was obtained using Array 900 HS kit (Genisphere, http://www.genisphere.com) and Superscript II (Invitrogen). The cDNA samples were hybridized to 60-mer oligo arrays using the Genisphere Array 900 HS protocol. The probes on the arrays cover genes all over the genome. These 60-mers (provided by Washington University) were designed to uniquely represent each gene with proximity to the gene 3′ end and with a minimum of secondary structure potential. All microarray data have been deposited in NCBI's Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo) and are accessible through the GEO Series accession number listed under the Accession Numbers heading in Supporting Information.
Pairwise design. We adopted a novel distant-pair design for the microarray experiments, which was proposed especially for genetic studies on gene expression [20 (link)]. In this design, the 80 RILs are hybridized directly on 40 arrays, in pairs that are maximally genetically different.

Primer design was based on the official gene nucleotide sequences from the NCBI Nucleotide database (GeneBank, National Centre for Biotechnology Information, Bethesda MD, USA). They were constructed with NCBI PrimerBLAST^{38 (link)} considering the final concentration of qPCR components according to optimized criteria^{11 (link),39 (link)–41 (link)}. Primers received no terminal or other modifications and were synthesized and purified by Eurofins MWG Operon LLC (Huntsville, AL, USA; High Purity Salt Free Purification HPSF^®). For qPCR amplification we used a Mastercycler^® ep realplex-S thermocycler (Eppendorf AG, Hamburg, Germany) in conjunction with 96 well PCR plates (TW-MT, 712282, Biozym Scientific GmbH, Hessisch Oldendorf, Germany) and BZO Seal Filmcover sheeting (712350, Biozym Scientific GmbH). Into each well SYBR^®Green JumpStart™ Taq ReadyMix™ (7.5 µl, Sigma–Aldrich^®, S4438), consisting of Tris–HCl (20 mM, pH 8.3), KCl (100 mM), MgCl₂ (7 mM), dNTPs (0.4 mM per dATP, dCTP, dGTP, dTTP), stabilizers, Taq-DNA-polymerase (0.05 U/µl), JumpStart™ Taq antibody and SYBR^®Green I, as well as the respective cDNA solution (1.5 µl, dilution 1:10) and the respective primer pair (7.5 pmol, 0.75 µl–3.75 pmol/primer) were pipetted ad 15 µl nuclease-free H₂O (T143, Carl-Roth GmbH). We amplified the cDNA in triplets (three technical replicates) per candidate reference gene and biological replicate (sample) and on the same qPCR plate in 45 cycles (initial heat activation 95 °C/5 min, per cycle 95 °C/10 s denaturation, 60 °C/8 s annealing, 72 °C/8 s extension, Supplementary Data 3), resulting in 6 (samples) × 3 (experimental conditions) × 3 (technical replicates) analysed PCR reactions (C_q values) per candidate reference gene. At the end of each extension step SYBR^®Green I fluorescence was measured at 521 nm.

RNA was isolated from cell pellets from chemostat and retentostat cultivations using the Tri reagent according to the supplier's instructions (Ambion, USA). Cells were disrupted by glass beads using a ribolyser (MP Biomedicals). To remove residual DNA, the RNA samples were treated with the DNA-free™-kit (Ambion) according to the manufacturer’s manual. Subsequently, RNA quality, purity, and concentration were analyzed by a NanoDrop™ spectrophotometer and Bioanalyzer (Agilent). For cDNA synthesis for qPCR, the Biozym cDNA synthesis kit (Biozym) in combination with oligo(dt)₂₃ primers (NEB) was used. Quantitative PCR was carried out using the Biozym Blue Probe qPCR kit on a Rotor Gene Q instrument (Qiagen). Changes in transcript levels were calculated relative to the reference sample after normalization to ACT1 (PP7435_Chr3-0993) expression using the threshold cycle method of the Rotor Gene software. A more detailed description and a list of the used primers is provided in Additional file 1.

RNA extraction was performed as described in the protocol of the RNeasy Protect Kit and RNase-Free DNase Set (QIAGEN GmbH, Hilden, Germany). A cDNA Synthesis Kit (Biozym Scientific GmbH, Hessisch Oldendorf, Germany) was used to generate cDNA and the following qPCR was run with Blue S'Green qPCR Mix Separate ROX (Biozym Scientific GmbH, Hessisch Oldendorf, Germany) and analyzed with qTOWER³ (Analytik Jena GmbH, Jena, Germany). Primers (Table 3) used in this study were ordered from Merck KGaA (Darmstadt, Germany). The housekeeping gene for qPCR was gyrAB.

RNA was isolated using TriFast (Peqlab, #30-2030) as per the manufacturer’s instructions. Concentration of the isolated RNA was measured using Take3 Plates on a Bio-Tek plate reader (Synergy HT). For mRNA measurements, RNA (500–1000 ng) was reverse transcribed using the iScript Select cDNA Synthesis Kit (Bio-Rad, #170-8897) or Biozym cDNA synthesis kit (Biozym, #331470). A SYBR Green-based real-time PCR was performed with iQ SYBR Green mix (Bio-Rad, #172-5006CUST). The real-time PCR was performed on a ViiA7 (Applied Biosystems) using specific primer pairs (see Table below).

Gene name	Species	Primer sequence (5′- > 3′)
18s	Human	Forward: AGTCCCTGCCCTTTGTACACA Reverse: GATCCGAGGGCCTCACTAAA
TBP	Human	Forward: TGCTGCGGTAATCATGAGGA Reverse: TTCACATCACAGCTCCCCAC
hTERT	Human	Forward: GCCTTCAAGAGCCACGTC Reverse: CCACGAACTGTCGCATGT
hGJA1	Human	Forward: TGGTAAGGTGAAAATGCGAGG Reverse: GCACTCAAGCTGAATCCATAGAT
hCACNAC1Cb	Human	Forward: ACTGGTCAGGGATGATTGGG Reverse: AGTAACTATGGCCCGAGACG
hSCN2b	Human	Forward: TAGCCCACCCGACTAACATC Reverse: GGTGGCACCAAAGAGAAAAA
hKCNJ8	Human	Forward: CCCTTTGATCATCTGCCACG Reverse: TAGGAGGTTCGTGCTTGTGT
hHCN1a	Human	Forward: AGAAGGAGCCGTGGGTAAAA Reverse: TCAGCAGGCAAATCTCTCCA
hHCN1b	Human	Forward: ACCACTACTGCAGGACTTCC Reverse: CCGACAAACATGGCATAGCA
hKCNH2a	Human	Forward: GACATCTTTGGGGAGCCTCT Reverse: TCGCAGGTTGAAGGTGATCT
hKCNH2b	Human	Forward: GCTGGATCGCTACTCAGAGT Reverse: TAGAGCGCCGTCACATACTT
hKCND3	Human	Forward: CCTGGGCTACACACTGAAGA Reverse: CTGCAATCGTCTTAGGCACC