Bleomycin

To construct the Pm35S DNA fragment, we annealed the oligonucleotides 5’- GACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGAAGCTAGTC-3’ and 5’- GACTAGCTTCAGCGTGTCCTCTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGGTC-3’. To construct the Pact1 DNA fragment, the OsACT1 promoter region [16 (link),42 (link)] was PCR-amplified from the pTKM1 plasmid [16 (link),42 (link)] with primers 5’- CTCAAGCTTCGAGGTCATTCATATGCTTGAG-3’ and 5’- ATCTTCTACCTACAAAAAAGCTCCG-3’. To construct the HSP DNA fragment, the Gmhsp17.3B promoter region was PCR-amplified from pPTA2-HSP with primers 5’- TCTAGATAGTCAGCCTTTTAAGAGATAG-3’ and 5’-P4345 HSP-blunt-r-3’. Pm35S, Pact1, and HSP DNA fragments were inserted to the pPIG1b-NGGII plasmid (AB537478) [26 (link),36 (link)] at the SmaI site to construct Pm35S:NGG, Pact1:NGG, and HSP:NGG plasmids, respectively. Direction and sequences of the inserts in the constructs were confirmed by PCR and sequencing.
To construct the pPGX vectors, DNA fragments including the LexA:Pm35S and the Tpea3A terminator were PCR-amplified from the pER8 plasmid [22 (link)] with primers 5’- ATCGATAGCTTGGGCTGCAGGTCGAGGCTAAAAAAC-3’ and 5’- CGGGATCCTACGTAAAGCCTATACTGTACTTAACTTG-3’. This fragment was inserted into the pPIG1b plasmid [14 (link)] between blunted-XhoI and BamHI sites. The XVE gene fragment was PCR-amplified from pER8 with primers 5’- ATGAAAGCGTTAACGGCCAGGCAACAAGAG-3’ and 5’- CTGTCGAGGGGGGATCAATTCCCCGATCTAG-3’, and it was inserted between the BamHI and XbaI sites after blunting. The DNA fragment including LexA:Pm35S, Tpea3 terminator, and the XVE gene was PCR-amplified with primers 5’-ATCGATAGCTTGGGCTGCAGGTCGAGGCTAAAAAAC-3’ and 5’-TCAGACTGTGGCAGGGAAAC-3’, and inserted between blunted XbaI and StuI sites of the pPIG1b-HSP-aphIV vector harboring PIG1bR and PIG1bL for neutral site targeting and the aphIV cassette for hygromicin resistance in P. patens. The Gateway cassette rfA (Invitrogen) was inserted into the resulting vector between the AscI and SpeI sites to construct the pPIG1b-LGXH plasmid (AB602444).
To construct pPGX6 and pPGX8, the promoter regions were PCR-amplified from P. patens genomic DNA with the primers described in Table S1. Each GX promoter DNA fragment was inserted into pPIG1b-LGXH at the SnaBI site. Direction and sequences of the inserts in all constructs were confirmed by PCR and sequencing. The NGG gene cloned into pENTR/D/TOPO [26 (link)] was introduced into each pPGX vector by LR reaction of the GATEWAY system (Life Technologies) according to the manufacturer’s instructions. These constructs without a backbone vector are represented in Figures S1 and S2.
To select potential neutral sites, we searched for redundant loci with similar expression levels in protonemata, gametophores, and excised leaves [38 (link)]. One of these regions was designated as the P. patens targeting site 2 (PTA2), which includes parts of the ribosomal protein L31e gene and is located on the scaffold_58: 518177–519180 and scaffold_58: 519609-520542 (http://genome.jgi-psf.org/Phypa11/Phypa11.home.html). These regions (PTA2-3’ side and PTA2-5’ side) were PCR-amplified from P. patens genomic DNA with primers 5’-TTGTTCAGGATAATGGTTCACAAAA-3’ and 5’-GTTCTTTCTGTCATTAACTGGTTGC-3’, 5’-gtatacGCGACTAGTGAGAGAATGTTCCAG-3’ and 5’-GGGGATTAATTATTGGAGGAAAACT-3’, respectively. To construct the pPTA2r plasmid, these DNA fragments were inserted at StuI and at EcoRV, respectively, in pBluescriptII [49 (link)] containing a multi-cloning site with Sse8387I, PmeI, StuI EcoRV, SmaI, Sse8387I, and PmeI. We inserted a DNA linker with ClaI, StuI, NdeI, and SphI sites at BstZ17I into pPTA2r, to form the pPTA2r-linker plasmid. To construct the pLGZ2 plasmid, the DNA fragment including the bleomycin resistant gene expression cassette with loxP sites, was excised between NdeI and HindIII from the p35S-loxP-Zeo plasmid (AB540628) and inserted between NdeI and HindIII of the pPTA2r-linker. Then, the DNA fragments including LexA:Pm35S, the Gateway cassette, and the Tpea3A terminator were PCR-amplified from pPIG1b-LGXH with primers 5’-ATCGATAGCTTGGGCTGCAGGTCGAGGCTAAAAAAC-3’ and 5’- CGGGATCCTACGTAAAGCCTATACTGTACTTAACTTG -3’, and inserted between ClaI and StuI.

RNA samples isolated from lungs were used for NanoString measurement with a total of 100 ng RNA for each group. Our customized codeset (circadian genes and fibrotic markers) was used for bleomycin treatment groups, and nCounter Fibrosis Panel was used in Bleomycin + SR9009-treated group as well as IAV infected groups. All the RNA samples were mixed with the master mix and incubated at 65 °C for 16 h for RNA hybridization. All the samples were loaded into a NanoString running cartridge, and profiling reading was performed by nCounter SPRINT Profiler (NanoString Technologies, Inc.). All the gene expressions were normalized by nSolver 4.0 software, and normalized counts were used for data representation. The RLF files generated by the profiler were uploaded to ROSALIND (https://www.rosalind.bio/) for advanced analysis to generate volcano plots and pathway direct enrichment scoring. The significantly dysregulated genes were filtered and uploaded to an online tool (http://bioinformatics.psb.ugent.be/webtools/Venn/) to generate the Venn diagram and overlapped dysregulated gene list.