> Chemicals & Drugs > Amino Acid > Bone Morphogenetic Protein 2

Bone Morphogenetic Protein 2

Bone Morphogenetic Protein 2 (BMP2) is a member of the transforming growth factor-beta superfamily.
It plays a critical role in bone and cartilage development, as well as in the regulation of cell growth, differentiation, and apoptosis.
BMP2 is involved in the process of osteoblast and chondrocyte differentiation, and is essential for skeletal patterning and fracture repair.
This potent morphogen has been widely studied for its therapeutic potential in the treatment of bone and cartilage disorders, as well as in tissue engineering and regenerative medicine applications.
Reasearch in this area can be greatly optimized using PubCompare.ai's AI-driven protocol comparison tool, which helps researchers easily identify the best BMP2-related protocols and products from the literature, pre-prits, and patents, saving time and improving research outcomes.

Most cited protocols related to «Bone Morphogenetic Protein 2»

Cardiac Differentiation of Murine Embryonic Stem Cells

Cited 11 times

Murine embryonic stem cells were differentiated into embryoid bodies using the hanging-drop method, with cardiac differentiation monitored by epifluorescence using α-actinin antibody (1:1,000) and live microscopy (34 (link), 48 (link)). RNA was processed by quantitative RT-PCR using the Light Cycler (Roche) and QuantiTect SYBR Green kit (QIAGEN) to quantify Nkx2.5 (forward, reverse primers: 5′-TGCAGAAGGCAGTGGAGCTGGACAAGCC-3′ and 5′-TTGCACTTGTAGCGACGGTTCTGGAACCA-3′), MEF-2C (5′-AGATACCCACAACACACCACGCGCC-3′ and 5′-ATCCTTCAGAGACTCGCATGCGCTT-3′), GATA-4 (5′-GGAATTCAAGATGAACGGCATCAAC-3′ and 5′-TGAATTCTCAACCTGCTGGCGTCTTAGA-3′), and β-MHC (5′-GCCAAAACACCAACCTGTCCAAGTTC-3 and 5′-CTGCTGGAGAGGTTATTCCTCG-3′) mRNA expression normalized to β-tubulin. From day 7 embryoid bodies, cardiopoietic progenitor cells were isolated by Percoll purification and visualized through laser confocal examination using MEF-2C (1:400; Cell Signaling Technologies), Nkx2.5 (1:300; Santa Cruz Biotechnology, Inc.), GATA-4 (1:300, Santa Cruz Biotechnology; Inc.), and α-actinin (1:1,000; Sigma-Aldrich). In a subset of experiments, the endodermal layer was eliminated from embryoid bodies through generation of hanging drops in the presence of recombinant leukemia inhibitory factor (10 U/μl) once differentiation has been initiated (38 (link)). Isolated visceral endoderm-like cells were derived from an F9 cell population (American Type Culture Collection) with retinoic acid (1 μM), dibutynyl cAMP (0.5 mM), and theophylline (0.5 mM), with phenotype confirmed through comparison with END-2 cells (67 (link)). Conditioned medium obtained after 24 h of culture was used for dissection of procardiogenic signaling by proteomic analysis. To stimulate cardiopoiesis of embryonic stem cells cultured in monolayer at 100 cells/cm², cells were stimulated with recombinant TGF-β1 (2.5 ng/ml), BMP-2 and -4 (5 ng/ml), activin-A (5 ng/ml), FGF-2 and -4 (10 ng/ml), IL-6 (100 ng/ml), IGF-1 and -2 (50 ng/ml), VEGF-A (10 ng/ml), and EGF (2.5 ng/ml) either in singular or combinatorial fashion with cellular response monitored by confocal microscopy. When recruited from a monolayer of embryonic stem cells, the cardiopoietic population was enriched using a dual interface Percoll gradient to separate sarcomere-rich high density cardiomyocytes (34 (link)) from the lower density sarcomere-poor cardiopoietic phenotype. Cardiopoietic cell proliferation and purity was assessed by ArrayScan multichannel fluorescence automated microscopy (Cellomics) using MEF-2C and α-actinin antibodies, along with DAPI nuclear staining. Cell morphology was resolved by field emission scanning or transmission electron microscopy. Action potentials and voltage–current relationships were acquired by patch-clamp electrophysiology. Calcium dynamics were tracked in Fluo 4-AM–loaded cells using laser confocal line scanning (48 (link)).

Behfar A., Perez-Terzic C., Faustino R.S., Arrell D.K., Hodgson D.M., Yamada S., Puceat M., Niederländer N., Alekseev A.E., Zingman L.V, & Terzic A. (2007). Cardiopoietic programming of embryonic stem cells for tumor-free heart repair. The Journal of Experimental Medicine, 204(2), 405-420.

Publication 2007

Actinin Action Potentials activin A Antibodies Bone Morphogenetic Protein 2 Calcium Cell Proliferation Cells Culture Media, Conditioned DAPI Dissection Embryoid Bodies Embryonic Stem Cells Endoderm Fibroblast Growth Factor 2 Fluo 4 Fluorescence Heart IGF1 protein, human Immunoglobulins LIF protein, human Light Maritally Unattached Microscopy Microscopy, Confocal Mus Myocytes, Cardiac Oligonucleotide Primers Percoll Phenotype Reverse Transcriptase Polymerase Chain Reaction RNA, Messenger Sarcomeres Stem Cells SYBR Green I TGF-beta1 Theophylline Transmission Electron Microscopy Tretinoin Tubulin Vascular Endothelial Growth Factors

Quantitative Gene Expression Analysis of Osteogenic Differentiation

Cited 8 times

Isolated total RNA was reverse transcribed to complementary DNA (cDNA) using the High Capacity cDNA Archive kit. The cDNA sample was subsequently mixed with Universal PCR Master mix (2x) and Taqman^® Gene Expression Assays. Four target growth factor genes including bone morphogenic protein-2 (BMP-2, Taqman Assay ID: Rn00567818_m1), transforming growth factor-β1 (TGF-β1, Rn00572010_m1), platelet-derived growth factor-A (PDGF-A, Rn00709363_m1), and fibroblast growth factor-1 (FGF-1, Rn00563362_m1), as well as two osteogenic differentiation marker genes, including ALP (Rn00564931_m1) and osteocalcin (OC), were assessed for relative gene expression level profiles. Pre-developed 18s ribosomal RNA was used as an endogenous control gene. The oligonucleotide primer and Taqman probe sequences for OC were 5’ GGCTTCCAGGACGCCTACA 3’ (forward primer), 5’ GGGCAACACATGCCCTAAAC 3’ (reverse primer), and 5’ CGCATCTATGGCACCAC 3’ (probe). Real time quantitative polymerase chain reaction (qRT-PCR) was performed on an ABI Prism 7000 sequence detector (Applied Biosystems). The thermal conditions for the PCR were 2 min at 50°C, 10 min at 95°C, and 50 cycles of 15 s at 95°C and 1 min at 60°C. The relative gene expression level of genes of interest (fold change) was first normalized to the mean of 18s control gene data in each group. The TCPS Min group was chosen as a calibrator and fold change was calculated by ΔΔCt method using the mean of the calibrator data. Mean of fold changes compared to the calibrator group (The TCPS Min group) and standard deviations are reported (n=3).

Kim K., Dean D., Mikos A.G, & Fisher J.P. (2009). The Effect of Initial Cell Seeding Density on Early Osteogenic Signal Expression of Rat Bone Marrow Stromal Cells Cultured on Crosslinked Poly(propylene fumarate) Disks. Biomacromolecules, 10(7), 1810-1817.

Publication 2009

Biological Assay Bone Morphogenetic Protein 2 Differentiation Antigens DNA, Complementary Fibroblast Growth Factor-1 Gene Expression Gene Expression Regulation Genes Growth Factor N-(3,4,5-trichlorophenyl)succinimide Oligonucleotide Primers Osteocalcin Osteogenesis PDGFA protein, human prisma Real-Time Polymerase Chain Reaction RNA, Ribosomal, 18S TGF-beta1 TGFB1 protein, human

Osteogenic Differentiation Assay with Estrogen Modulation

Cited 6 times

Cells were plated in 24-well plates at a density of 10,000 cells/well, and were treated with osteogenic differentiation medium (ODM) containing DMEM, 10% FBS, 100 µg/ml ascorbic acid, 10 mM β-glycerophosphate, 100 IU/ml penicillin/streptomycin as previously described [32] (link). ODM was supplemented with E2 (1–100 nM), Fulvestrant (0.1–10 uM), the ERα specific agonist propyl pyrazole triol (PPT, 1–100 nM), ERβ specific agonist diarylpropionitrile (DPN, 1–100 nM), or with vehicle as a control (Sigma-Aldrich, St. Louis, MO).
To assess early osteogenic differentiation, alkaline phosphatase (ALP) staining and quantification was performed after 7d differentiation as previously described [32] (link). For staining, cells were fixed with a 60% acetone, 40% citrate solution, and stained with a diazonium salt with 4% napthol AS-MX phosphate alkaline solution. Alkaline phosphatase positive cells were stained purple. For ALP quantification, protein was isolated in RIPA buffer. The alkaline phosphate activity was assayed by measuring the p-nitrophenol formed from the enzymatic hydrolysis of p-nitrophenylphosphate. Experiments were performed in triplicate wells; means and standard deviations were calculated.
After 14d osteogenic differentiation, Alizarin red S staining was performed to detect extracellular mineralization as previously described [32] (link). Briefly, cells were fixed in 100% ethanol and stained with a 0.2% Alizarin red S solution. The red staining represents calcium deposits on differentiated cells.
Finally, total RNA was isolated from SMCs at 2, 4, 7, and 14d of osteogenic differentiation. Gene expression of the transcription factor Runx2, as well as other markers of osteogenesis (Alkaline phosphatase, Collagen Type 1α, Osteopontin, Osteocalcin, Bone morphogenetic protein-2, -4, -7, Sonic Hedgehog, Indian Hedgehog, Gli1, Ptc1, Sex determining region Y-box 9 (Sox9), ERα, ERβ) was evaluated by quantitative RT-PCR.

James A.W., Theologis A.A., Brugmann S.A., Xu Y., Carre A.L., Leucht P., Hamilton K., Korach K.S, & Longaker M.T. (2009). Estrogen/Estrogen Receptor Alpha Signaling in Mouse Posterofrontal Cranial Suture Fusion. PLoS ONE, 4(9), e7120.

Full text: Click here

Publication 2009

2,3-bis(4-hydroxyphenyl)-propionitrile 4,4',4''-(4-propyl-((1)H)-pyrazole-1,3,5-triyl) tris-phenol 4-nitrophenol Acetone Alizarin Red S Alkaline Phosphatase Ascorbic Acid beta-glycerol phosphate Bone Morphogenetic Protein 2 Buffers Calcium Cells Citrates Collagen Enzymes Erinaceidae Ethanol Fulvestrant Hydrolysis Naphthols nitrophenylphosphate Osteocalcin Osteogenesis Osteopontin Penicillins Phosphates Physiologic Calcification Proteins PTCH1 protein, human Radioimmunoprecipitation Assay Reverse Transcriptase Polymerase Chain Reaction RUNX2 protein, human Sodium Chloride SOX9 protein, human Streptomycin Transcription Factor

Murine Limb Bud Culture and Cartilage Analysis

Cited 6 times

Cultures were prepared from murine fore and hind limb buds of E11.25 to E11.75 embryos (obtained from breedings of homozygous male transgenic animals or C57Bl6F₁/J males with C57Bl6F₁/J females) as previously described with the following modifications (Cash et al. 1997). After proteolytic digestion, cells were filtered through a Cell Strainer (40 μm; Falcon) to obtain a single cell suspension. Culture media (40% Dulbecco's modified Eagle's medium and 60% F12 supplemented with fetal bovine serum to 10%; GIBCO BRL) was changed daily. BMP-2 or -4 (Genetics Institutes), AGN 194301 (Allergan Pharmaceuticals), and/or purified Xenopus Noggin protein was added to culture media at a concentration of 10 ng/ml, 1 μM, and 10 ng/ml, respectively. Addition/removal experiments included either adding or removing supplemented media on the indicated culture day. 24 h after culture initiation was considered day 1. To detect transgene-expressing cells, cultures were fixed and stained as previously described, with magenta-gal (BioSynth International Inc.) being substituted for X-gal. This was followed by alcian blue staining for cartilage-specific glycosaminoglycans (Lev and Spicer 1964). Alcian blue staining of magenta-gal–stained cultures turned the red precipitate to a purple color, as a result of incubating magenta-gal–stained cells at pH 1. This double-staining technique enables transgene-expressing cells to be localized with respect to alcian blue–stained cartilage nodules. Images were captured using a Sony DXC-950 3CCD color video camera and analyzed using Northern Eclipse image analysis software (Empix Imaging, Inc.) and composite figures were generated in CorelDraw.

Weston A.D., Rosen V., Chandraratna R.A, & Underhill T.M. (2000). Regulation of Skeletal Progenitor Differentiation by the Bmp and Retinoid Signaling Pathways. The Journal of Cell Biology, 148(4), 679-690.

Publication 2000

5-bromo-4-chloro-3-indolyl beta-galactoside Alcian Blue Animals, Transgenic Bone Morphogenetic Protein 2 Breeding Cartilage Cells Culture Media Digestion Embryo Females Fetal Bovine Serum Glycosaminoglycans Homozygote Limb Buds Males Mus nog protein, Xenopus Pharmaceutical Preparations Proteolysis Rosaniline Dyes Staining Transgenes

Quantitative Measurement of BMP Receptor Interactions

Cited 5 times

Alk1-ED and Alk3-ED variants were generated by site directed mutagenesis of the corresponding expression plasmids using PCR (Quikchange, Stratagene, LaJolla, CA). All variants were expressed and purified as described for the corresponding wild type protein. Biacore 3000 biosensor instrument was used for quantitative measurement of the receptor-ligand interactions. BMP-9 and BMP-2 were diluted in 0.1 M acetic acid to a final concentration 2 – 6 μg/mL and coupled to the carboxymethylated dextran chip surface (CM5, GE Healthcare, Piscataway, NJ) using amine-coupling methods. The chip surface was first activated by injecting 35 μL of N-hydroxysuccinimide (NHS) and 1-ethyl-3′-(3-diethylaminopropyl) carbodiimide hydrochloride (EDC) followed by injection of 5 – 15 μL of the ligand to achieve the desired surface density (600–800 RU for BMP-9 and 2500 RU for BMP-2). Remaining activated groups were blocked by injecting 35 μL ethanolamine. One of the flow cells was activated and blocked without injecting any ligand as a reference surface. All injected samples were dialyzed against HBS-EP buffer (10 mM Hepes, 3 mM EDTA 500 mM NaCl, .002% surfactant P20, pH 7.4), centrifuged for 10 min at 50,000 x g, passed through a 0.2 mm filter prior to injection into the SPR instrument. Protein concentrations were determined based on the calculated extinction coefficient at 280 nm and the measured absorbance at this wavelength immediately prior to injection. Six or more concentrations of two-fold serial dilutions of the wild type and the variants of Alk1 and Alk3 were injected over the chip surface at a flow rate of 5 – 10 μL/min. All the injections were performed at room temperature were preceded by a brief injection of 2.5 M guanidine hydrochloride (20 μL/min for 12 seconds) to regenerate the surface. Instrument noise was removed by referencing the data against three or more buffer blank injections, while background signal was eliminated by referencing the data against a blank flow cell. K_ds were determined by fitting the equilibrium binding response, R_eq, as a function of the injected receptor concentration, [R], to R_eq = (R_max × [R])/(K_d + [R]) using the program Kaleidagraph (Synergy Software, Reading, PA).

Mahlawat P., Ilangovan U., Biswas T., Sun L, & Hinck A.P. (2012). Structure of the Alk1 extracellular domain and characterization of its BMP binding properties. Biochemistry, 51(32), 6328-6341.

Publication 2012

Acetic Acid ACVRL1 protein, human Amines Biosensors Bone Morphogenetic Protein 2 Buffers Carbodiimides Dextran DNA Chips Edetic Acid Ethanolamine Extinction, Psychological Growth Differentiation Factor 2 HEPES Hydrochloride, Guanidine Ligands Mutagenesis, Site-Directed Neoplasm Metastasis Plasmids Proteins Sodium Chloride Surface-Active Agents Technique, Dilution

Most recents protocols related to «Bone Morphogenetic Protein 2»

Quantitative Analysis of Endometrial Gene Expression

Total RNA was extracted from collected endometrial tissue or cultured cells using TRIzol reagent (Invitrogen, Life Technologies, Inc.) according to the manufacturer’s instructions. Each reverse transcription procedure used 2 μg of RNA to create first-strand complementary DNA (cDNA) utilizing random primers and Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI, United States of America). Using an Applied Biosystems 7300 Real-Time PCR System, SYBR Green or TaqMan was used for RT-qPCR assays. Each 25 μl qPCR reaction comprised 12.5 μl of SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA), 100 ng of cDNA, and 7.5 nM of each specific primer. These primers were used in this study: ICAM-1, 5′-CTCCAATGTGCCAGGCTTG-3' (forward) and 5′- 5′-CAGTGGGAAAGTGCCATCCT-3’ (reverse); ID3, 5′- CAGCTTAGCCAGGTGGAAATCC-3' (forward) and 5′-GTCGTTGGAGATGACAAGTTCCG-3’ (reverse); SMAD4, 5′-TGGCCCAGGATCAGT AGGT-3′ (forward) and 5′-CATCAACACCAATTCCAGCA-3′ (reverse); and GAPDH, 5' -GAGTCAACGGATTTGGTCGT-3' (forward) and 5'- GACAAGCTTCCCGTTCTCAG-3' (reverse). Alternatively, TaqMan gene expression assay kits for BMP2 (Hs00154192_m1), ALK2 (Hs00153836_m1), ALK3 (Hs01034913_g1), and GAPDH (Hs02758991_g1) were bought from Applied Biosystems. Each 20 μL TaqMan RT-qPCR reaction comprised 1 × TaqMan Gene Expression Master Mix (Applied Biosystems), 20 ng of cDNA, and 1 × specific TaqMan assay Mix containing primers and probes. Relative quantification of the mRNA levels of target genes was determined based on the comparative cycle threshold (Ct) method, and the 2^−ΔΔCt method was used specifically, with the results standardized to endogenous GAPDH.

Luo J., Wang Y., Chang H.M., Zhu H., Yang J, & Leung P.C. (2023). ID3 mediates BMP2-induced downregulation of ICAM1 expression in human endometiral stromal cells and decidual cells. Frontiers in Cell and Developmental Biology, 11, 1090593.

Full text: Click here

Publication 2023

5'-chloroacetamido-5'-deoxythymidine ACVR1 protein, human Biological Assay Bone Morphogenetic Protein 2 Cultured Cells DNA, Complementary Endometrium GAPDH protein, human Gene Expression Genes Intercellular Adhesion Molecule-1 Moloney Leukemia Virus Oligonucleotide Primers Promega Reverse Transcription RNA, Messenger RNA-Directed DNA Polymerase SMAD4 protein, human SYBR Green I trizol

Evaluating Graft-Bone Interface and Cartilage Formation

Samples were fixed (10% formalin, 36 h) then decalcified (10% EDTA, 6 weeks) before a dehydration and paraffin embedding were carried. Then, samples were sliced (5μm, SM2500; Leica, Nussloch, Germany) parallelly to tunnels’ longitudinal axis and fixed on glass slides (40°F oven). Standard Hematoxylin and eosin (H&E) staining was completed to evaluate graft-bone interface.
Patterns of intra-articular collagen alignment were visualized by Masson’s trichrome staining and Safranin O/fast green staining was also carried to observe fibro-cartilage formation patterns and glycosaminoglycans (GAGs) content (Chen et al., 2021 (link)).
All staining procedures were carried based on manufacturer’s instructions before an inverted light microscopy (Leica DM4000 B, Germany) was used for observation and Leica DFC420C camera (Leica Microsystems GmbH) to capture images.
Obtained results were analyzed and quantified by two observers. Three parameters (fibrocartilage formation, new bone formation and graft bonding to adjacent tissues) were considered in the final scoring (0-3 points/item, 0-9 points for total score) with higher scores representing enhanced results. Details of the scoring system are provided in Supplementary Table S2 (Cheng et al., 2016 (link)).
Immunohistochemical staining (IHC) for COL I, COL III and BMP-2 was carried. First, samples’ dewaxing and rehydration were carried before antigen-retrieval. Then, 0.3% hydrogen perioxide (20 min) and 2% bovine serum albumin (1 h) were used for blocking and primary anti-body incubation was carried over-night (4°C). Secondary antibody was used for incubation for 1 h at 37°C. Samples were then washed. Finally, observation of obtained images was completed under a light microscopy (Leica DM4000 B, Germany).

Cho E., Qiao Y., Chen C., Xu J., Cai J., Li Y, & Zhao J. (2023). Injectable FHE+BP composites hydrogel with enhanced regenerative capacity of tendon-bone interface for anterior cruciate ligament reconstruction. Frontiers in Bioengineering and Biotechnology, 11, 1117090.

Full text: Click here

Publication 2023

Antigens Bone Morphogenetic Protein 2 Bones Chondrogenesis Collagen Dehydration Edetic Acid Eosin Epistropheus Fast Green Fibrocartilage Fibromyalgia Formalin Glycosaminoglycans Grafts Hematoxylin Human Body Hydrogen Immunoglobulins Joints Light Microscopy Osteogenesis Rehydration safranine T Serum Albumin, Bovine Tissue Grafts Tissue Transplantation

Role of LAP in BMSC Osteogenesis

After being cultured on RSF/LAP hydrogels with gradient LAP content for 24 h, protein of the BMSCs was extracted for Western blot analysis to explore the role of LAP in the AKT signaling pathway. To further investigate the role of AKT signaling, 10 μM MK2206 (AKT1/2/3 inhibitor, Selleck, Houston, TX, USA) was used to suppress AKT phosphorylation. Western blot and real-time qPCR analyses were conducted after culturing on the RSF/LAP hydrogels for 24 h, while ALP staining was conducted to verify the osteogenic differentiation of BMSCs cultured for 7 days. The following primary antibodies were used against specific proteins: AKT (1:2000, Proteintech), p-AKT (1:2000, Cell signaling technology), BMP-2 (1:1000, Proteintech), and β-actin (1:2000, Absin). The experimental protocols of Western blot, real-time qPCR, and ALP staining were the same as previously described.

Sun L., Lu M., Chen L., Zhao B., Yao J., Shao Z., Chen X, & Liu Y. (2023). Silk–Inorganic Nanoparticle Hybrid Hydrogel as an Injectable Bone Repairing Biomaterial. Journal of Functional Biomaterials, 14(2), 86.

Full text: Click here

Publication 2023

Actins AKT1 protein, human Antibodies Bone Morphogenetic Protein 2 Hydrogels MK 2206 Osteogenesis Phosphorylation Proteins Signal Transduction Pathways Western Blot

Honeycomb Tricalcium Phosphate Bone Graft

A 1:2 mixture of CaHPO₄·2H₂O powder and CaCO₃ was prepared, and a slurry was formed by mixing and grinding with water for 24 h in a ball mill. After the slurry was dried, it was pressed in a cylindrical mold with a depth of 5 mm containing through-and-through pores with diameters of 300 μm (300TCP) and 500 μm (500TCP). Each TCP was calcinated by heating to 1200 °C at a rate of 50 °C h⁻¹ and holding at that temperature for 1 h. (Figure 1). The details of the honeycomb TCP manufacturing method and properties such as surface properties and crystalline elementary properties were described previously [15 (link)].
Each TCP structure was sterilized by autoclave and loaded with BMP-2 diluted to a final contained amount of 1000 ng in Matrigel^® (BD Bioscience). Next, these TCPs were implanted into rat femoral muscles [16 (link),17 (link)].

Inada Y., Takabatake K., Tsujigiwa H., Nakano K., Shan Q., Piao T., Chang A., Kawai H, & Nagatsuka H. (2023). Novel Artificial Scaffold for Bone Marrow Regeneration: Honeycomb Tricalcium Phosphate. Materials, 16(4), 1393.

Full text: Click here

Publication 2023

Bone Morphogenetic Protein 2 Carbonate, Calcium Femur Fungus, Filamentous matrigel Muscle Tissue N-(3,4,5-trichlorophenyl)succinimide Powder Surface Properties

Osteogenic Differentiation of SHED, CD146+ SHED, and CD146- SHED

SHED, CD146 + SHED, and CD146-SHED were cultured at 37°C under 5% CO₂. After the cells reached 80% confluence, induction of differentiation was initiated with the osteodifferentiation induction medium described above. The cells were harvested before induction, and at 21 and 28 days after induction. The mRNA expression levels of alkaline phosphatase (ALP), osteocalcin (OCN, a bone transcription factor), and bone morphogenetic protein-2 (BMP-2) were determined using quantitative real-time polymerase chain reaction (RT-PCR) analysis with QuantiTect SYBR Green PCR master mix (Qiagen, Valencia, CA, USA) with a LightCycler^® 480 II instrument (Roche Diagnostics). Total RNA was extracted from cells using an RNeasy Mini kit (Qiagen) and quantified using a NanoDrop One/Onec spectrophotometer (Thermo Fisher Scientific, Inc., Waltham, MA, USA). RNA purity was also assessed using this instrument based on the OD 260/OD 280 ratio; only samples with an A260/A280 ratio of 1.5–2.0 were used for further analysis. Subsequently, 1 μg of purified total RNA was reverse-transcribed to cDNA using a ReverTra Ace first-strand cDNA synthesis kit (Toyobo, Osaka, Japan). RT-PCR was performed using Thunderbird SYBR qPCR mix (Toyobo) with specific primer sets (Table 1).

Kunimatsu R., Rikitake K., Yoshimi Y., Putranti N.A., Hayashi Y, & Tanimoto K. (2023). Bone Differentiation Ability of CD146-Positive Stem Cells from Human Exfoliated Deciduous Teeth. International Journal of Molecular Sciences, 24(4), 4048.

Full text: Click here

Publication 2023

Alkaline Phosphatase Anabolism Bone Morphogenetic Protein 2 Bones Cells Diagnosis DNA, Complementary Oligonucleotide Primers Osteocalcin Real-Time Polymerase Chain Reaction Reverse Transcriptase Polymerase Chain Reaction RNA, Messenger SYBR Green I Transcription Factor

Top products related to «Bone Morphogenetic Protein 2»

Trizol reagent by Thermo Fisher Scientific

Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand

TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.

Bmp 2 by R&D Systems

Sourced in United States, Germany, United Kingdom, China

BMP-2 is a recombinant human bone morphogenetic protein-2 (rhBMP-2) laboratory product produced by R&D Systems. BMP-2 is a member of the transforming growth factor-beta (TGF-β) superfamily and is involved in the regulation of bone and cartilage development.

Dexamethasone (dex) by Merck Group

Sourced in United States, Germany, United Kingdom, China, Japan, Italy, Sao Tome and Principe, Macao, France, Australia, Switzerland, Canada, Denmark, Spain, Israel, Belgium, Ireland, Morocco, Brazil, Netherlands, Sweden, New Zealand, Austria, Czechia, Senegal, Poland, India, Portugal

Dexamethasone is a synthetic glucocorticoid medication used in a variety of medical applications. It is primarily used as an anti-inflammatory and immunosuppressant agent.

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

Bmp 2 by Thermo Fisher Scientific

Sourced in United States, Germany

The BMP-2 is a lab equipment product manufactured by Thermo Fisher Scientific. It is a recombinant human bone morphogenetic protein-2 used for in vitro research applications.

Trizol by Thermo Fisher Scientific

Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines

TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.

Ascorbic acid by Merck Group

Sourced in United States, Germany, United Kingdom, France, Italy, India, China, Sao Tome and Principe, Canada, Spain, Macao, Australia, Japan, Portugal, Hungary, Brazil, Singapore, Switzerland, Poland, Belgium, Ireland, Austria, Mexico, Israel, Sweden, Indonesia, Chile, Saudi Arabia, New Zealand, Gabon, Czechia, Malaysia

Ascorbic acid is a chemical compound commonly known as Vitamin C. It is a water-soluble vitamin that plays a role in various physiological processes. As a laboratory product, ascorbic acid is used as a reducing agent, antioxidant, and pH regulator in various applications.

β glycerophosphate by Merck Group

Sourced in United States, Germany, United Kingdom, Japan, Italy, China, Sao Tome and Principe, France, Canada, Australia, Macao, India, Senegal, Ireland, Spain, Denmark, Belgium

β-glycerophosphate is a chemical compound that serves as a buffering agent and source of phosphate for cell culture media. It helps maintain a stable pH environment for cell growth and proliferation.

Streptomycin by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, China, France, Canada, Australia, Japan, Switzerland, Italy, Belgium, Israel, Austria, Spain, Netherlands, Poland, Brazil, Denmark, Argentina, Sweden, New Zealand, Ireland, India, Gabon, Macao, Portugal, Czechia, Singapore, Norway, Thailand, Uruguay, Moldova, Republic of, Finland, Panama

Streptomycin is a broad-spectrum antibiotic used in laboratory settings. It functions as a protein synthesis inhibitor, targeting the 30S subunit of bacterial ribosomes, which plays a crucial role in the translation of genetic information into proteins. Streptomycin is commonly used in microbiological research and applications that require selective inhibition of bacterial growth.

Penicillin by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, China, France, Canada, Japan, Australia, Switzerland, Italy, Israel, Belgium, Austria, Spain, Brazil, Netherlands, Gabon, Denmark, Poland, Ireland, New Zealand, Sweden, Argentina, India, Macao, Uruguay, Portugal, Holy See (Vatican City State), Czechia, Singapore, Panama, Thailand, Moldova, Republic of, Finland, Morocco

Penicillin is a type of antibiotic used in laboratory settings. It is a broad-spectrum antimicrobial agent effective against a variety of bacteria. Penicillin functions by disrupting the bacterial cell wall, leading to cell death.

What are the different types or variations of Bone Morphogenetic Protein 2 (BMP2)?

Bone Morphogenetic Protein 2 (BMP2) is a member of the transforming growth factor-beta (TGF-β) superfamily. While there is primarily one main form of BMP2, researchers have identified several naturally occurring BMP2 variants and isoforms that can exhibit slightly different biological activities and functions. These include BMP2A, BMP2B, and various post-translationally modified versions of BMP2. Understanding the unique characteristics of these BMP2 variants is important when selecting the appropriate form for your specific research or therapeutic applications.

What are some of the key applications of Bone Morphogenetic Protein 2 (BMP2)?

Bone Morphogenetic Protein 2 (BMP2) has been widely studied for its therapeutic potential in a variety of applications, including: - Bone and cartilage regeneration: BMP2 plays a critical role in the differentiation of osteoblasts and chondrocytes, making it a valuable tool for bone and cartilage repair, such as in the treatment of fractures, non-unions, and degenerative joint diseases. - Tissue engineering: BMP2 has been utilized in tissue engineering strategies to promote the growth and development of various tissue types, including bone, cartilage, and even cardiovascular tissues. - Wound healing: BMP2 has been shown to enhance wound healing and tissue repair processes, making it a potential candidate for wound management applications. - Spinal fusion: BMP2 has been approved by the FDA for use in certain spinal fusion procedures to stimulate bone growth and improve surgical outcomes.

How can PubCompare.ai help optimize Bone Morphogenetic Protein 2 (BMP2) research?

PubCompare.ai's AI-driven protocol comparison tool can significantly optimize your Bone Morphogenetic Protein 2 (BMP2) research in several ways: 1. Screnning protocol literature more efficiently: The platform's advanced search and filtering capabilities allow you to quickly identify and compare the most relevant BMP2-related protocols from the literature, pre-prints, and patents. 2. Leveraging AI to pinpoint critical insights: PubCompare.ai's AI-powered analysis can help you uncover key differences in protocol effectiveness, enabling you to select the most optimal BMP2 protocols for your specific research goals and ensure reproducibility and accuracy. 3. Identifying the best BMP2 protocols and products: The platform's comprehensive database and AI-driven recommendations can assist you in finding the most effective BMP2-related protocols and products, saving you time and improving your research outcomes.

What are some common usage challenges or considerations when working with Bone Morphogenetic Protein 2 (BMP2)?

When working with Bone Morphogenetic Protein 2 (BMP2), researchers may encounter the following usage challenges or considerations: - Dosage optimization: Determining the optimal dosage of BMP2 for specific applications can be critical, as too much or too little can lead to suboptimal outcomes. - Delivery method: Choosing the appropriate delivery method, such as local injection, scaffold-based delivery, or controlled release formulations, can significantly impact the efficacy of BMP2 treatments. - Tissue-specific response: The response to BMP2 can vary depending on the target tissue, and researchers must consider the unique characteristics and requirements of different tissue types. - Potential side effects: While BMP2 is generally well-tolerated, there have been reports of adverse events, such as ectopic bone formation, that must be carefully monitored and managed. Careful planning and optimization of BMP2 usage, as well as close collaboration with PubCompare.ai's AI-driven platform, can help researchers navigate these challenges and maximize the benefits of this powerful morphogen.

More about "Bone Morphogenetic Protein 2"

Bone Morphogenetic Protein 2 (BMP2) is a crucial member of the transforming growth factor-beta (TGF-β) superfamily, playing a pivotal role in the development and regulation of bone, cartilage, and various other cellular processes.
This potent morphogenetic protein is essential for osteoblast and chondrocyte differentiation, as well as skeletal patterning and fracture repair.
BMP2 has been extensively studied for its therapeutic potential in the treatment of bone and cartilage disorders, as well as in tissue engineering and regenerative medicine applications.
Researchers can leverage the power of PubCompare.ai's AI-driven protocol comparison tool to optimize their BMP2-related studies.
This platform helps identify the best protocols and products from the literature, preprints, and patents, saving time and improving research outcomes.
By incorporating synonyms like 'BMP-2' and related terms such as 'TRIzol reagent', 'Dexamethasone', 'FBS', 'Ascorbic acid', 'β-glycerophosphate', 'Streptomycin', and 'Penicillin', researchers can gain a comprehensive understanding of the essential elements involved in BMP2 research and development.
With PubCompare.ai's user-friendly interface and powerful capabilities, scientists can optimize their studies and accelerate breakthroughs in the field of bone and cartilage regeneration.