Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > Caveolin 1

Caveolin 1

Caveolins are a family of integral membrane proteins that are the principal components of caveolae, invaginations of the plasma membrane.
Caveolin-1 is the most widely expressed and studied member of this family.
It plays a crucial role in the formation and function of caveolae, serving as a scaffolding protein to concentrate and organize signaling molecules within caveolar membranes.
Caveolin-1 has been implicated in a variety of cellular processes, including vesicular transport, cholesterol homeostasis, and signal transduction.
Dysregulation of caveolin-1 has been assocaited with various pathological conditions, making it an important target for biomedical research.

Most cited protocols related to «Caveolin 1»

1
Protein Extraction and Western Blot Analysis
Cited 19 times
Cells and tissues were lysed in RIPA buffer. Tumors were ground in liquid nitrogen and lysed. Protein concentration was determined using the BCA Kit (Beyotime Institute of Biotechnology). Proteins were mixed with loading buffer and heated at 70°C for 10 minutes on sodium dodecyl sulfate (SDS)-polyacrylamide gels at 30 μg per lane. The proteins were transferred to polyvinylidene fluoride (PVDF, Millipore, MA, USA) after electrophoresis. Membranes were blocked for 2 hours in 5% BSA and incubated overnight at 4°C with antibodies against γ-H2AX, ATM, ATR, Chk1, cell-cycle controller-2 (Cdc2), E-cadherin, vimentin, caspase-3, and caveolin-1 (Cav-1). The blots were then incubated with HRP-conjugated secondary antibody (1:1000; Santa Cruz Biotechnology). Finally, bands were visualized by enhanced chemiluminescence (Thermo Scientific Pierce, IL, USA).
Tian Y., Xie Q., He J., Luo X., Zhou T., Liu Y., Huang Z., Tian Y., Sun D, & Yao K. (2015). Radioactive 125I seeds inhibit cell growth and epithelial-mesenchymal transition in human glioblastoma multiforme via a ROS-mediated signaling pathway. BMC Cancer, 15, 1.
Full text: Click here
Publication 2015
Antibodies Buffers Caspase 3 Caveolin 1 Cell Cycle Cells Chemiluminescence E-Cadherin Electrophoresis Immunoglobulins Neoplasms Nitrogen polyacrylamide gels polyvinylidene fluoride Proteins Radioimmunoprecipitation Assay Sulfate, Sodium Dodecyl Tissue, Membrane Tissues Vimentin
2
In Vivo Knockdown of Caveolin and S1P1 Receptor
Cited 12 times
Adult male C57BL/6J mice, 8 to 10 weeks old, with an average weight of 20 to 25 g (The Jackson Laboratory, Bar Harbor, Me) were bred at the University of Chicago animal care center. All experimental protocols involving the use of animals were approved by the University of Chicago Institutional Animal Care & Use Committee for the humane treatment of experimental animals. Small interfering (si)RNAs from Dharmacon (Lafayette, Colo) had the following sequences: siCaveolin1: 5′-ACGUAGACUCCGAGGGACA-3′; siS1P1 receptor: 5′-CUUGCUAACUAUUUGGAAA-3′; control siRNA (Luciferase): 5′-UAAGGCUAUGAAGAGAUA-3′. Polyethylenimine-22, which provides preferential RNA targeting to the lung,18 (link) was used as a carrier in the in vivo experiments with siRNA-induced caveolin and S1P1 receptor knockdown in vivo. Obtained polyethylenimine-22–siRNA polyplexes (400 μL) were injected into the jugular vein of the 8- to 10-week-old C57BL/6 male mice under anesthesia. After 72 hours, the mice were subjected to mechanical ventilation or Evan’s blue dye and euthanized; lungs, livers, and hearts were collected and homogenized as previously described.19 (link)
Singleton P.A., Chatchavalvanich S., Fu P., Xing J., Birukova A.A., Fortune J.A., Klibanov A.M., Garcia J.G, & Birukov K.G. (2009). Akt-Mediated Transactivation of the S1P1 Receptor in Caveolin-Enriched Microdomains Regulates Endothelial Barrier Enhancement by Oxidized Phospholipids. Circulation research, 104(8), 978-986.
Publication 2009
Adult Anesthesia Animal Care Committees Animals Caveolin 1 Evans Blue Heart Jugular Vein Liver Luciferases Lung Males Mechanical Ventilation Mice, Inbred C57BL Mus Polyethyleneimine RNA, Small Interfering Sphingosine-1-Phosphate Receptor 1 Therapies, Investigational
3
Lentiviral Transduction of Caveolin-1 shRNA in MDA-MB-231 Cells
Cited 6 times
The oligonucleotide containing shRNA candidates for caveolin-1 (#1-1, CCAGTTAGATTTAGGGATTTA; #1-2, CCGCTTGTTGTCTACGATCTT; #1-3, CGACGTGGTCAAGATTGACTT; #1-4, TGAAGCTATTGGCAAGATATT; and #1-5, GCTTCCTGATTGAGATTCAGT) or control shRNA for Luciferase (CGCTGAGTACTTCGAAATGTC) were cloned into the lentiviral vector pLKO.1, which contains a puromycin resistance gene and the U6 promoter to control the shRNA. Lentiviral particles were prepared by co-transfecting HEK-293T cells (packaging) with the pLKO.1 vector and plasmids encoding the envelope protein VSV-g (pHCMV-G) and the packaging plasmid p?8.9 (pCMV?R8.9) as described [44] (link). Post-transfection (48 hours), media containing lentivirus were filtered through a 0.45 µm filter and used to transduce MDA-MB-231 cells in the presence of 8 µg/ml polybreen. After 24 hours cells were selected with puromycin (2µg/ml) for seven days and expression was monitored by Western blotting. Plasmids encoding the envelope protein VSV-g (pHCMV-G), the packaging plasmid p?8.9 (pCMV?R8.9) and pLKO.1 plasmids containing shRNA for caveolin-1 and control plasmid containing shRNA for Luciferase (shLuc) were provided by Dr. Claudio Hetz (Universidad de Chile, Santiago, Chile).
Urra H., Torres V.A., Ortiz R.J., Lobos L., Díaz M.I., Díaz N., Härtel S., Leyton L, & Quest A.F. (2012). Caveolin-1-Enhanced Motility and Focal Adhesion Turnover Require Tyrosine-14 but Not Accumulation to the Rear in Metastatic Cancer Cells. PLoS ONE, 7(4), e33085.
Full text: Click here
Publication 2012
Caveolin 1 Cells Cloning Vectors G-substrate Genes HEK293 Cells Lentivirus Luciferases MDA-MB-231 Cells Oligonucleotides Plasmids Puromycin Short Hairpin RNA Transfection
4
Proximal Tubule Marker Identification
Cited 6 times
Markers of proximal tubules used were: Lotus tetragonolobus agglutinin (LTA), γglutamyl transpeptidase (GGT), megalin (MEG), aminopeptidase A (APA), aminopeptidase N (APN / CD13) and villin. Levels of genes expressed in proximal tubule as well as other segments include NHE3 (proximal tubule and thick ascending limb15 (link) and caveolin-1 (proximal tubule, distal tubule, glomerulus and cortical collecting duct).16 (link)–17 Markers of cells from other nephron segments which served as negative controls were Tamm-Horsfall protein (THP) 18 (link) and sodium chloride co-transporter (NCC).19 (link) Controls for non-specific secondary antibody binding were performed for each cell type. See the Online Supplement and Table S1 for details about the antibodies and staining.
Gildea J.J., Shah I., Weiss R., Casscells N.D., McGrath H.E., Zhang J, & Felder R.A. (2010). The HK-2 human renal proximal tubule cell as a model for GRK4-mediated dopamine-1 receptor uncoupling. Hypertension, 56(3), 505-511.
Publication 2010
Alanine Aminopeptidase Aminopeptidase, Glutamyl Antibodies Caveolin 1 Cells Dietary Supplements gamma-Glutamyl Transpeptidase Genes Immunoglobulins Kidney Cortex Kidney Glomerulus Kidney Tubules, Proximal LDL-Receptor Related Protein 2 Lotus Tetragonolobus agglutinin Nephrons Sodium Chloride Symporters Tamm-Horsfall Protein villin
5
Membrane Fractionation and Translocon Protein Detection
Cited 5 times
Membrane isolation and detection of translocon proteins was performed as described previously37 (link). Briefly, Vim+/+ and Vim−/− MEFs, seeded at 6×106 cells per 10cm tissue culture-treated dish, were infected with early exponential phase bacteria in 2.5mL of DMEM supplemented with 10% FBS at an MOI of 100 for 1 hour at 37°C. For strains carrying an arabinose inducible construct, DMEM without glucose was used. The cells were washed 3 times with ice-cold PBS, scraped off the dish into ice-cold PBS containing protease inhibitors, and recovered by centrifugation at 225xg for 5 min at 25°C. The cell pellet was cooled on ice for 5 min and was resuspended in ice-cold 50mM Tris, pH 7.5 containing protease inhibitors and 0.2% saponin. After incubation on ice for 20 min and centrifugation at 16,100xg at 4°C for 30 min, the saponin-solubilized supernatant (cytosolic fraction) was collected, and the pellet was resuspended in 50mM Tris, pH 7.5 containing protease inhibitors and 1% Triton X-100. After additional incubation on ice for 30 min and centrifugation at 16,100xg at 4°C for 15 min, the Triton X-100-soluble supernatant (membrane fraction) was collected, and the pellet (detergent insoluble cellular debris and intact bacteria) was resuspended in 50mM Tris, pH 7.5 containing protease inhibitors and 1% Triton X-100. Western blots were performed using mouse anti-DnaK (Stressgen, SPA-880), rabbit anti-vimentin (Cell Signaling, 3932S), mouse anti-GAPDH (abcam, ab9484), rabbit anti-caveolin-1 (Sigma, C4490), rabbit anti-IpaC (gift from W. Picking), and rabbit anti-IpaB (gift of W. Picking).
Russo B.C., Stamm L.M., Raaben M., Kim C.M., Kahoud E., Robinson L.R., Bose S., Queiroz A.L., Herrera B.B., Baxt L.A., Mor-Vaknin N., Fu Y., Molina G., Markovitz D.M., Whelan S.P, & Goldberg M.B. (2016). Intermediate filaments enable pathogen docking to trigger type 3 effector translocation. Nature microbiology, 1, 16025.
Publication 2016
Arabinose Bacteria Caspase 1 Caveolin 1 Cells Centrifugation Common Cold Cytosol Detergents GAPDH protein, human Glucose Hyperostosis, Diffuse Idiopathic Skeletal inhibitors isolation Mus Protease Inhibitors Proteins Rabbits Saponin Strains Tissue, Membrane Tissues Triton X-100 Tromethamine Vimentin Western Blot

Most recents protocols related to «Caveolin 1»

1
Characterization of HTLV-1 protein interactions
WJ460 (DMSO) was purchased from Glixx Laboratories Inc. or MedChem Express; A-485 (DMSO), vacuolin-1 (DMSO) and apilimod (DMSO) were purchased from MedChem Express; EGA (DMSO), leupeptin (H2O) and pepstatin A (DMSO) were purchased from MilliporeSigma; E64D (DMSO) was purchased from Cayman Chemical. Compounds were purchased in solution or reconstituted and were aliquoted and stored at -20°C or -80°C as recommended by the manufacturers. Viability following treatment with WJ460 was assessed using alamarBlue (Bio-Rad) according to the manufacturer’s instructions. Cells were transfected using Turbofect (Thermo Fisher Scientific) according to the manufacturer’s instructions and harvested 24 h later. Whole cell extracts were prepared, and western blotting was done as described [98 (link)]. Affinity enrichment of HBZ using GST-KIX was done as described [34 (link)]. Antibodies used were as follows: anti-HTLV-1 Env (ARP-1578) and anti-Tax (hybridoma 168B17-46-92) were obtained from NIH AIDS Research and Reagent Program; anti-HBZ has been described [99 (link)]; anti-6x His (ab9108) was purchased from Abcam; anti-MyoF (HPA014245) and anti-Myc (06–340) were purchased from MilliporeSigma; anti-HTLV-1 Env gp46 (1C11, sc-53890; 65/6C2.2.34, sc-57865), anti-Gag p19 (TP7, sc-57870) and anti-β-actin (C4, sc-47778) were purchased from Santa-Cruz; anti-clathrin (D3C6, #4796), anti-caveolin-1 (D46G3, #3267), anti-EEA1 (C45B10, #3288), anti-Rab5a (E6N8S, #46449), anti-Rab7 (D95F2, #9367), anti-Rab11 (D4F5, #5589), anti-LAMP-1 (D2D11, #9091) were purchased from Cell Signaling; anti-EHD2 (PA5-80576) was purchased from ThermoFisher Scientific. All blots were developed using Pierce ECL 2 (Thermo Fisher Scientific) and scanned with a Typhoon RGB imager (Cytiva). Immunoblot quantification was performed using ImageQuant TL v8.1 (Cytiva). To enrich Env SU/gp46 when transiently expressed in HEK293T cells, whole cell extracts were immunoprecipitated with Lens Culinary Agglutinin lectin bound to agarose beads (Vector Laboratories) [26 (link)] and beads resuspended in SDS loading dye.
Polakowski N., Sarker M.A., Hoang K., Boateng G., Rushing A.W., Kendle W., Pique C., Green P.L., Panfil A.R, & Lemasson I. (2023). HBZ upregulates myoferlin expression to facilitate HTLV-1 infection. PLOS Pathogens, 19(2), e1011202.
Full text: Click here
Publication 2023
Acquired Immunodeficiency Syndrome Actins Agglutinins Alamar Blue Antibodies apilimod Caimans Caveolin 1 Cell Extracts Cells Clathrin Cloning Vectors Human T-lymphotropic virus 1 Hybridomas Immunoblotting Lectin Lens, Crystalline leupeptin lysosomal-associated membrane protein 1, human pepstatin Sepharose Sulfoxide, Dimethyl Typhoons vacuolin-1
2
Comprehensive Antibody Characterization for Cell Biology
Primary antibodies used in this study were anti‐Rab21 (R4405, Sigma), anti‐Rab5 (3547, Cell Signaling Technology; 46449, Cell Signaling Technology), anti‐APPL1 (3858, Cell Signaling Technology), anti‐EEA1 (07‐292, Upstate; 610456, BD Biosciences), anti‐caveolin‐1 (3238, Cell Signaling Technology for staining and immunoblotting; 610406, BD Biosciences for staining; 3267, Cell Signaling Technology for immunoblotting), anti‐Rab11 (5589, Cell Signaling Technology), anti‐Rab7 (9367, Cell Signaling Technology), anti‐Rab6 (9625, Cell Signaling Technology), anti‐Lamp1 (sc‐19992, Santa Cruz), anti‐Syntaxin‐6 (610635, BD Biosciences), anti‐Calnexin (610523, BD Biosciences), anti‐KDEL (sc‐58774, Santa Cruz), anti‐TfR (13‐6800, Invitrogen), anti‐CD44 (NB100‐65905, Novus), anti‐Endophilin‐II (sc‐365704, Santa Cruz), anti‐GFP (A‐6455, Molecular Probes; 04404‐84, Nacalai; AB16901, Millipore), anti‐mAG1 (PM052M, MBL), anti‐HA (2367, Cell Signaling Technology), anti‐N‐cadherin (C3865, Sigma; sc‐7939, Santa Cruz Biotechnology; ab98952, Abcam), anti‐Phospho Histone H3 (9701, Cell Signaling Technology), anti‐Ki67 (NCL‐Ki67p, Leica), anti‐βIII tubulin (Tuj1) (MMS‐435P, Covance), anti‐MAP2ab (ab11268, Abcam), anti‐β‐tubulin (T5201, Sigma), and anti‐β‐actin (A5441, Sigma). BODIPY‐FL C5‐LacCer (LacCer), Alexa555‐conjugated Cholera Toxin Subunit B (CTxB) and Alexa594‐ or Alexa555‐conjugated transferrin (Tf) were purchased from Molecular Probes. 4′,6‐diamidino‐2‐phenylindole dihydrochloride solution (DAPI), and Bafilomycin A1 were purchased from Wako (340‐07971) and Sigma (SML‐1661), respectively.
Shikanai M., Ito S., Nishimura Y.V., Akagawa R., Fukuda M., Yuzaki M., Nabeshima Y, & Kawauchi T. (2023). Rab21 regulates caveolin‐1‐mediated endocytic trafficking to promote immature neurite pruning. EMBO Reports, 24(3), e54701.
Full text: Click here
Publication 2023
Actins Alexa594 Antibodies bafilomycin A1 BODIPY-LacCer Cadherins Calnexin Caveolin 1 CD44 protein, human Choleragenoid DAPI Histone H3 lysosomal-associated membrane protein 1, human Molecular Probes Novus Syntaxin 6 Transferrin Tubulin
3
Western Blot Analysis of Extracellular Vesicle Markers
Both cell lysates and EV preparations, which were lysed in RIPA or 1X sample buffer, were electrophoretically separated using 10% mini‐PROTEAN precast gels (BioRad). Gels were loaded for western analysis with EV lysates extracted from the same protein mass of secreting cells, so that changes in band intensity on the blots with glutamine depletion reflected a net change in secretion of the marker on a per cell basis (see Fan et al., 2020 (link)). Protein preparations were ultimately dissolved in either reducing (containing 5% β‐mercaptoethanol) or non‐reducing (for CD63 and CD81 detection) sample buffer and were heated to 90°C–100°C for 10 min before loading with a pre‐stained protein ladder (Bio‐Rad). Proteins were wet‐transferred to polyvinylidene difluoride (PVDF) membranes at 100 V for 1 h using a Mini Trans‐Blot Cell (Bio‐Rad). Membranes were then blocked with either 5% milk (CD63 detection) or 5% BSA in TBS buffer with Tween‐20 (TBST) for 30 min and probed overnight at 4°C with primary antibody diluted in blocking buffer. The membranes were washed for 3 × 10 min with TBST, then probed with the relevant secondary antibodies for 1 h at 22°C, washed for 3 × 10 min again, and then the signals detected using the enhanced chemiluminescent detection reagent (Clarity, BioRad) and the Touch Imaging System (BioRad). Relative band intensities were quantified by ChemiDoc software (Bio‐Rad) or ImageJ. Signals were normalised to cell lysate protein (Fan et al., 2020 (link)).
Antibody suppliers, catalogue numbers and concentrations used were: rabbit anti‐CHMP1a (Proteintech #15761‐1‐AP, 1:500), rabbit anti‐CHMP1b (Proteintech #14639‐1‐AP, 1:500), rabbit anti‐IST1 (Biorad #VPA00314, 1:500), mouse anti‐CHMP5 (Santa Cruz #sc‐374338, 1:500), rabbit anti‐4E‐BP1 (Cell Signaling Technology #9644, rabbit anti‐p‐4E‐BP1‐Ser65 (Cell Signaling Technology #9456, 1:1000), rabbit anti‐S6 (Cell Signaling Technology #2217, 1:4000), rabbit anti‐p‐S6‐Ser240/244 S6 (Cell Signalling Technology #5364, 1:4000), rabbit anti‐Caveolin‐1 (Cell Signaling Technology #3238, 1:500), goat anti‐AREG (R&D Systems #AF262, 1:200), mouse anti‐Tubulin (Sigma #T8328, 1:4000), mouse anti‐CD81 (Santa Cruz #23962, 1:500), mouse anti‐CD63 (BD Biosciences # 556019, 1:500), rabbit anti‐Syntenin‐1 antibody (Abcam ab133267, 1:500), rabbit anti‐Tsg101 (Abcam ab125011, 1:500), mouse anti‐Rab11 (BD Biosciences #610657, 1:500), sheep anti‐TGN46 (BioRad; AHP500G, 1:1000), rabbit anti‐EEA1 (Cell Signalling Technology #3288, 1:1000) , anti‐mouse IgG (H+L) HRP conjugate (Promega #W4021, 1:10000), anti‐rabbit IgG (H+L) HRP conjugate (Promega #W4011, 1:10000), anti‐goat IgG (H+L) HRP conjugate (R&D Systems #HAF109, 1:100).
Marie P.P., Fan S., Mason J., Wells A., Mendes C.C., Wainwright S.M., Scott S., Fischer R., Harris A.L., Wilson C, & Goberdhan D.C. (2023). Accessory ESCRT‐III proteins are conserved and selective regulators of Rab11a‐exosome formation. Journal of Extracellular Vesicles, 12(3), 12311.
Full text: Click here
Publication 2023
2-Mercaptoethanol anti-IgG Antibodies Antibodies, Anti-Idiotypic AREG protein, human Buffers Caveolin 1 Cells Domestic Sheep EIF4EBP1 protein, human Gels Glutamine Goat Immunoglobulins Milk, Cow's Mus polyvinylidene fluoride Promega Proteins Proto-Oncogene Mas Rabbits Radioimmunoprecipitation Assay secretion Syntenin-1 Tissue, Membrane Touch TSG101 protein, human Tubulin Tween 20
4
Evaluating TPGS Cellular Uptake and Inhibitors
To evaluate TPGS cell uptake efficiency, MCF-7-ADR cells were seeded into 24-well plates at 1 × 105 cells/well. After incubation at 37 °C for 24 h, cells were treated with complete medium containing different TPGS concentrations (0.5, 1, 2, and 4 mg/mL) for 1, 2, 4, 6, and 8 h. Then, 0.5% lauryl sodium sulfate was added and then lysed in a cell incubator for 5 min and collected in a centrifuge tube. After processing cells in methanol and centrifuging at 10,000 rpm for 10 min, cell supernatants were analyzed using high performance liquid chromatography (HPLC) (Agilent 1200, Agilent Technologies, Santa Clara, CA, USA) to determine TPGS levels. HPLC analyses were performed at 284 nm using a 1 mL/min flow rate. The mobile phase was consisted of methanol and 10 mM phosphoric acid in a 97:3 (v/v) ratio.
The effects of inhibitors (verapamil, sodium amide, chlorpromazine, and indomethacin) were also investigated. Verapamil is a P-gp efflux inhibitor, and sodium azide is an ATP inhibitor. Both chlorpromazine and indomethacin are endocytosis inhibitors, chlorpromazine is involved in clathrin-mediated endocytosis, and indomethacin is involved in caveolin-mediated endocytosis. Inhibitors were simultaneously added with TPGS to cells and co-cultured for 6 h. Other treatments were consistent with the cellular uptake experiments described above.
Tang L., Huang K., Jiang W., Fu L., Zhang R., Shen L., Ou Z., Huang Y, & Zhang Z. (2023). Exploration of the inhibition action of TPGS on tumor cells and its combined use with chemotherapy drugs. Drug Delivery, 30(1), 2183830.
Publication 2023
Amides Caveolin 1 Cells Chlorpromazine Clathrin Endocytosis High-Performance Liquid Chromatographies Indomethacin inhibitors MCF-7 Cells Methanol phosphoric acid Sodium Sodium Azide sodium sulfate tocophersolan Verapamil
5
Subcellular Proteome Extraction and Western Blotting
Total protein extracts of cell samples, BEC-EVs and BMSC-EVs, and isolated brain microvessels were collected, and ProteoExtract Subcellular Proteome Extraction Kit (539790, Calbiochem) was used to extract subcellular protein components in cytosolic fraction (CF), membrane fraction (MF), and actin cytoskeletal fraction (ACF) followed manufacture’s protocol. Samples with equal protein concentration were boiled, electrophoresis separated by 10% sodium dodecyl sulfate (SDS) polyacrylamide gels and transferred into 0.22 μm pore sized polyvinylidene difluoride (PVDF) membranes (1620177, Bio-Rad). After blocking in 5% skimmed milk, membranes were incubated with primary and secondary antibodies, and then washed by TBS-T (Tris-buffered saline with 0.1% Tween 20). ChemiDoc MP Imaging System (Bio-Rad) were applied for imaging. Bands grey value was calculated by ImageJ software and relative expression level of proteins was presented as ratio of β-actin or Fractions REF (Calpain I, Calnexin, Vimentin). Antibodies used in this study were as follows: ZO-1 (1:1000, 61–7300, Invitrogen); Claudin-5 (1:1000, 34–1600, Invitrogen); CD 31 (1:1000, ab281583, Abcam); NeuN (1:5000, ab104225, Abcam); β-actin (1:5000, ab8227,Abcam); Caveolin-1 (1:1000, ab2910, Abcam); TSG 101 (1:1000, ab125011, Abcam); HSP 70 (1:1000, ab137680, Abcam); Calpain I (1:1000, ab108400, Abcam); Calnexin (1: 1000, ab22595, Abcam); Vimentin (1:1000, ab92547, Abcam); Goat Anti-Rabbit IgG H&L (HRP) (1:3000, ab6721, Abcam); Goat Anti-Mouse IgG H&L (HRP) (1:3000, ab67879, Abcam); Normal rabbit IgG (1 μg/ml, 2729S, Cell Signaling Technology).
Li Y., Liu B., Zhao T., Quan X., Han Y., Cheng Y., Chen Y., Shen X., Zheng Y, & Zhao Y. (2023). Comparative study of extracellular vesicles derived from mesenchymal stem cells and brain endothelial cells attenuating blood–brain barrier permeability via regulating Caveolin-1-dependent ZO-1 and Claudin-5 endocytosis in acute ischemic stroke. Journal of Nanobiotechnology, 21, 70.
Full text: Click here
Publication 2023
Actins anti-IgG Antibodies Brain Calnexin Calpain I Caveolin 1 Cell Extracts Claudin-5 Cytoskeleton Cytosol Electrophoresis Goat Heat-Shock Proteins 70 Microvessels Milk, Cow's Mus polyacrylamide gels polyvinylidene fluoride Proteins Proteome Rabbits Saline Solution Subcellular Fractions Sulfate, Sodium Dodecyl Tissue, Membrane Tween 20 Vimentin

Top products related to «Caveolin 1»

1
Caveolin 1 by Cell Signaling Technology
Sourced in United States
Caveolin-1 is a protein that plays a key role in the formation and function of caveolae, specialized invaginations of the cell membrane. It is involved in the regulation of various cellular processes, including signal transduction, endocytosis, and cholesterol homeostasis.
2
Caveolin 1 by Santa Cruz Biotechnology
Sourced in United States, Germany
Caveolin-1 is a structural protein that is a key component of caveolae, flask-shaped invaginations of the plasma membrane. It plays a role in the regulation of signal transduction and membrane trafficking processes.
3
Pvdf membrane by Merck Group
Sourced in United States, Germany, China, United Kingdom, Morocco, Ireland, France, Italy, Japan, Canada, Spain, Switzerland, New Zealand, India, Hong Kong, Sao Tome and Principe, Sweden, Netherlands, Australia, Belgium, Austria
PVDF membranes are a type of laboratory equipment used for a variety of applications. They are made from polyvinylidene fluoride (PVDF), a durable and chemically resistant material. PVDF membranes are known for their high mechanical strength, thermal stability, and resistance to a wide range of chemicals. They are commonly used in various filtration, separation, and analysis processes in scientific and research settings.
4
Caveolin 1 by Abcam
Sourced in United States, United Kingdom
Caveolin-1 is a structural protein that is a major component of caveolae, which are invaginations of the plasma membrane. It plays a role in the formation and function of caveolae, and is involved in various cellular processes such as signal transduction, endocytosis, and cholesterol homeostasis.
5
Anti caveolin 1 by Cell Signaling Technology
Sourced in United States, China
Anti-caveolin-1 is a primary antibody that recognizes the caveolin-1 protein. Caveolin-1 is a structural component of caveolae, which are invaginations of the plasma membrane that play a role in various cellular processes.
6
Rabbit anti caveolin 1 by Cell Signaling Technology
Sourced in United States
Rabbit anti-caveolin-1 is a primary antibody that specifically binds to the caveolin-1 protein. Caveolin-1 is a structural component of caveolae, which are invaginations of the plasma membrane. This antibody can be used to detect and study the localization and expression of caveolin-1 in various cell types and tissues.
7
β actin by Merck Group
Sourced in United States, United Kingdom, Germany, China, Canada, Japan, Macao, Italy, Sao Tome and Principe, Israel, Spain, Denmark, France, Finland, Australia, Morocco, Ireland, Czechia, Sweden, Uruguay, Switzerland, Netherlands, Senegal
β-actin is a protein that is found in all eukaryotic cells and is involved in the structure and function of the cytoskeleton. It is a key component of the actin filaments that make up the cytoskeleton and plays a critical role in cell motility, cell division, and other cellular processes.
8
Bovine serum albumin (bsa) by Merck Group
Sourced in United States, Germany, United Kingdom, China, Italy, Japan, France, Sao Tome and Principe, Canada, Macao, Spain, Switzerland, Australia, India, Israel, Belgium, Poland, Sweden, Denmark, Ireland, Hungary, Netherlands, Czechia, Brazil, Austria, Singapore, Portugal, Panama, Chile, Senegal, Morocco, Slovenia, New Zealand, Finland, Thailand, Uruguay, Argentina, Saudi Arabia, Romania, Greece, Mexico
Bovine serum albumin (BSA) is a common laboratory reagent derived from bovine blood plasma. It is a protein that serves as a stabilizer and blocking agent in various biochemical and immunological applications. BSA is widely used to maintain the activity and solubility of enzymes, proteins, and other biomolecules in experimental settings.
9
β actin by Cell Signaling Technology
Sourced in United States, United Kingdom, China, Germany, Japan, Canada, Morocco, Sweden, Netherlands, Switzerland, Italy, Belgium, Australia, France, India, Ireland
β-actin is a cytoskeletal protein that is ubiquitously expressed in eukaryotic cells. It is an important component of the microfilament system and is involved in various cellular processes such as cell motility, structure, and integrity.

More about "Caveolin 1"

Caveolins are a family of integral membrane proteins that form caveolae, invaginations in the plasma membrane.
Caveolin-1 is the most extensively studied member of this family and plays a crucial role in caveolae formation and function.
It serves as a scaffolding protein, concentrating and organizing signaling molecules within caveolar membranes.
Caveolin-1 is implicated in various cellular processes, including vesicular transport, cholesterol homeostasis, and signal transduction.
Dysregulation of caveolin-1 has been associated with numerous pathological conditions, making it an important target for biomedical research.
To optimize your caveolin-1 research, consider utilizing PubCompare.ai, an AI-driven platform that enhances the reproducibility and accuracy of your work.
PubCompare.ai can help you easily locate the best protocols from literature, pre-prints, and patents using its intelligent comparison tools.
By maximizing the impact of your research with PubCompare.ai, you can ensure that your caveolin-1 studies are conducted at the highest level of efficiency and effectiveness.
When working with caveolin-1, it's important to consider related topics and techniques, such as PVDF membranes, anti-caveolin-1 antibodies (including rabbit anti-caveolin-1), and the use of β-actin and bovine serum albumin as controls and reference proteins.
Incorporating these elements into your research can provide a more comprehensive understanding of caveolin-1 and its role in cellular processes and disease mechanisms.