> Chemicals & Drugs > Amino Acid > Clathrin Heavy Chains

Clathrin Heavy Chains

Q: What are the different types or variations of Clathrin Heavy Chains?

There are two main isoforms of Clathrin Heavy Chains: Clathrin Heavy Chain 1 (CLTC) and Clathrin Heavy Chain 2 (CLTCL1). These isoforms have slightly different structures and functions, allowing the cell to fine-tune the assembly and disassembly of clathrin-coated vesicles in response to different cellular needs and conditions.

Clathrin Heavy Chains are a key component of clathrin-coated vesicles, which play a crucial role in endocytosis and intracellular trafficking.
These large, protein complexes are responsible for the formation of clathrin-coated pits, facilitating the internalization of various molecules and cargoes into the cell.
Clathrin Heavy Chains form the structural backbone of the clathrin lattice, providing the necessary scaffolding for the assembly and disassembly of these dynamic structures.
Understanding the function and regulation of Clathrin Heavy Chains is essential for investigating cellular processes such as signaling, nutrient uptake, and synaptic transmission.
Reserach in this area may lead to insights into disease mechanisms and the development of targeted therapies.

Most cited protocols related to «Clathrin Heavy Chains»

Knockdown of Clathrin and AP-2 in HeLaM Cells

Cited 46 times

HeLaM cells (Tiwari et al., 1987 (link)) were seeded at a density of 10⁶ cells per 9-cm dish. At least 2 h after seeding the cells, the first transfection was performed. For each 9-cm dish, 50 μl OligofectAMINE™ (Invitrogen) was added to 100 μl Opti-MEM^® I (Life Technologies), and the solution was incubated at RT for 5–10 min. This was then added to a second solution or 800 μl Opti-MEM^® I plus 50 μl 20 μM siRNA, and the mixture was incubated at RT for 15–20 min. Next, 4 ml Opti-MEM^® I was added to the siRNA mixture to make a final volume of 5 ml, and this was added to the cells after rinsing them once with Opti-MEM^® I. The transfection mixture was left for 4 h on the cells, after which 5 ml DME containing 20% FCS without antibiotics was added, and the cells were left in this mixture until they were trypsinized the following day. Two transfections were performed, on d 0 and d 2. The cells were trypsinized 24 h after each transfection and were seeded into two 9-cm dishes for the second transfection, whereas after the second transfection, they were plated onto coverslips or 35-mm dishes for uptake assays. For each experiment, an extra 35-mm dish was used to assay efficiency of knockdown.
Two independent siRNAs were used to investigate the effects of knockdown of each target. For AP-2, the targets were the α and μ2 subunits of the complex. The α-2 siRNA target sequence was AAGAGCAUGUGCACGCUGGCCA and the μ2-2 target sequence was AAGUGGAUGCCUUUCGGGUCA (other sequences, designated α-1 and μ2–1, were ineffective). The clathrin heavy chain target sequences were AAG-CUGGGAAAACUCUUCAGA (chc-1) and UAAUCCAAUUCGAAGACCAAU (chc-2). The control siRNA was a nonfunctional oligo, μ2–1, originally designed to knock down the μ2 subunit, target sequence AACACAGCAACCUCUACUUGG. All siRNAs were designed according to the manufacturer's instructions and were synthesized as Option C siRNAs by Dharmacon, Inc.

Motley A., Bright N.A., Seaman M.N, & Robinson M.S. (2003). Clathrin-mediated endocytosis in AP-2–depleted cells. The Journal of Cell Biology, 162(5), 909-918.

Publication 2003

Antibiotics Biological Assay Cells Clathrin Heavy Chains Hyperostosis, Diffuse Idiopathic Skeletal oligofectamine Oligonucleotides Protein Subunits RNA, Small Interfering Transfection

Purification and Labeling of Clathrin and Auxilin

Cited 5 times

Wild-type rat clathrin heavy chain and a mutant truncated at residue 1637 (and hence lacking the Hsc70-binding motif Q₁₆₃₈LMLT) were expressed in insect cells and purified as described 16 (link). Rat clathrin light chain a1 (LCa) containing the mutations D203E (to restore the epitope recognized by the antibody CVC.6 24 (link)) and C218S (to remove one of the two cysteines in the light-chain sequence) was expressed in E. coli and purified as described 16 (link). Cys187 of LCa was reacted with an excess of a maleimide functionalized fluorophore (Alexa Fluor 488 or DyLight 649). The free dye was removed by ultrafiltration and the labeled LCa was purified by anion exchange chromatography. To reconstitute fluorescent clathrin, heavy-chain trimers were incubated with labeled LCa at a molar ratio of 1:2.4 for 40 min at room temperature. UV-visible absorption spectroscopy showed that >90% of heavy chains were occupied with a labeled LCa.
The C-terminal fragment of bovine auxilin (residues 547–910) containing the clathrin-binding and J-domain functions was expressed in E. coli and purified as described 16 (link).
Bovine Hsc70 with an N-terminal His-tag was expressed in E. coli strain BL21-DE3 using a pProEX HTc vector. The C-terminus of Hsc70 was modified for site-specific labeling by adding a glycine and a cysteine residue (Supplementary Figure 5). Affinity purification was followed by TEV protease cleavage to remove the His-tag. Undigested fusion protein was removed by binding to Co beads. The C-terminal cysteine residue of Hsc70 was labelled with an excess of Alexa Fluor 568-C5-maleimide. Labeled Hsc70 was purified by gel filtration. The labeling yield determined using UV-visible absorption spectroscopy was ~97%. Hsc70 without C-terminal cysteine did not incorporate an appreciable amount of label. Labeled Hsc70–ATP was monomeric and exhibited normal uncoating activity.

Böcking T., Aguet F., Harrison S.C, & Kirchhausen T. (2011). Single-molecule analysis of a molecular disassemblase reveals the mechanism of Hsc70-driven clathrin uncoating. Nature structural & molecular biology, 18(3), 295-301.

Publication 2010

alexa 568 alexa fluor 488 Anions Auxilins Bos taurus Cells Chromatography Chromatography, Affinity Clathrin Clathrin Heavy Chains Clathrin Light Chains Cloning Vectors Cysteine Cytokinesis Epitopes Escherichia coli Gel Chromatography Glycine Immunoglobulins Insecta Light maleimide Molar Mutation Proteins Spectrum Analysis Strains TEV protease Ultrafiltration

Purification and Labeling of Clathrin and Auxilin

Cited 5 times

Publication 2010

Cloning and Expression of Myosin VI

Cited 5 times

The human myosin VI (+ large insert) was generated from KIAA 0389 clone from Human cDNA Bank Section, Kazusa DNA Research Institute, Japan, and cloned into the pEGFP-C3 vector for mammalian transient expression. Intact chicken myosin VI (+large insert) was expressed in Sf9 insect cells using the Baculovirus expression system and purified and checked for activity as described13 (link). Mouse monoclonal anti-clathrin X-22 and rabbit polyclonal anti-GFP antibodies were from AbCam and the rabbit polyclonal myosin VI tail antibody as previously described2 (link). Rabbit anti-clathrin heavy chain antibody used for the Western blot was from M.S. Robinson (CIMR, Cambridge).

Spudich G., Chibalina M.V., Au J.S., Arden S.D., Buss F, & Kendrick-Jones J. (2006). Myosin VI targeting to clathrin-coated structures and dimerisation is mediated by binding to Disabled-2 and PtdIns(4,5)P2. Nature cell biology, 9(2), 176-183.

Publication 2006

Anti-Antibodies Antibodies, Anti-Idiotypic Baculoviridae Chickens Clathrin Clathrin Heavy Chains Cloning Vectors DNA, Complementary Homo sapiens Immunoglobulins Insecta Mammals Mus myosin VI Rabbits Sf9 Cells Tail Transients Western Blotting

Immunofluorescence Staining and dSTORM Imaging of Clathrin in SK-MEL-2 Cells

Cited 4 times

All samples were imaged on round 24 mm high precision glass coverslips No. 1.5H (117640, Marienfeld, Lauda-Königshofen, Germany). Coverslips were cleaned overnight in a 1:1 mixture of concentrated HCl and methanol, rinsed with millipore water until neutral, dried and UV sterilized in a standard cell culture hood.
SK-MEL-2 cells (kind gift from David Drubin, described in Ref. 35 (link)) were cultured under adherent conditions in DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12) with GlutaMAX and phenol red (ThermoFisher 10565018) supplemented with 10% [v/v] FBS, ZellShield^™ (Biochrom AG, Berlin, Germany), and 30 mM HEPES at 37°C, 5% CO2 and 100% humidity. Cells were fixed using 3% [w/v] paraformaldehyde (PFA) in cytoskeleton buffer (CB; 10 mM MES pH 6.1, 150 mM NaCl, 5 mM EGTA, 5 mM D-glucose, 5 mM MgCl₂, described in Ref. 36 (link)) for 20 minutes. Fixation was stopped by incubation in 0.1% [w/v] NaBH₄ for 7 minutes. The sample was washed with PBS three times, and subsequently permeabilised using 0.01% [w/v] digitonin (Sigma-Aldrich, St. Louis, MO, USA) in PBS for 15 minutes. After washing twice with PBS, the sample was blocked with 2% [w/v] BSA in PBS for 60 minutes, washed again with PBS, and stained for 3–12 hours with anti-clathrin light chain (sc-28276, Santa Cruz Biotechnology, Dallas, TX, USA, diluted 1:300) and anti-clathrin heavy chain rabbit polyclonal antibodies (ab21679, Abcam, Cambridge, UK, diluted 1:500) in 1% [w/v] BSA in PBS. The sample was washed with PBS three times, and incubated with a donkey anti-rabbit secondary antibody (711-005-152, Jackson ImmunoResarch, West Grove, PA, USA), which was previously conjugated with Alexa Fluor 647-NHS at an average degree of labeling of 1.5, for 4 hours. Finally, the sample was washed three times with PBS prior to imaging.
For dSTORM imaging, coverslips were mounted in 500 μL blinking buffer (50 mM Tris pH 8, 10 mM NaCl, 10% [w/v] D-glucose, 35 mM 2-mercaptoethylamine (MEA), 500 μg/mL GLOX, 40 μg/mL catalase, 2 mM COT).

Li Y., Mund M., Hoess P., Deschamps J., Matti U., Nijmeijer B., Sabinina V.J., Ellenberg J., Schoen I, & Ries J. (2018). Optimal 3D single-molecule localization in real time using experimental point spread functions. Nature methods, 15(5), 367-369.

Publication 2018

Alexa Fluor 647 Anti-Antibodies Antibodies, Anti-Idiotypic Buffers Catalase Cell Culture Techniques Cells Clathrin Heavy Chains Clathrin Light Chains Cysteamine Cytoskeleton Digitonin Eagle Egtazic Acid Equus asinus Glucose HEPES Humidity Magnesium Chloride Methanol Nutrients paraform Rabbits Sodium Chloride Tromethamine

Most recents protocols related to «Clathrin Heavy Chains»

Antibody Identification and Characterization

The following primary antibodies were obtained from Dr Pietro De Camilli’s lab at Yale University: rabbit anti-SJ1, rabbit anti-Auxilin, mouse anti-Amphiphysin 1, mouse anti-Clathrin Heavy Chain, rabbit anti-pan-Dynamin, rabbit anti-pan-Endophilin, mouse anti-GAD65, rabbit anti-SNAP25, rabbit anti-Synapsin, mouse anti-VAMP2, rabbit anti-Synaptophysin and mouse anti-Syt1. The other antibodies used in this study were obtained from commercial sources as stated: rabbit anti-LRRK2 (ab133474, RRID: AB_2713963) from Abcam; mouse anti-α-synuclein (610786, RRID: AB_2748880), mouse anti-AP2 (611350, RRID: AB_398872) and mouse anti-Hip1R (612118, RRID: AB_399489) from BD Biosciences; rabbit anti-DARPP-32 (2306, RRID: AB_823479) and rabbit anti-NPY (11976, RRID: AB_2716286) from Cell Signaling Technology; mouse anti-α-adaptin (MA1-064, RRID: AB_2258307) from Life Technologies; mouse anti-Amph2 (05-449, RRID: AB_309738), goat anti-ChAT (AB144P, RRID: AB_2079751), mouse anti-CLC (AB9884, RRID: AB_992745), rat anti-DAT (MAB369, RRID: AB_2190413), mouse anti-SV2C (MABN367, RRID: AB_2905667) and rabbit anti-TH (AB152, RRID: AB_390204) from Merck Millipore; mouse anti-β-actin (sc-47778, RRID: AB_2714189) and mouse anti-Hsc70 (sc-7298, RRID: AB_627761) from Santa Cruz Biotechnology; rabbit anti-Auxilin (HPA031182, RRID: AB_10611957), rabbit anti-GABA (A2052, RRID: AB_477652), rabbit anti-GFAP (ZRB2383, RRID: AB_2905668) and rabbit anti-SJ1 (HPA011916, RRID: AB_1857692) from Sigma-Aldrich; rabbit anti-Amphiphysin 1 (120002, RRID: AB_887690), rabbit anti-AADC (369003, RRID: AB_2620131), rabbit anti-SV2B (119102, RRID: AB_887803), rabbit anti-SV2C (119202, RRID: AB_887803), rabbit anti-Synaptogyrin 3 (103 302, RRID: AB_2619752), and rabbit anti-Syt11 (270003, RRID: AB_2619994) from Synaptic Systems; rabbit anti-Iba1 (019-19741, RRID: AB_839504) from FUJIFILM Wako Chemicals.
Secondary antibodies used were all purchased from commercial sources as stated: donkey anti-mouse IgG (H + L) Alexa Fluor 594 (A21203, RRID: AB_141633), goat anti-mouse IgG (H + L) Alexa Fluor 488 (A11001, RRID: AB_2534069), goat anti-mouse IgG (H + L) Alexa Fluor 594 (A11032, RRID: AB_2534091), goat anti-mouse IgG (H + L) Alexa Fluor 647 (A21236, RRID: AB_2535805), donkey anti-rabbit IgG (H + L) Alexa Fluor 488 (A21206, RRID: AB_2535792), goat anti-rabbit IgG (H + L) Alexa Fluor 488 (A11034, RRID: AB_2576217), goat anti-rabbit IgG (H + L) Alexa Fluor 594 (A11037, RRID: AB_2534095), goat anti-rabbit IgG (H + L) Alexa Fluor 647 (A21244, RRID: AB_2535812), goat anti-rat IgG (H + L) Alexa Fluor 488 (A11006, RRID: AB_2534074), goat anti-rat IgG (H + L) Alexa Fluor 594 (A11007, RRID: AB_10561522) and donkey anti-goat IgG (H + L) Alexa Fluor 488 (A11055, RRID: AB_2534102) from Life Technologies and IRDye 800CW donkey anti-rabbit IgG (926-32213, RRID: AB_621848), IRDye 800CW donkey anti-mouse IgG (926-32212, RRID: AB_621847), IRDye 680RD donkey anti-mouse IgG (926-68072, RRID: AB_10953628) and IRDye 800CW goat anti-rat (926-32219, RRID: AB_1850025) from LI-COR Biosciences.

Ng X.Y., Wu Y., Lin Y., Yaqoob S.M., Greene L.E., De Camilli P, & Cao M. (2023). Mutations in Parkinsonism-linked endocytic proteins synaptojanin1 and auxilin have synergistic effects on dopaminergic axonal pathology. NPJ Parkinson's Disease, 9, 26.

Full text: Click here

Publication 2023

Actins Alexa594 alexa fluor 488 Alexa Fluor 647 amphiphysin anti-IgG anti-synaptophysin Antibodies Auxilins Clathrin Heavy Chains DDC protein, human Dopamine and cAMP-Regulated Phosphoprotein 32 Dynamins Equus asinus gamma Aminobutyric Acid Glial Fibrillary Acidic Protein glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) protein, human Goat IRDye 800CW LRRK2 protein, human Mice, House Rabbits SNAP25 protein, human SNCA protein, human Synapsins Synaptogyrins SYT1 protein, human Vesicle-Associated Membrane Protein 2

Immunostaining of Clathrin-Mediated Endocytosis

Cells were seeded onto high-precision 24-mm round glass coverslips (No. 1.5H, catalog no. 117640; Marienfeld). Coverslips were previously cleaned by incubating them overnight in a methanol/hydrochlorid acid (50:50) solution while stirring. The coverslips were then repeatedly rinsed with water until a neutral pH was reached. They were then placed into a laminar flow cell culture hood overnight to dry. In a final cleaning step, the coverslips are irradiated with ultraviolet light for 30 min.
Cells were fixed as described previously (Li et al., 2018 (link)) using 3% (w/v) formaldehyde, 10 mM MES pH 6.1, 150 mM NaCl, 5 mM EGTA, 5 mM glucose, and 5 mM MgCl₂ for 20 min. Fixation was quenched in 0.1% (w/v) NaBH₄ for 7 min. The sample was washed three times with PBS and permeabilized for 15 min with 0.01% (w/v) digitonin (Sigma-Aldrich) in PBS. The sample was then washed twice with PBS and blocked for 1 h with 2% (w/v) BSA/PBS, washed with PBS, and stained for 3–12 h with anti-clathrin light chain (sc-28276; Santa Cruz Biotechnology) and anti-clathrin heavy chain rabbit polyclonal antibodies (ab21679; Abcam) in 1% (w/v) BSA/PBS. After three washes with PBS, the sample was incubated for 3–4 h with a secondary donkey anti-rabbit antibody (711-005-152; Jackson ImmunoResearch) that was conjugated to Alexa Fluor 647–NHS at an average degree of labeling of 1.5. The sample was then washed three times and mounted for imaging in blinking buffer (50 mM Tris/HCl pH 8, 10 mM NaCl, 10% (w/v) D-glucose, 500 µg ml⁻¹ glucose oxidase, 40 µg ml⁻¹ glucose catalase, and 35 mM MEA in H₂O).
For the analysis of the disconnected population of sites, 3T3 cells were transfected with a plasmid encoding the sigma 2 subunit, fused to GFP (gift from Steeve Boulant, University of Florida, #53610; Addgene), to obtain cells transiently expressing AP2-GFP. The transfection was performed using a Lipofectamine 2,000 reagent (Life Technologies) according to the manufacturer’s recommendations: 1 µg DNA was mixed with 50 µl OptiMEM I (Thermo Fisher Scientific). The same was done for 3 µl Lipofectamin in 50 µl OptiMEM I. Both solutions were incubated for 5 min and then mixed together and incubated for an additional 10 min at room temperature. The media of previously seeded cells was exchanged to prewarmed OptiMEM I, to which the DNA-Lipofectamin solution (100 µl) was added dropwise. After ∼24 h of incubation (at 5% CO₂, 37°C), the medium was exchanged with fresh growth medium. After additional incubation for ∼16 h, cells were fixed according to the same protocol described above.

Mund M., Tschanz A., Wu Y.L., Frey F., Mehl J.L., Kaksonen M., Avinoam O., Schwarz U.S, & Ries J. (2023). Clathrin coats partially preassemble and subsequently bend during endocytosis. The Journal of Cell Biology, 222(3), e202206038.

Full text: Click here

Publication 2023

3T3 Cells Acids Alexa Fluor 647 Anti-Antibodies Antibodies, Anti-Idiotypic Buffers Catalase Cell Culture Techniques Cells Clathrin Heavy Chains Clathrin Light Chains Culture Media Digitonin Egtazic Acid Equus asinus Formaldehyde Glucose Light Lipofectamine Magnesium Chloride Methanol Oxidase, Glucose Plasmids Rabbits Sigma Factor Sodium Chloride Transfection Tromethamine Ultraviolet Rays

Simulating FRET Efficiency in Clathrin-Mediated Endocytosis

FRET simulations (Supplementary Figs. 4c and 18) were performed using MATLAB. We used 60 Å for Förster radius for EGFP-ShadowY FRET. For the simulation in Supplementary Fig. 4c, we determined the position of N- and C-terminus of CLC according to the structure models (PDB 3LVG and 6WCJ)^{17 (link),46 (link)}. For the simulation in Supplementary Fig. 18, the lateral position of N-terminus was moved by 0.6 Å spacing, and N-terminus was assumed to locate axially 25 Å higher than C-terminus. When we focus on single clathrin heavy chain, there are four different states; without CLC, endogenous CLCa or CLCb binding, EGFP-CLC binding, or CLC-ShadowY binding (Supplementary Fig. 4b). By considering these four states, we calculated the FRET efficiency between EGFP-CLC and CLC-ShadowY or ShadowY-CLC binding to surrounding five clathrin heavy chains at various heavy chain occupancy with ShadowY-attached CLC.

Occupancy = \frac{[ShadowY probe binding]}{[No CLC binding] + [Endogenous CLCa / b biding] + [EGFP - CLC binding] + [ShadowY probe binding]}

Obashi K., Sochacki K.A., Strub M.P, & Taraska J.W. (2023). A conformational switch in clathrin light chain regulates lattice structure and endocytosis at the plasma membrane of mammalian cells. Nature Communications, 14, 732.

Full text: Click here

Publication 2023

Clathrin Heavy Chains Fluorescence Resonance Energy Transfer Radius

Proteomic Analysis of Kiwifruit Extracellular Vesicles

Total proteins from TLs, EVs, and EVFs fractions of both treatment and control groups were resolved in one-dimensional SDS-PAGE and blotted onto nitrocellulose membrane. For each pollen sample (40 mg), the total protein content for EVs and EVFs fractions was loaded into the gel for both treatments. Instead, for TLs only 50 µg of total proteins were used, to avoid overloading. The membrane was incubated for 10 min with Ponceau staining to visualize protein profiles and loadings for all the fractions. The membrane was then blocked in 5% Blotting Grade Blocker (BioRad, Italy) in TBS for 30 min, and thus incubated at 4°C overnight with one of the following rabbit polyclonal antibodies: 1:2000 dilution of anti-clathrin heavy chain (Agrisera), 1:5000 dilution of anti-H+ATPase (Agrisera, Italy), 1:500 dilution of anti-COXII (Agrisera, Italy), 1:5000 dilution of anti-UGPase (Agrisera, Italy), 1:1000 dilution of anti-ARF1 (Agrisera, Italy), or 1:1000 dilution of anti-ALIX (Covalab, Italy). All membranes were then washed in TBS-Tween (0.05% v/v) and TBS, and they were incubated at room temperature for 2 h with 1:5000 goat polyclonal anti-rabbit IgG peroxidase conjugated (Sigma-Aldrich, Italy). Finally, the membranes were developed with Amersham™ ECL Prime Western Blotting Reagents (GE Healthcare, Italy) and read in chemiluminescence with Azure 280 (Azure Biosystems, California). Experiments were repeated in triplicate for each target protein. Comparison between proteins bands was performed using ImageJ (Schneider et al., 2012 (link)).
The existence of plant homologs for human ALIX in Actinidia chinensis Planch. was assessed using BLAST (Altschul et al., 1990 (link); Boratyn et al., 2012 (link)) to compare human ALIX sequence to published protein sequences in Actinidia chinensis var chinensis.

Suanno C., Tonoli E., Fornari E., Savoca M.P., Aloisi I., Parrotta L., Faleri C., Cai G., Coveney C., Boocock D.J., Verderio E.A, & Del Duca S. (2023). Small extracellular vesicles released from germinated kiwi pollen (pollensomes) present characteristics similar to mammalian exosomes and carry a plant homolog of ALIX. Frontiers in Plant Science, 14, 1090026.

Full text: Click here

Publication 2023

Actinidia anti-IgG Antibodies Azure A Chemiluminescence Clathrin Heavy Chains Goat Homo sapiens Nitrocellulose PDCD6IP protein, human Peroxidase Plants Pollen Proteins Proton-Translocating ATPases PTGS2 protein, human Rabbits RNA-Binding Protein FUS SDS-PAGE Technique, Dilution Tissue, Membrane Tweens

RNAi Knockdown and Feeding Assay for Aphids

The clathrin heavy chain (chc) and GFP (control) sequences were amplified by PCR using sequence-specific primers conjugated with 20 bp of T7 RNA polymerase promotor (Table 3). The PCR products were utilized as templates for dsRNA synthesis using the HiScribe T7 High Yield RNA synthesis Kit (New England Biolabs). The precipitated dsRNAs were resuspended in 20 µL of RNAse free water. The purity and integrity of dsRNAs were determined using NanoVue Plus spectrophotometer (GE Healthcare) and migration on agarose gel electrophoresis. S2 cells were transfected with 2 µg dsRNA using FuGENE HD Transfection Reagent. After two and seven days the total RNA was extracted (see below).
Healthy young and synchronized adults were fed through a parafilm membrane during 2 days. To minimize the volume included in the cap of the 1.5-mL microtubes, we placed a 2 mm glass bead and 18 µL of a solution consisting of HEPES 8 mM, sucrose 280 mM, pH 7.4 plus 2 µg/µL of dsRNA between two parafilm membranes. After feeding, the insects were transferred to encaged FDP infected broad beans or non-infected plants for 7 days (100 insects per plant). Then, the insects were placed into non-infected broad beans for one to three weeks for incubation period that corresponds to 14, 21 and 30 days after the dsRNA ingestion. Midguts and heads were dissected after the insects were anaesthetized with CO₂, and two organs of the same experimental condition were pooled and correspond to one sample. Four independent experiments were conducted and all results were mixed for analysis.

Arricau-Bouvery N., Dubrana M.P., Canuto F., Duret S., Brocard L., Claverol S., Malembic-Maher S, & Foissac X. (2023). Flavescence dorée phytoplasma enters insect cells by a clathrin-mediated endocytosis allowing infection of its insect vector. Scientific Reports, 13, 2211.

Full text: Click here

Publication 2023

Adult Anabolism bacteriophage T7 RNA polymerase Cells Clathrin Heavy Chains Electrophoresis, Agar Gel Endoribonucleases FuGene Head HEPES Insecta Oligonucleotide Primers Plants RNA, Double-Stranded Sucrose Tissue, Membrane TRAF3 protein, human Training Programs Transfection Vicia faba

Top products related to «Clathrin Heavy Chains»

Lipofectamine rnaimax by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Japan, France, Canada, Switzerland, Denmark, Belgium, Italy, Australia, Singapore, Spain, Colombia, Sweden, Netherlands, New Zealand, Poland, Pakistan, Lithuania

Lipofectamine RNAiMAX is a transfection reagent designed for efficient delivery of small interfering RNA (siRNA) and short hairpin RNA (shRNA) into a wide range of cell types. It is a cationic lipid-based formulation that facilitates the uptake of these nucleic acids into the target cells.

Lipofectamine 2000 by Thermo Fisher Scientific

Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco

Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.

Ab21679 by Abcam

Sourced in United Kingdom

Ab21679 is an antibody product offered by Abcam. It is a primary antibody used for research purposes. The core function of this product is to bind to a specific target, enabling detection and analysis of the target in various experimental applications.

Chlorpromazine by Merck Group

Sourced in United States, United Kingdom, China, Germany

Chlorpromazine is a pharmaceutical compound used as a laboratory reagent. It is a white crystalline solid that is soluble in water and organic solvents. Chlorpromazine is commonly used in research and laboratory settings as a reference standard or for various analytical purposes.

Opti mem by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, China, Japan, Canada, France, Switzerland, Italy, Australia, Belgium, Spain, Denmark, Ireland, Netherlands, Holy See (Vatican City State), Israel

Opti-MEM is a cell culture medium designed to support the growth and maintenance of a variety of cell lines. It is a serum-reduced formulation that helps to reduce the amount of serum required for cell culture, while still providing the necessary nutrients and growth factors for cell proliferation.

Alexa fluor conjugated secondary antibody by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, Italy, Canada, Macao, Denmark, Australia

Alexa Fluor-conjugated secondary antibodies are fluorescent-labeled antibodies used in immunodetection techniques. They bind to primary antibodies and emit light at specific wavelengths, enabling the visualization and quantification of target proteins or biomolecules in various applications, such as flow cytometry, immunohistochemistry, and Western blotting.

Anti clathrin heavy chain by BD

Sourced in United Kingdom

Anti-clathrin heavy chain is a laboratory reagent used in the study of clathrin-mediated endocytosis. It is a specific antibody that binds to the heavy chain component of the clathrin protein complex, which is involved in the formation of vesicles during this cellular process.

Mouse anti clathrin heavy chain by BD

The mouse anti-clathrin heavy chain is a laboratory reagent used to detect and study the clathrin heavy chain protein, which is a key component of clathrin-coated vesicles involved in endocytosis and intracellular trafficking.

Ma1 065 by Thermo Fisher Scientific

Sourced in United Kingdom, United States

The MA1-065 is a laboratory instrument designed for the detection and analysis of specific molecules or compounds. It utilizes advanced spectroscopy techniques to provide accurate and reliable data. The core function of this product is to facilitate scientific research and analysis in a variety of laboratory settings.

Anti caveolin 1 by Cell Signaling Technology

Sourced in United States, China

Anti-caveolin-1 is a primary antibody that recognizes the caveolin-1 protein. Caveolin-1 is a structural component of caveolae, which are invaginations of the plasma membrane that play a role in various cellular processes.

What are Clathrin Heavy Chains and what is their role in cellular processes?

Clathrin Heavy Chains are large protein complexes that form the structural backbone of clathrin-coated vesicles. These vesicles play a crucial role in endocytosis and intracellular trafficking, facilitating the internalization of various molecules and cargoes into the cell. Clathrin Heavy Chains provide the necessary scaffolding for the assembly and disassembly of these dynamic structures, which are essential for cellular processes such as signaling, nutrient uptake, and synaptic transmission.

What are the different types or variations of Clathrin Heavy Chains?

How can PubCompare.ai assist in optimizing the use and comparison of Clathrin Heavy Chains?

PubCompare.ai allows researchers to screen protocol literature more efficiently and leverage AI to pinpoint critical insights. The platform's AI-driven analysis can help identify the most effective protocols related to Clathrin Heavy Chains for your specific research goals. By highlighting key differences in protocol effectiveness, PubCompare.ai enables you to choose the best option for reproducibility and accuracy, streamlining your research process and ensuring you find the most effective solutions.

What are some common usage challenges associated with Clathrin Heavy Chains?

One of the main challenges in working with Clathrin Heavy Chains is ensureing the reproducibility and accuracy of experimental protocols. The dynamic nature of clathrin-coated vesicle formation and the complex regulatory mechanisms involved can make it difficult to consistently replicate results. Additionally, the purification and manipulation of Clathrin Heavy Chains can be technically demanding, requiring specialized expertise and equipment.

What are some specific applications of Clathrin Heavy Chains in research and medicine?

Clathrin Heavy Chains are a key focus of research in cellular and molecular biology, as they are central to a variety of important cellular processes. Studying the function and regulation of Clathrin Heavy Chains can provide insights into disease mechanisms, such as the role of endocytic disruption in neurodegenerative disorders. Additionally, targeting Clathrin Heavy Chains or the clathrin-mediated endocytic pathways they facilitate may lead to the development of novel therapies for conditions like cancer, where aberrant endocytosis is a hallmark.

More about "Clathrin Heavy Chains"

Clathrin heavy chains (CHCs) are a crucial structural component of clathrin-coated vesicles (CCVs), which play a vital role in endocytosis and intracellular trafficking.
These large, dynamic protein complexes are responsible for the formation of clathrin-coated pits, facilitating the internalization of various molecules, nutrients, and cargoes into the cell.
CHCs form the backbone of the clathrin lattice, providing the necessary scaffolding for the assembly and disassembly of these crucial structures.
Understanding the function and regulation of CHCs is essential for investigating important cellular processes, such as signaling, nutrient uptake, and synaptic transmission.
Researchers often utilize tools like Lipofectamine RNAiMAX and Lipofectamine 2000 to study the impact of CHC knockdown or overexpression on cellular processes.
Additionally, antibodies like Ab21679, Anti-clathrin heavy chain, and Mouse anti-clathrin heavy chain (MA1-065) are commonly used to detect and visualize CHCs in experiments.
The internalization of materials into cells can also be affected by compounds like Chlorpromazine, which disrupts clathrin-mediated endocytosis.
Opti-MEM is often used as a transfection medium, while Alexa Fluor-conjugated secondary antibodies are employed to fluorescently label and observe CHCs and other proteins of interest.
Research in this area may lead to important insights into disease mechanisms and the development of targeted therapies, as CHCs play a crucial role in various cellular functions.
By understanding the complex interplay of CHCs and their regulation, scientists can uncover new avenues for therapeutic interventions and advance our knowledge of fundamental cell biology.