Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > COL1A1 protein, human

COL1A1 protein, human

The COL1A1 gene provides instructions for making one of the two main components of type I collagen, a protein that provides structure and strength to connective tissues throughout the body, such as skin, bone, cartilage, tenions, and the cornea.
Variations in the COL1A1 gene can lead to several genetic disorders, including osteogenesis imperfecta, Ehlers-Danlos syndrome, and chondrodysplasias.
Researchers continue to investigate the role of COL1A1 in health and disease, with a focus on improving reproducibilty and optimizing analytical methods for studying this important collagen protein.

Most cited protocols related to «COL1A1 protein, human»

1
Quantitative Gene Expression Analysis Protocol
Cited 6 times
Samples with too low RNA quantity or quality were excluded from gene expression analysis. Criteria for inclusion were defined as follows: RNA concentration >7 ng/μL and 260/280 absorption ratio >1.6 (under these conditions, the 260/230 absorption ratio does not have a strong effect on the RT‐PCR outcome). For all samples meeting these requirements, reverse transcription was performed using TaqMan reverse transcription reagents (TaqMan RT buffer, 5.5 μM MgCl2, 500 μM each deoxynucleotide triphosphate (dNTP), 2.5 μM random hexamers, 0.4 U/μL RNase inhibitor, and 1.35 U/μL Multiscribe reverse transcriptase; Applied Biosystems, Forster City, CA, USA). For all samples, 500 ng of total RNA was transcribed in 20 μL reaction mixture and the resulting cDNA was diluted 1:4 Tris‐ethylenediaminetetraacetic acid (Tris‐EDTA) buffered RNase‐free water. For all samples, real‐time PCR was performed using TaqMan Gene Expression Master Mix (Applied Biosystems) with QuantStudio 6 Flex instrument (Applied Biosystems). The following genes were analyzed: collagen type Iα1 (COL1), collagen type IIα1 (COL2), aggrecan (ACAN), matrix metalloproteinase 3 (MMP3) and a disintegrin and metalloproteinase with thrombospondin motifs 4 (ADAMTS4). The 18S ribosomal RNA (18S) and glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) were used as endogenous controls. Primers and TaqMan probes were supplied by Microsynth or Applied Biosystems, using the same sequences as in previous studies.18, 19
Caprez S., Menzel U., Li Z., Grad S., Alini M, & Peroglio M. (2018). Isolation of high‐quality RNA from intervertebral disc tissue via pronase predigestion and tissue pulverization. JOR Spine, 1(2), e1017.
Full text: Click here
Publication 2018
Aggrecans COL1A1 protein, human Collagen Disintegrins DNA, Complementary Edetic Acid Endoribonucleases Gene Expression Gene Expression Profiling Genes Glyceraldehyde-3-Phosphate Dehydrogenases Magnesium Chloride Matrix Metalloproteinase 3 Metalloproteases Oligonucleotide Primers Real-Time Polymerase Chain Reaction Reverse Transcriptase Polymerase Chain Reaction Reverse Transcription RNA, Ribosomal, 18S RNA-Directed DNA Polymerase thrombospondin 4 triphosphate Tromethamine
2
Genetically Modified Mice for Bone Research
Cited 3 times
Female mice were used in all experiments. C57BL/6J mice were purchased from Crea Japan (Tokyo, Japan). The generation of the TRAP-tdTomato mice was described previously9 (link). The Col2.3-ECFP mice were generated using a transgene expressing ECFP, driven by the 2.3 kb fragment of rat type I collagen α (1) promoter11 (link),12 (link). All mice were maintained under specific pathogen-free conditions and all animal studies were approved by the Institutional Animal Care and Use Committee of Osaka University.
Furuya M., Kikuta J., Fujimori S., Seno S., Maeda H., Shirazaki M., Uenaka M., Mizuno H., Iwamoto Y., Morimoto A., Hashimoto K., Ito T., Isogai Y., Kashii M., Kaito T., Ohba S., Chung U.I., Lichtler A.C., Kikuchi K., Matsuda H., Yoshikawa H, & Ishii M. (2018). Direct cell–cell contact between mature osteoblasts and osteoclasts dynamically controls their functions in vivo. Nature Communications, 9, 300.
Full text: Click here
Publication 2018
Animals COL1A1 protein, human Females Institutional Animal Care and Use Committees Mice, Inbred C57BL Mice, Laboratory Specific Pathogen Free tdTomato Transgenes
3
Quantitative Gene Expression Analysis of Fracture Callus
Cited 3 times
The callus was extracted from 46 fractured femurs by cutting the bone 2 mm away from each edge of the callus. An equal length of the diaphysis was extracted from the contralateral limbs. The bone samples were then flash-frozen in liquid nitrogen and processed using TRIzol (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. RNA was purified using Qiaquick RNeasy mini-kit (Qiagen, Valencia, CA) and cDNA was generated from total RNA using the QuantiTect Reverse Transcription Kit (Qiagen). Quantitative reverse transcription PCR (qPCR) was performed using primer and TaqMan probe sets (Applied Biosystems, Foster City, CA) and QuantiFast Probe PCR kit (Qiagen) on a Mastercycler realplex2 (Eppendorf, Westbury, NY). Amplification conditions were 95°C for 3 min, followed by 40 cycles at 95°C for 3 s and 60°C for 30 s. Quantitative PCR results were first normalized to ActB (Mm00607939_s1) transcript to yield ΔCt, and then normalized to contralateral limb to yield ΔΔCt. Results are expressed as 2−ΔΔCt .34 (link) Genes probed were collagen Type 1 alpha 1 (Col1a1, Mm00801666_g1), collagen Type 2 alpha 1 (Col2a1, Mm01309565_m1), collagen Type 10 alpha 1 (Col10a1, Mm00487041_m1), SDF-1 (Sdf1, Mm00445553_m1), bone sialoprotein (Ibsp, Mm00492555_m1), vascular endothelial growth factor (Vegf, Mm01281449_m1), Annexin A5 (AnxA5, Mm01293059_m1), early growth response 1 (Egr1, Mm00656724_m1), nitric oxide synthase 2 (Nos2, Mm00440502_m1), and mechanistic target of rapamycin (mTOR; Frap1, Mm00444968_m1).
Toupadakis C.A., Wong A., Genetos D.C., Chung D.J., Murugesh D., Anderson M.J., Loots G.G., Christiansen B.A., Kapatkin A.S, & Yellowley C.E. (2012). Long-Term Administration of AMD3100, an Antagonist of SDF-1/CXCR4 Signaling, Alters Fracture Repair. Journal of orthopaedic research : official publication of the Orthopaedic Research Society, 30(11), 1853-1859.
Publication 2012
Annexin A5 Bones Callus Chemokine CXCL12 COL1A1 protein, human Collagen Type I Diaphyses DNA, Complementary EGR1 protein, human Femoral Fractures FRAP1 protein, human Freezing Genes Nitric Oxide Synthase Type II Nitrogen Oligonucleotide Primers Reverse Transcription Sialoprotein, Integrin-Binding trizol Vascular Endothelial Growth Factors
4
Quantifying Gene Expression in OA Tissues
Cited 3 times
The homogenized tissue was placed on ice, and 100mg was weighed and separated for RNA isolation using a kit (Versagene’s 5-Prime RNA Isolation Kit4). RNAse free procedures and filtered pipettes were used throughout the isolation procedure. The nanodrop spectrophotometer (ND-1000 Spectrophotometer5) was used to analyze the amount and purity of the RNA product. Concentrations ranged from 3.8–51.8ng/ul, and one joint (mild OA) was excluded as its RNA concentration was less than 3.0ng/ul and its 260/280 wavelength ratio was <1.6.
Gene expression was quantified through the use of quantitative real-time PCR (ABI PRISM 7900 Sequence Detection System 6). Primers and labeled probes (6-FAM as the 5′ reporter label and TAMRA as the 3′ quenching label) were created using commercial software (ABI Primer Express Software 2.0b8a6). Sequences for these primers and probes were generated from Genbank7 or available from clones within the laboratory of Dr Alan Nixon. Copy number was quantified for the mRNA of TNF-α, IL-1β, aggrecanase 1 (ADAMTS-4), aggrecanase 2 (ADAMTS-5), MMP-13, and IL-17 in both the synovium and the cartilage. Collagen type I alpha 1(Col-1) was quantified in synovium, and collagen type IIB (Col-2B) and aggrecan were quantified in cartilage. The housekeeping gene used was 18S, and the 18S copy number was similar for all tissues used. Data used for statistical analysis was copy number per microgram.
Kamm J.L., Nixon A.J, & Witte T.H. (2010). Cytokine and catabolic enzyme expression in synovium, synovial fluid and articular cartilage of naturally osteoarthritic equine carpi. Equine veterinary journal, 42(8), 693-699.
Publication 2010
ADAMTS4 Protein ADAMTS5 Protein Aggrecans Cartilage Clone Cells COL1A1 protein, human Collagen Endoribonucleases Gene Expression Genes, Housekeeping IL17A protein, human Interleukin-1 beta isolation Joints MMP13 protein, human Oligonucleotide Primers prisma Real-Time Polymerase Chain Reaction RNA, Messenger Synovial Membrane Tissues Tumor Necrosis Factor-alpha
5
Quantitative RT-PCR of Cardiac Gene Expression
Cited 2 times
Quantitative RT-PCR was performed with gene-specific primers to monitor mRNA expression as described previously [77 (link)]. Briefly, RNA was isolated using Qiagen RNeasy Fibrous Tissue Mini Kit (Qiagen, Hilden, Germany) from heart tissue. Then, 100 μg of total RNA was reverse transcribed using iScript™ cDNA Synthesis Kit (BioRad Laboratories Inc., Hercules, CA, USA). Specific primers (Agt: angiotensinogen, #qRnoCED0051666; Agtr1: angiotensin II receptor type 1, #qRnoCID0052626; Bax: BCL2-associated X apoptosis regulator, #qRnoCED0002625; Bcl2: B-Cell CLL/lymphoma 2 apopotosis regulator, #qRnoCED0006419; Cat: catalase, #qRnoCID0006360; Cma1: chymase, #qRnoCED0005462; Col1a1: collagen type 1 alpha 1 chain, #qRnoCED0007857; Ctgf: connective tissue growth factor, #qRnoCED0001593; Il1: interleukin-1, #qRnoCID0002056; Il6: interleukin-6, #qRnoCID0053166; Mmp2: matrix metalloproteinase 2, #qRnoCID0002887; Mmp9: matrix metalloproteinase 9, #qRnoCED0001183; Nos1: neuronal nitric oxide synthase, #qRnoCED0009301; Nos2: inducible nitric oxide synthase, #qRnoCID0017722; Nos3: endothelial nitric oxide synthase, #qRnoCID0005021; Nox4: NADPH-oxidase type 4, #qRnoCID0003969; Nppa: A-type natriuretic peptide, #qRnoCED0006216, Nppb: B-type natriuretic peptide, #qRnoCED0001541; Smad2, mothers against decapentaplegic homolog 2, #qRnoCID0005549; Smad3: mothers against decapentaplegic homolog 3, #qRnoCID0004164; Sod1: Cu/Zn superoxide dismutase (soluble) #qRnoCID0051055; Sod2: Mn superoxide dismutase (mitochondrial), #qRnoCID0008099; Sod3: Cu/Zn superoxide dismutase (extracellular), #qRnoCID0006360; Tgfb: transforming growth factor-β, #qRnoCID0009191, Tnf: tumor necrosis factor-α, #qRnoCED0009117) and SsoAdvanced™ Universal SYBR® Green Supermix (BioRad Laboratories Inc., Hercules, CA, USA) were used according to the manufacturer’s instructions. Peptidyl-prolyl isomerase A (Ppia, forward primer sequence: tgctggaccaaacacaaatg and reverse primer sequence: caccttcccaaagaccacat) was used as a housekeeping control gene for normalization.
Freiwan M., Kovács M.G., Kovács Z.Z., Szűcs G., Dinh H., Losonczi R., Siska A., Kriston A., Kovács F., Horváth P., Földesi I., Cserni G., Dux L., Csont T, & Sárközy M. (2022). Investigation of the Antiremodeling Effects of Losartan, Mirabegron and Their Combination on the Development of Doxorubicin-Induced Chronic Cardiotoxicity in a Rat Model. International Journal of Molecular Sciences, 23(4), 2201.
Full text: Click here
Publication 2022
5-nitro-2-(3-phenylpropylamino)benzoic acid AGTR1 protein, human Anabolism Angiotensinogen bcl-2 Gene BCL2 protein, human Catalase Chymase CMA1 protein, human COL1A1 protein, human Connective Tissue Growth Factor DNA, Complementary Fibrosis Genes Genes, Housekeeping Heart Interleukin-1 Interleukin-6 Manganese Superoxide Dismutase Matrix Metalloproteinase 2 Matrix Metalloproteinase 9 Mitochondria MMP2 protein, human MMP9 protein, human Natriuretic Peptides Nesiritide Nitric Oxide Synthase Type I Nitric Oxide Synthase Type II Nitric Oxide Synthase Type III NOS1 protein, human NOS3 protein, human NOX4 protein, human NPPA protein, human Oligonucleotide Primers Peptidylprolyl Isomerase Reverse Transcriptase Polymerase Chain Reaction RNA, Messenger SMAD2 protein, human SMAD3 protein, human SOD2 protein, human SOD3 protein, human Superoxide Dismutase-1 SYBR Green I Tissues Transforming Growth Factors Tumor Necrosis Factor-alpha

Most recents protocols related to «COL1A1 protein, human»

1
Elucidating THP-1 and LX2 Cell Crosstalk
On the one hand, THP1 cells were seeded 1x106 cells per well in six-well plate and treated with palmitate (PA,1 mM, Sigma-Aldrich, USA). Meanwhile, different siRNA-lipofectamine™ 3000 (Cat# L3000015, Invitogen) mixture was added into cell culture medium. After 48h, total RNA of THP1 cells were extracted to detect the levels of Jun, spp1, Socs3 and Rac1. On the other hand, THP1 cells were seeded 1x106 cells per well on six-well upper trans-well insert (0.4µM), LX2 cells were seeded 1x105 cells in the lower wells of trans-well plates and attached overnight. After 24h, THP1 cells were washed with phosphate-buffered saline solution (PBS), and treated with PA (1 mM) and different siRNA-lipofectamine™ 3000 mixture, each upper insert was transferred to a lower plate containing the LX2 cells. Thereafter, THP1 cells and LX2 cells were co-cultured in serum-free medium for 48 hours. Total RNA of LX2 cells were extracted to detect the levels of α-smooth muscle actin (SMA), collagen type I alpha 1 (Col1a1) and Fibronectin (Fn). The sequences of different siRNA were listed in Supplementary Table 1.
Wang X., Wang Z., Liu B., Jin R., Song Y., Fei R., Cong X., Huang R., Li X., Yang J., Wei L., Rao H, & Liu F. (2023). Characteristic gene expression in the liver monocyte-macrophage-DC system is associated with the progression of fibrosis in NASH. Frontiers in Immunology, 14, 1098056.
Full text: Click here
Publication 2023
Actins Cell Culture Techniques Cells COL1A1 protein, human Culture Media Fibronectins Lipofectamine Palmitate Phosphates RNA, Small Interfering Saline Solution Serum Smooth Muscles SPP1 protein, human
2
Quantitative Gene Expression Analysis of PBECs
Total RNA from PBECs or cell lines was isolated using TRIzol reagent (Thermo Fisher Scientific, Carlsbad, USA) according to the manufacturer’s protocol and RNA from LCM-collected epithelium was extracted as described above. cDNA was synthesized with random hexamer primers using the Revertaid cDNA synthesis kit (Thermo Scientific Inc.). Expression of UCHL1, collagen type I alpha 1 (COL1A1), fibronectin, collagen type III alpha 1 (COL3A1), calponin 1 (CNN1), E-cadherin (CDH1), laminin alpha 1 (LAMA1), and GAPDH genes were quantified using an ABI ViiA7 real-time PCR system (Applied Biosystems, USA) with ABsolute qPCR SYBR Green (Thermo Scientific, Inc.). Gene-specific primers are listed in Table 3 and Supplemental Table 3. Three technical replicates of real-time qRT-PCR were done for each biological repeat. Fold changes in mRNA expression above the control (dCas9-NED transfected cells) were calculated by the cycle threshold (ΔΔCt) method after normalization to GAPDH expression, unless stated otherwise.

Information of PCR and sequencing primers.

PrimerSequence (5’-3’)Application
UCHL1-FwTTCCTGTGGCACAATCGGACqRT-PCR primer for UCHL1
UCHL1-RvCATCTACCCGACATTGGCCTT
COL1A1-FwGGGATTCCCTGGACCTAAAGqRT-PCR primer for COL1A1
COL1A1-RvGGAACACCTCGCTCTCCA
COL3A1-FwCTGGACCCCAGGGTCTTCqRT-PCR primer for COL3A1
COL3A1-RvCATCTGATCCAGGGTTTCCA
Fibronectin-FwTCAACTCACAGCTTCTCCAAqRT-PCR primer for Fibronectin
Fibronectin-RvTTGATCCCAAACCAAATCTT
CNN1-FwCCAACCATACACAGGTGCAGqRT-PCR primer for CNN1
CNN1-RvTCACCTTGTTTCCTTTCGTCTT
CDH1-FwCATTGCCACATACACTCTCTTCTqRT-PCR primer for CDH1
CDH1-RvCGGTTACCGTGATCAAAATCTC
GAPDH-FwCCACATCGCTCAGACACCATqRT-PCR primer for GAPDH
GAPDH-RvGCGCCCAATACGACCAAAT
dCas9-FwAATGGCATCCGAGACAAGCAqRT-PCR primer for dCas9
dCas9-RvTGTGCTCGTGAAGACTGTCC
UCHL1-pyro-FwGGTTTTGTTTTTGTTTTTTTTGTATAGGPCR and sequencing primer for UCHL1 pyrosequencing (lower cases reflect the universal primer, Y is the CpG sites tested, subscript number indicating the site) (Site #4 is SNP-rs577696101-C/G according to UCSC)
UCHL1-pyro-RvgggacaccgctgatcgtttaAATCTCCA-TCYACTTAAACTACATCTTC
Pyroseq-sequencing primerTTGTATAGGTTTTATAGTG
Pyroseq-sequence to analyseY1GTTTGGTY2GGY3GTTTTATAGTTGTAGTTTGGGY4GGTTTY5G TTAGTTGTTTTTY6GTTTTTTTTAGGTTATTTTTGTY7GGGYGTTTYGYGAAGATGTAGTTTAAGTYGATGGAGATT
Wu D.D., Lau A.T., Xu Y.M., Reinders-Luinge M., Koncz M., Kiss A., Timens W., Rots M.G, & Hylkema M.N. (2023). Targeted epigenetic silencing of UCHL1 expression suppresses collagen-1 production in human lung epithelial cells. Epigenetics, 18(1), 2175522.
Full text: Click here
Publication 2023
Anabolism Biopharmaceuticals calponin Cell Lines Cells COL1A1 protein, human Collagen Type I DNA, Complementary E-Cadherin Epithelium Fibronectins GAPDH protein, human Genes laminin A Oligonucleotide Primers Real-Time Polymerase Chain Reaction RNA, Messenger SYBR Green I trizol UCHL1 protein, human
3
Muscle Protein Analysis Post-Injury
Snap frozen whole TA muscles were crushed into powder using a mortar and pestle. Crushed muscles were then used for protein analysis at a sample size of n = 4 per group for the 56-day post-injury time point and n = 5 per group for the 28-day time point. Powdered muscle samples were suspended in T-PER™ (ThermoFisher; Waltham, MA, USA) lysis buffer and Halt™ Protease Inhibitor Cocktail 100× (Thermo Fisher Scientific Inc.; Waltham, MA, USA) at a concentration of 100 mg/mL. The suspended samples were homogenized and centrifuged at 10,000× g for 5 min at 4 °C. The supernatant was collected, and total protein concentration was quantified using a Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific Inc.; Waltham, MA, USA) according to the manufacturer’s instructions. Proteins were measured in muscle lysate using ELISA kits (MyBiosource Inc; San Diego, CA, USA). Proteins associated with fibrogenic processes included collagen type I alpha I (COL1a1), collagen 3 alpha I (COL3A1), and transforming growth factor beta (TGFβ). Proteins associated with myogenic processes included myogenin (MYOG), paired box 7 (PAX7), insulin-like growth factor (IGF-1), and myosin heavy chain 3 (MHC3). Protein lysates were further diluted in the T-PER™ lysis buffer as needed and added to antibody-coated plates along with standard protein concentrations. The plates were incubated and washed according to specific manufacturer instructions. A change in color appeared in the plate, and the optical density was measured at specific wavelengths using an Infinite M200 Pro spectrophotometer (Tecan; Männedorf, Switzerland). Fibrotic and myogenic protein concentrations were calculated by interpolation from the generated standard curve and normalized to the total protein concentration quantified from the BCA assay.
Motherwell J.M., Dolan C.P., Kanovka S.S., Edwards J.B., Franco S.R., Janakiram N.B., Valerio M.S., Goldman S.M, & Dearth C.L. (2023). Effects of Adjunct Antifibrotic Treatment within a Regenerative Rehabilitation Paradigm for Volumetric Muscle Loss. International Journal of Molecular Sciences, 24(4), 3564.
Full text: Click here
Publication 2023
Biological Assay Buffers COL1A1 protein, human Collagen Type I Enzyme-Linked Immunosorbent Assay Fibrosis Freezing IGF1 protein, human Immunoglobulins Injuries M-200 Muscle Tissue Myogenesis MYOG protein, human Myosin Heavy Chains Protease Inhibitors Proteins Somatomedins Transforming Growth Factor beta Vision
4
Liver and Gonadal Fat Gene Expression Analysis
RNA was extracted from one female and one male liver or gonadal fat sample from each litter using the TRIzol® reagent (Thermo Scientific, Grand Island, NY, USA). Reverse transcription was conducted using the High-Capacity cDNA Reverse Transcription kit (Thermo Scientific) following the manufacturer’s instructions. Gene transcript abundance was analyzed by quantitative real-time PCR with SYBR green detection using the CFX384 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) as previously described. Data were expressed as the fold difference of the gene of interest relative to the housekeeping gene, beta-actin (Actb), using the 2-ΔΔCt method [33 (link)]. All primers were designed using GeneRunner Version 3.01 (http://www.softpedia.com, accessed on 1 January 2022) (Supplementary Table S1). Expression of the following genes was analyzed: Acer2 (alkaline ceramidase 2), Agps (peroxisomal alkyldihydroxyacetonephosphate synthase), Ccl2 [MCP-1/chemokine (C-C motif) ligand 2], Cers2 (ceramide synthase 2), Col1a1 (COL1A1 collagen type I alpha 1 chain); Cybb (cytochrome b-245 beta), Elovl1 (elongation of very long chain fatty acids 1), Fads2 (fatty acid desaturase 2), Far1 (fatty acyl-CoA reductase 1), Gnpat (glyceronephosphate O-acyltransferase), Gpx4 (glutathione peroxidase 4), Mfsd2a (mammalian family super domain 2 a), Sod (superoxide dismutase), and Tnfa (tumor necrosis factor alpha).
Korsmo H.W., Kadam I., Reaz A., Bretter R., Saxena A., Johnson C.H., Caviglia J.M, & Jiang X. (2023). Prenatal Choline Supplement in a Maternal Obesity Model Modulates Offspring Hepatic Lipidomes. Nutrients, 15(4), 965.
Full text: Click here
Publication 2023
ACER2 protein, human Acyltransferase alkylglycerone-phosphate synthase beta-Actin CCL2 protein, human Chemokine COL1A1 protein, human CYBB protein, human cytochrome b245 Dehydrogenase, Acyl-CoA dihydroceramide desaturase DNA, Complementary Fatty Acid Desaturases Fatty Acids Females Gene Expression Genes Genes, Housekeeping Gonads Ligands Liver Males Mammals Oligonucleotide Primers Orosomucoid Peroxisome Phospholipid Hydroperoxide Glutathione Peroxidase Real-Time Polymerase Chain Reaction Reverse Transcription Superoxide Dismutase SYBR Green I TNF protein, human Touch trizol Tumor Necrosis Factor-alpha
5
Vibration-Induced Osteoblast Differentiation
POB cells were seeded at a density of 5 × 105/well in a 6-well plate (n = 3) and cultured until confluence. Cells were then cultured in calcification medium, and the experimental groups were subjected to vibration (30 and 300 Hz) once every 2 days for 30 min. On day 14, total RNA was extracted from the experimental and control groups using TRIzol (Thermo Fisher Scientific, Waltham, MA, USA) and chloroform. After precipitating RNA using isopropanol and washing with 70% ethanol. The extracted total RNA was dissolved in RNase-free water and quantified, and its purity was measured using an ultra-trace spectrometer (Nanodrop 2000, Thermo Fisher Scientific). The ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan) was used to synthesize cDNA. The THUNDERBIRD SYBR qPCR Mix (TOYOBO) was used for each cDNA for real-time PCR (n = 3) in accordance with the SYBR Green method. The PCR conditions were as follows: initial thermal denaturation at 95 °C for 15 min, cycling with thermal denaturation at 95 °C for 3 s, annealing at 62 °C for 5 s, and elongation at 72 °C for 45 s for 40 cycles. Targets of mRNA expression analysis were runt-related transcription factor 2 (Runx2), bone morphogenetic protein 2 (BMP2), collagen type I alpha 1 chain (Col1a1), osteopontin (OPN), osteocalcin (OCN), and sclerostin, all being osteoblast differentiation markers. We also targeted p53, p21, and p16, aging-related markers, and c-fos, a cytotoxicity marker. Primers are shown in Table 1. With beta-actin as the internal control, relative mRNA expression was quantified using the double delta method.
Choi D., Ishii T., Ishikawa M., Ootake T., Kamei H., Nagai K, & Sueishi K. (2023). Vertical Vibration of Mouse Osteoblasts Promotes Cellular Differentiation and Cell Cycle Progression and Induces Aging In Vitro. Biomedicines, 11(2), 444.
Full text: Click here
Publication 2023
beta-Actin Bone Morphogenetic Protein 2 Cells Chloroform COL1A1 protein, human Culture Media Cytotoxin Differentiation Antigens DNA, Complementary Endoribonucleases Ethanol Isopropyl Alcohol Oligonucleotide Primers Osteoblasts Osteocalcin Osteopontin Physiologic Calcification Real-Time Polymerase Chain Reaction RNA, Messenger RUNX2 protein, human SYBR Green I trizol v-fos Genes Vibration

Top products related to «COL1A1 protein, human»

1
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
2
Rneasy mini kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway
The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.
3
High capacity cdna reverse transcription kit by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Japan, Lithuania, France, Italy, China, Spain, Canada, Switzerland, Poland, Australia, Belgium, Denmark, Sweden, Hungary, Austria, Ireland, Netherlands, Brazil, Macao, Israel, Singapore, Egypt, Morocco, Palestine, State of, Slovakia
The High-Capacity cDNA Reverse Transcription Kit is a laboratory tool used to convert RNA into complementary DNA (cDNA) molecules. It provides a reliable and efficient method for performing reverse transcription, a fundamental step in various molecular biology applications.
4
Steponeplus real time pcr system by Thermo Fisher Scientific
Sourced in United States, Japan, China, Germany, United Kingdom, Switzerland, Canada, Singapore, Italy, France, Belgium, Denmark, Spain, Netherlands, Lithuania, Estonia, Sweden, Brazil, Australia, South Africa, Portugal, Morocco
The StepOnePlus Real-Time PCR System is a compact, flexible, and easy-to-use instrument designed for real-time PCR analysis. It can be used to detect and quantify nucleic acid sequences.
5
Trizol by Thermo Fisher Scientific
Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines
TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.
6
Iscript cdna synthesis kit by Bio-Rad
Sourced in United States, Germany, Italy, Canada, United Kingdom, France, Netherlands, Switzerland, Sweden, Belgium, Japan, Australia, China, India, Spain, Denmark, Austria, Norway
The IScript cDNA Synthesis Kit is a reagent kit used for the reverse transcription of RNA into complementary DNA (cDNA). The kit contains all the necessary components to perform this reaction, including a reverse transcriptase enzyme, reaction buffer, and oligo(dT) primers.
7
Taqman gene expression assay by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Japan, Switzerland, Canada, Italy, Australia, Spain, France, Sweden, Estonia, Lithuania, Belgium, Denmark, Finland, Israel, Netherlands, Hungary
TaqMan Gene Expression Assays are a set of pre-designed and pre-optimized qPCR assays for accurately quantifying gene expression levels. They provide a sensitive and reliable method for measuring targeted mRNA transcripts in a variety of sample types.
8
Quantitect reverse transcription kit by Qiagen
Sourced in Germany, United States, United Kingdom, Japan, Netherlands, Canada, China, Australia, Italy, France, Spain, India, Switzerland, Belgium, Norway, Sweden, Denmark
The QuantiTect Reverse Transcription Kit is a laboratory tool designed for the reverse transcription of RNA into complementary DNA (cDNA). It enables the conversion of RNA samples into cDNA, which can then be used for various downstream applications, such as real-time PCR or gene expression analysis.
9
7900ht fast real time pcr system by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, China, Japan, Italy, Canada, Switzerland, Singapore, Spain, Denmark, Belgium, Netherlands, France, Poland
The 7900HT Fast Real-Time PCR System is a laboratory instrument designed for fast and accurate real-time PCR analysis. It features a 96-well format, support for multiple fluorescent dyes, and rapid thermal cycling capabilities.
10
Purelink rna mini kit by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Canada, Japan, Australia, Italy, China, Belgium, India, Spain, Switzerland, Norway, France, Portugal, Hong Kong, Netherlands
The PureLink RNA Mini Kit is a product designed for the purification of total RNA from various sample types. It utilizes a silica-based membrane technology to efficiently capture and purify RNA molecules. The kit provides a streamlined protocol for the extraction and isolation of high-quality RNA suitable for downstream applications such as RT-PCR, northern blotting, and RNA sequencing.

More about "COL1A1 protein, human"

The COL1A1 gene, which stands for Collagen Type I Alpha 1 Chain, encodes one of the two main components of type I collagen, a vital structural protein found throughout the human body.
This collagen is a key constituent of connective tissues like skin, bone, cartilage, tendons, and the cornea.
Variations in the COL1A1 gene can lead to several genetic disorders, including osteogenesis imperfecta, Ehlers-Danlos syndrome, and chondrodysplasias.
Researchers continue to extensively study the COL1A1 gene and its encoded collagen protein, aiming to better understand its role in health and disease.
Advanced analytical techniques, such as those utilizing TRIzol reagent, RNeasy Mini Kit, and High-Capacity cDNA Reverse Transcription Kit, allow for accurate quantification and analysis of COL1A1 expression.
The StepOnePlus Real-Time PCR System and TaqMan Gene Expression Assays are commonly used tools in this research.
To enhance reproducibilty and optimize analytical methods for studying COL1A1, the QuantiTect Reverse Transcription Kit and 7900HT Fast Real-Time PCR System can be employed.
The PureLink RNA Mini Kit is another useful tool for high-quality RNA extraction, enabling robust and reliable COL1A1 analysis.
By leveraging these advanced techniques and technologies, researchers can gain deeper insights into the role of COL1A1 in both health and disease states, ultimately leading to improved understanding and potential therapeutic interventions.