Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > Cyclins

Cyclins

Cyclins are a family of regulatory proteins that play a crucial role in the cell cycle by controlling the activity of cyclin-dependent kinases (CDKs).
These proteins oscillate in their concentration during the cell cycle, driving the progression through different phases.
Cyclins bind to and activate CDKs, allowing the cell to move forward in the cell cycle.
Proper regulation of cyclins is essential for maintaining normal cell division and proliferation.
Dysregulation of cyclins has been implicated in the development of various cancers, making them an important target for therapeutic interventions.
Understamding the complex roles of cyclins in cellular processes is crucial for advancing research in cell biology and developing effective treatments for cell-cycle related diseases.

Most cited protocols related to «Cyclins»

1
Protein Interaction Characterization Server
Cited 55 times
PIC server accepts atomic coordinate set of a protein structure in the standard Protein Data Bank (PDB) format. The user is prompted with selecting one or more of the following interaction types: Interaction between apolar residues, disulphide bridges, hydrogen bond between main chain atoms, hydrogen bond between main chain and sidechain atoms, hydrogen bond between two sidechain atoms, interaction between oppositely charged amino acids (ionic interactions), aromatic–aromatic interactions, aromatic–sulphur interactions and cation–π interactions. The input coordinate set is accepted, under each section of the page, for recognition of interactions within a polypeptide chain. If an ensemble of NMR-derived structures is input then the first model in the file is taken as a representative and is used by the PIC server. The output corresponds to the list of residues involved in interaction type of interest. An option is provided, using RasMol (25 (link)) interface and Jmol interface, for enabling visualization of structure in the graphics with interactions highlighted. It is possible to get the results by e-mail. It is also possible to download the output files of the original programs.
A separate panel is available for identification of various types of interactions between polypeptide chains when a multi-chain PDB file is subjected to the analysis. All the said interactions could be explored for their occurrence across the inter-polypeptide chain interface. Thus this panel facilitates recognition of interactions between different subunits in a multimeric protein structures or between proteins in a protein–protein complex structure. Figure 1 show ionic interactions between oppositely charged sidechains across the interface, formed between cyclin-dependent protein kinase and bound cyclin (26 (link)), recognized using PIC server.

Interactions between oppositely charged amino acid sidechains in the interaction interface of cyclic dependent protein kinase 2 (CDKs) and cyclin identified using PIC server. The folds of CDK2 and cyclin and the charged residues in the interface formed by the two proteins are represented in different colours. The ion pairs are highlighted by black dotted lines. This figure is produced using SETOR (35 ).

Solvent accessibility calculations could be used to identify different kinds of interactions between buried or between solvent exposed residues. Solvent accessibility calculations are performed using NACCESS program (Hubbard, S.J. and Thornton, J.M., 1993, NACCESS Computer Program, Department of Biochemistry and Molecular Biology, University College London.). The exposed and buried residues are identified by >7% and ⩽7% residue accessibility, respectively. Under this facility list of all the interaction types are displayed prompting the user to select list of interaction types of interest. For example, a user may prefer to identify interactions between apolar residues that are exposed. Figure 2 shows interactions between solvent exposed apolar residues, in crambin (27 (link)), recognized using PIC server.

Structure of crambin with solvent exposed and interacting apolar sidechains, recognized using PIC. Interactions between apolar sidechains is shown by green dots. Disulphide bonds are shown in yellow. This figure is produced using SETOR (35 ).

Depth of an atom in a protein is defined as the distance from the nearest atom in the surface of the protein structure. Mean depths of atoms of a residue defines the residue depth (28 (link),29 (link)). Analogous to the panel on solvent accessibility, panel on residue depth enables the users to identify specific types of interactions near the protein surface or deep inside the core of the structure. Based on the analysis of residue depth parameter by Chakravarty and Varadarajan (28 (link)) we consider those residues with depths ⩽5 Å as close to the protein surface and others as deep inside. Using this part of the PIC server it is possible to identify interactions between, say, aromatic residues near the protein structural surface. As calculation of residue depths takes a few minutes for most protein structures, results involving depth calculation are sent by e-mail to the user if a valid e-mail address is provided.
Tina K.G., Bhadra R, & Srinivasan N. (2007). PIC: Protein Interactions Calculator. Nucleic Acids Research, 35(Web Server issue), W473-W476.
Publication 2007
Amino Acids Amino Acids, Cyclic CDK2 protein, human crambin protein, Crambe abyssinica Cyclin-Dependent Kinases Cyclins Disulfides Hydrogen Bonds Membrane Proteins Polypeptides Protein Kinases Proteins Protein Subunits SET protein, human Solvents Staphylococcal Protein A Sulfur
2
Molecular Docking Analysis of CDK and STAT3 Inhibitors
Cited 16 times
The three-dimensional (3D) structure of palbociclib (CID: 5330286) and SH-4-54 (CID: 72188643) were retrieved in SDF file format from the PubChem database, while the 3D structures of NSC765690 and NSC765599 were drawn out in sybyl mol2 format using the Avogadro molecular builder and visualization tool vers. 1.XX [46 (link)] and were subsequently transformed into the protein data bank (PDB) format using the PyMOL Molecular Graphics System, vers. 1.2r3pre (Schrödinger, LLC). The PDB file of the 3D structure of the receptors and crystal structures of apo CDK2 (PDB; 4EK3), CDK4/cyclin D3 (PDB; 3G33), CDK6/cyclin (PDB; 1JOW), and STAT3 (PDB; 4ZIA), were retrieved from the Protein Data Bank. The PDB file formats of the ligands (NSC765690, NSC765599, and palbociclib) and the receptors (STAT3; CDK2, 4, and 6) were subsequently converted into the Auto Dock Pdbqt format using AutoDock Vina (vers. 0.8, The Scripps Research Institute, La Jolla, CA, USA) [47 (link)]. Pre-docking preparation of the receptors followed the removal of water molecules, while hydrogen atoms and Kolmman charges were added accordingly. Molecular docking studies were performed using Autodock VINA software and by following the protocols described in our previous study [3 (link)]. The docking results based on hydrogen bonds and electrostatic and hydrophobic interactions of the best pose of the ligand–receptor complexes were expressed as binding energy values (kcal/mol). PyMOL software was used to visualize H-bond interactions, binding affinities, interacting amino acid residues, binding atoms on the ligands and receptors, and 3D graphical representations of ligand-receptor complexes, while 2D graphical illustrations of ligand-binding interactions were further visualized using Discovery studio visualizer vers. 19.1.0.18287 (BIOVIA, San Diego, CA, USA) [48 ].
Lawal B., Liu Y.L., Mokgautsi N., Khedkar H., Sumitra M.R., Wu A.T, & Huang H.S. (2021). Pharmacoinformatics and Preclinical Studies of NSC765690 and NSC765599, Potential STAT3/CDK2/4/6 Inhibitors with Antitumor Activities against NCI60 Human Tumor Cell Lines. Biomedicines, 9(1), 92.
Full text: Click here
Publication 2021
Amino Acids CDK2 protein, human CDK6 protein, human Cyclin D3 Cyclins Electrostatics Hydrogen Hydrogen Bonds Hydrophobic Interactions Ligands palbociclib Proteins STAT3 Protein Versed
3
B2G-FAR: Comprehensive Functional Annotation
Cited 16 times
B2G-FAR presents contents in a user-friendly data sheet concept based on Wiki technology. All the given information (annotations, data files, images) is generated beforehand by the B2G-FAR annotation pipeline and is summarized on automatically generated web pages. This facilitates fast access to data files, images and charts describing genome-wide information. Annotation data can be further visualized and analyzed through its upload into the Blast2GO application (see below: Download and query options). B2G-FAR is periodically updated every 6 months.
Species annotations: by applying the above-described steps, we could assign GO terms to 14 million sequences that represents ∼56.4% of the entire SIMAP database (excluding metagenomic data). The remaining sequences are entries without significant alignments (35.7%) or that did not surpass the annotations quality threshold (7.7%). Sequences from ∼150 000 taxa were functionally annotated and the 2000 most represented species are now available through B2G-FAR. Table 1 contains the numbers of annotated sequences compared with the whole SIMAP dataset and the available source annotations by the GO. Species can be accessed directly by their scientific name or NCBI taxa ID through a search function. For every species, several precalculated files and statistical charts are available. These include a GO annotation flat file and its corresponding GO-Slim version. Statistical charts provide information about GO annotation distributions, GO level distributions or about the most abundant functional terms within one of the three GO categories.

Simap2GO annotation coverage: the table shows the number of Blast2GO-annotated sequences in relation to the whole SIMAP dataset (May 2010) and the number of GO sequences which has been used as annotation source/reference dataset

Data sourceUnique sequences
Whole Simap29 906 548
Simap without metagenomes25 099 929
Simap protein sequences annotated by Blast2GO14 175 984
Sequences which do not surpass the annotation threshold1 938 862
Sequences without sequence alignment8 985 083
GO annotation source sequences (only sequences with non-electronic annotations)465 677

Only sequences with at least one non-electronic annotations (non-IEA) were used (GO-Lite data-set). Additionally, the number of sequences which could not be annotated is given, i.e. sequences without sequence alignments and sequences whose annotations did not surpass the annotation threshold.

Microarray annotations: This section is organized as annotation sheets for each probe-set collection corresponding to the 17 non-model Affymetrix GeneChips. Model species Affymetrix chips were purposely not included in the repository as there already exist extensive functional annotation projects. The annotation sheet contains detailed information on the Blast2GO annotation process from the BLAST step up to the augmentation by ANNEX [a data mining procedure to annotate from links between molecular function and biological process/cellular component GO terms (Myhre et al., 2006 (link))] and InterProScan. In contrast to the previous section, which provides only final annotation records, the microarray probe-set annotation sheets include a great variety of descriptive charts that offer a comprehensive view of the functional information contents gathered throughout the annotation pipeline. Likewise, Blast2GO project files are provided. The charts and files included in the annotation sheets are listed in the Supplementary Table S3.
Download and query options: in both Species and Microarray sections, final annotation files are provided in plaintext format as GO and GO-Slim data. The text file format allows direct upload into the Blast2GO application for further analysis of annotation results as well as integration in other applications accepting GO annotation data. Additionally, all species annotations are available in the standard GO annotation format. Some descriptive charts are included in B2G-FAR for a quick overview of the results. Dynamic access to the data is provided by the Blast2GO Java application. This guarantees optimal reutilization and synchrony within Blast2GO developments. For example, new query options have been incorporated into Blast2GO to support diverse access to B2G-FAR data (see online tutorial available as Supplementary Material). Annotated sequences can be queried and filtered by their name/id, description, GO code and GO name, either as exact or ‘contains’ matches. Existing Blast2GO functions such as the generation of summary charts, single or combined graphs, annotation pies and enrichment analysis can be performed for the sequences selected by the user. Moreover, the .annot files from B2G-FAR are fully compatible with the Babelomics suite (Al-Shahrour et al., 2008 (link); http://www.babelomics.org) for functional profiling analysis, where additional statistical methods for pathway analysis [FatiGO (Al-Shahrour et al., 2004 (link)) and FatiScan (Al-Shahrour et al., 2007 (link))] are available. This is especially interesting in the case of microarray probe files or when a functional enrichment needs to be assessed with experimental data involving any of the non-model species included in the repository.
Comparison of B2G-FAR annotations with GO annotations: the quality of the Blast2GO annotation method has been extensively assessed and proved in previous works (Conesa and Götz, 2008 ; Conesa et al., 2005 (link); Götz et al., 2008 (link)). However, we performed an additional evaluation of the annotation process to provide B2G-FAR users with a general feeling of the performance and nature of the annotations contained in the repository. We selected 10 000 random sequences from B2G-FAR which were also present in the GO database and compared their annotations. We recorded the number of exact GO term matches, more specific or more general terms (different specificity levels of the annotation), other branch or other GO category (true novel annotations) as described previously (Götz et al., 2008 (link)). Results are given in Table 2. The comparison study revealed that most of the original GO annotations (93.5%) were contained in the B2G-FAR repository as exact matches and more specific/general terms and only a small fraction (6.5%) were lost (other GO branch and category annotations) during the annotation process, presumably due to GO version differences or the removal of root category terms in the B2G-FAR repository. When comparing in the opposite direction, we observed that 49% of the B2F-FAR annotations were represented as exact matches in the GOA, and an additional 13% of terms are provided as more specific concepts. The remaining 38% are terms in other branches and in other main GO categories. To have an impression on the nature of these novel B2G-FAR annotations, we checked manually 20 randomly selected sequences for which differences between the two databases were found (see manual_evaluation.xls in Supplementary Material). Curation of the novel GO terms implied contrasting against scientific papers and established functional databases, such as UniProt, Tair, Saccharomyces Genome Database, Entrez, etc. From these 20 sequences one (AT5G35370.1) resulted to have doubtful sequence identity and was not considered in further computations. The remaining 19 sequences accounted for 109 novel GO terms, 9 of which could not be verified from the available literature. One sequence (Cyclin CLB2 of S.cerevisiae) obtained 4 presumably false GO functions due to sequence similarity to a paralogue with different functional specification. The remaining 96 GO terms (88%) were confirmed from literature data and assessed as valid annotations. These results evidence the quality of the GO term assignments contained in B2G-FAR.

Functional annotation of 10 000 random sequences from the GO and B2G-FAR compared against each other (annotation score ≥ 70, evalue ≤1 × E−10, GOw = 5, 5 BLAST hits)

ComparedGO versus FAR*FAR versus GO
Compared terms46 414 (GO)61 176 (B2G-FAR)
Exact GO term match29 44629 446
More specific GO terms5107960
More general GO terms13 457156
Other GO branch112616 193
Other GO category18757421

*Comparisons are given as reference database versus comparing database, and numbers refer to the reference database.

Götz S., Arnold R., Sebastián-León P., Martín-Rodríguez S., Tischler P., Jehl M.A., Dopazo J., Rattei T, & Conesa A. (2011). B2G-FAR, a species-centered GO annotation repository. Bioinformatics, 27(7), 919-924.
Publication 2011
Amino Acid Sequence Apicoectomy Biological Processes Cellular Structures Cyclins DNA Chips Genome Metagenome Microarray Analysis Process Assessment, Health Care Saccharomyces Sequence Alignment
4
Purification and Kinetic Analysis of Cyclin-CDK Complexes
Cited 9 times
The TAP method was applied for purification of cyclin-Cdk1 complexes and Swe1 as described previously for Clb5-TAP-Cdk1 and Clb2-TAP-Cdk1 (Puig et al., 2001; Ubersax et al., 2003 ). 3HA-Cln2-Cdk1 was purified according to published protocols (McCusker et al., 2007 (link)). 6His-tagged recombinant T33-Sic1ΔC constructs and substrates were purified by cobalt affinity chromatography. GST-tagged substrates were purified on glutathione agarose columns.
For the quantitative phosphorylation assays of T33-Sic1ΔC constructs and recombinant substrates, substrate concentrations were kept in the range of 0.5–2 μM (in the linear [S] versus v0 range, several-fold below the estimated KM value), and initial velocity conditions were defined as an initial substrate turnover of up to 10% of the total turnover. For the steady-state peptide kinetics of the Histone peptide PKTPKKAKKL, a similar assay composition was used as for protein substrates, and phosphocellulose paper was used for the quantification of the phosphorylated substrate.
For the western blotting experiments using the Phos-Tag SDS-PAGE, the Sic1ΔC-3HA versions were cloned into vector pRS315 and constitutively expressed under the ADH promoter. The cells were treated for 2.5 hr with 1 μg/ml α factor and released by washing. After the 50 min time point, α factor was readded to collect the cells in the next G1. The cells were lysed by bead beating in lysis buffer containing urea. Blotting of Phos-Tag SDS-PAGE gels was performed using a dry system iBlot (Invitrogen).
For viability assays on galactose plates and for galactose-induced expression time courses, Sic1 mutants were cloned into vector pRS416 under the GAL1 promoter. For flow cytometry experiments, the DNA was stained with propidium iodide and the analysis was performed on a Becton Dickinson BD LSRII flow cytometer.
Kõivomägi M., Valk E., Venta R., Iofik A., Lepiku M., Morgan D.O, & Loog M. (2011). Dynamics of Cdk1 Substrate Specificity during the Cell Cycle. Molecular Cell, 42(5-4), 610-623.
Full text: Click here
Publication 2011
1,3-bis(bis(pyridin-2-ylmethyl)amino)propan-2-ol Biological Assay Buffers CDK1 protein, human Cells Chromatography, Affinity Cloning Vectors Cobalt Cyclins Flow Cytometry Galactose Gels Glutathione Histones Kinetics Peptides phosphocellulose Phosphorylation Propidium Iodide Proteins SDS-PAGE Sepharose Urea
5
Xenopus Egg Extract Replication
Cited 8 times
Xenopus egg extracts were prepared from Xenopus laevis wild type males and females 2–5 years of age, as approved by the Harvard Medical School Institutional Animal Care and use Committee (IACUC) and as described previously46 (link). For DNA replication, 1 volume of ‘licensing mix’ was prepared by adding plasmid DNA to High Speed Supernatant (HSS) of egg cytoplasm to a final concentration of 7.5–15 ng/µl. Licensing mix was incubated for 30 minutes at room temperature, leading to the formation of pre-replication complexes (pre-RCs). Next, licensing mix was supplemented with 0.1 volumes of Cyclin A to a final volume of 576 nM and incubated a further 10 minutes at room temperature, as previously described45 (link). Cyclin A treatment was performed to achieve highly synchronous DNA replication (Extended Data Fig. 10). Finally, 1.9 volumes of nucleoplasmic extract (NPE) was added to initiate Cdk2-dependent replication at pre-RCs. In all Figures, “0 minutes” represents the time 30 seconds after NPE addition. To radiolabel DNA, NPE was supplemented with [α-32 (link)P]dATP. Reactions were stopped with 10 volumes Stop Solution (0.5% SDS, 25 mM EDTA, 50 mM Tris-HCl pH 7.5). DNA in Stop Solution was treated with RNase A (190 ng/µl final concentration) then Proteinase K (909 ng/µl final concentration) before either direct analysis by gel electrophoresis or purification of DNA as described previously40 (link). For UbVS experiments, UbVS (Boston Biochem) was added to final concentration of 20 µM, to HSS 5 minutes prior to addition of plasmid DNA (HSS) and to NPE 5 minutes prior to addition of HSS, with or without 120 µM Ubiquitin (Boston Biochem). Unless otherwise stated in the figure legend, all experiments were performed at least twice and a representative result is shown. Replicate samples were collected from independently assembled replication reactions, and therefore represent biological replicates.
Dewar J.M., Budzowska M, & Walter J.C. (2015). The mechanism of DNA replication termination in vertebrates. Nature, 525(7569), 345-350.
Publication 2015
Biopharmaceuticals CDK2 protein, human Cyclin A Cyclins Cytoplasm DNA Replication Edetic Acid Electrophoresis Endopeptidase K Endoribonucleases Females Institutional Animal Care and Use Committees Males Neoplasm Metastasis Plasmids Tromethamine Ubiquitin Xenopus laevis

Most recents protocols related to «Cyclins»

1
Monitoring Signaling Pathways in CML Cell Lines
Not available on PMC !

Example 7

In order to provide a more readily available and reproducible cell system (and to avoid the problems seen with existing methods), experimental systems based on tissue culture cell lines may be utilized to monitor the impact of drugs on signaling pathways.

Flow cytometric methods using tissue culture cells have been routinely used for investigating the effects of drugs, for example, inhibitors of Bcr/Abl kinase that are useful in the therapy of chronic myeloid leukemia (CML). CML is associated with the Philadelphia chromosome, a genetic translocation that fuses the Abl1 gene on chromosome 9 with part of the BCR gene on chromosome 22. The resulting fusion protein contains a receptor tyrosine kinase that constitutively activates several downstream signaling pathways, including P-STAT5, P-Crkl, P-mTOR, and P—HSF. The Abl kinase is the target of several therapeutics currently used clinically, including imatinib (GLEEVEC™), nilotinib, and dasatinib. These compounds act by inhibiting the tyrosine kinase activity at the receptor level, and also concomitantly inhibit all downstream signaling pathways.

As a representative model of CML, human K562 cell line, which expresses the Bcr/Abl fusion protein and constitutively phosphorylates the downstream STAT5 target (Cytometry 54A; 75-88, 2003), was used in the following experiment. As shown in FIG. 10, treatment of K562 cells for 30 min with 2 μM GLEEVEC™ (imatinib, or STI571) results in >95% inhibition of the phosphorylation of the downstream STAT5 target. Also, as shown in FIG. 10, although the phosphorylation of STAT5 is inhibited after 30 min imatinib exposure, there is no change in the cell cycle, as measured by DNA content.

Phosphorylated STAT5 (P-STAT5) acts as a transcriptional activator of several target proteins, including Cyclin D. Constitutive expression of Cyclin D (induced by P-STAT5) maintains K562 cells in cell cycle. It was found that exposure to imatinib for 24 hr decreases S-phase (as a marker of cell proliferation) by ˜50%, and further exposure to imatinib for an additional 24 hr decreases S-phase by an additional 50-70% (data not shown).

US11867690B2. Identification of functional cell states (2024-01-09). ASEDASCIENCES AG [CH]. Inventors: Bartlomiej Rajwa [US], Vincent T Shankey [US].
Full text: Click here
Patent 2024
Cell Culture Techniques Cell Cycle Cell Lines Cell Proliferation Cells Chromosomes, Human, Pair 9 Chromosomes, Human, Pair 22 CRKL protein Cyclin D Cyclins Dasatinib Flow Cytometry FRAP1 protein, human Fusion Proteins, bcr-abl Genes Gleevec Homo sapiens Imatinib inhibitors K562 Cells Leukemias, Chronic Granulocytic nilotinib Pharmaceutical Preparations Philadelphia Chromosome Phosphorylation Phosphotransferases Proteins Protein Targeting, Cellular Psychological Inhibition Receptor Protein-Tyrosine Kinases SERPINA3 protein, human Signal Transduction Pathways Staphylococcal Protein A STAT5A protein, human STI571 Tissues Transcription, Genetic Translocation, Chromosomal Vision
2
Computational Screening of Rosmarinic Acid
Initially, (R)-(+)-rosmarinic acid was chosen as a ligand molecule and retrieved from the chemical database to find out its antiviral potential against the proteins of dengue and herpes viruses. Similar to the ligand, the viral proteins were retrieved from the protein database (www.rcsb.com) as in crystallographic form to dock with (R)-(+)-rosmarinic acid. The alphanumeric identities of the proteins were 1F5Q murine gamma herpesvirus cyclin complexed to human cyclin-dependent kinase 2 (Card et al. 2000 (link)), 2J7W dengue virus NS5 RNA-dependent RNA polymerase domain complexed with 3’dGTP (Yap et al. 2007 (link)), and 4OIG dengue virus nonstructural protein NS1 (Edeling et al. 2014 (link)).
Samy C.R., Karunanithi K., Sheshadhri J., Rengarajan M., Srinivasan P, & Cherian P. (2023). (R)-(+)-Rosmarinic Acid as an Inhibitor of Herpes and Dengue Virus Replication: an In Silico Assessment. Revista Brasileira De Farmacognosia, 33(3), 543-550.
Publication 2023
Antiviral Agents CDK2 protein, human Crystallography Cyclins Dengue Fever Dengue Virus deoxyguanosine triphosphate Gamma Rays Herpesviridae Ligands Mus Proteins RNA-Directed RNA Polymerase rosmarinic acid Rumex Simplexvirus Viral Nonstructural Proteins Viral Proteins
3
Generating CRISPR-Cas9 Constructs for Cyclin A and CDC25A
CRISPR-Cas9 constructs targeting cyclin A (CAGTATGAGAGCTATCCTCG) or CDC25A (AAGAGCAGGCGGCGGCGGTG) were prepared by ligating the annealing products of 5′-CACCGCAGTATGAGAGCTATCCTCG-3′ and 5′-AAACCGAGGATAGCTCTCATACTGC-3′ or 5′-CACCGAAGAGCAGGCGGCGGCGGTG-3′ and 5′-AAACCACCGCCGCCGCCTGCTCTTC-3′, respectively, to BbsI-cut pX330 (a gift from Feng Zhang; obtained from Addgene; Addgene#42230). CDK2 CRISPR-Cas9 in pX330 was generated as previously described (25 (link)).
FLAG-3C-cyclin A in pCDNA3.1(−) was generated as previously described (61 (link)). CRISPR-resistant silent mutations were introduced into cyclin A with a double PCR procedure. In the first PCR, FLAG-cyclin A in pUHD-P3 (62 (link)) was used as a template and amplified with 5′-AGCTCGTTTAGTGAACCGTCAGATCG-3′ and 5′-GCCATATTGGTAGACTGGTTAGTTG-3′ and 5′-GTCTACCAATATGGCTCTCATACTG-3′ and 5′-TATCTTATCATGTCTGGATCC-3′. These PCR products were then amplified in the second PCR using the franking primers (first and last primers above). AID-cyclin A constructs were generated by inserting NcoI–BamHI-cut fragment of the double PCR product into NcoI–BamHI-cut pRevTRE-AID/Hyg (25 (link)) or pUHD-SB-AID/Hyg (26 (link)).
Ng L.Y., Ma H.T, & Poon R.Y. (2023). Cyclin A–CDK1 suppresses the expression of the CDK1 activator CDC25A to safeguard timely mitotic entry. The Journal of Biological Chemistry, 299(3), 102957.
Full text: Click here
Publication 2023
CDC25A protein, human CDK2 protein, human Clustered Regularly Interspaced Short Palindromic Repeats Cyclin A Cyclins Oligonucleotide Primers Silent Mutation
4
Generation of cell lines with AID-tagged proteins
HeLa (cervical carcinoma) used in this study was a clone expressing the tTA tetracycline transactivator (64 (link)). H1299 cells were obtained from American Type Culture Collection. Cell lines AIDCDK1KO (26 (link)) and AIDCDK2KO (25 (link)) were generated as previously described. mAIDCyclin B1KO was a HeLa cell line expressing cyclin B1-mAID without endogenous cyclin B1 (Adrijana Crncec and RYCP, manuscript in preparation).
AIDCyclin AKO cells from HeLa were generated by retroviral infection (25 (link)) using the construct AID-cyclin A in pRevTRE-AID/Hyg, followed by transfection of cyclin A CRISPR-Cas9 in pX330. AIDCyclin AKO cells from H1299 were generated by transfecting H1299 cells with AID-cyclin A in pUHD-SB-AID/Hyg, pSBbi-TIR1-tTA/Pur (26 (link)), cyclin A CRISPR-Cas9 in pX330, and Sleeping Beauty transposase (pCMV(CAT)T7-SB100; a gift from Zsuzsanna Izsvak; Addgene, #34879) before selecting with hygromycin and puromycin for 2 weeks. AIDCyclin AKO cells lacking CDK2 were generated by cotransfecting CDK2 CRISPR-Cas9 in pX330 and a plasmid expressing blasticidin-resistant gene (a gift from Tim Hunt, Cancer Research UK) into AIDCyclin AKO HeLa cells. After enriching the transfected cells with blasticidin selection for 36 h, the cells were recovered in blasticidin-free medium for 48 h. In all the above cell lines, single cell-derived colonies were obtained by limiting dilution in 96-well plates.
Ng L.Y., Ma H.T, & Poon R.Y. (2023). Cyclin A–CDK1 suppresses the expression of the CDK1 activator CDC25A to safeguard timely mitotic entry. The Journal of Biological Chemistry, 299(3), 102957.
Full text: Click here
Publication 2023
CDK2 protein, human Cell Lines Cells Cervical Cancer Clone Cells Clustered Regularly Interspaced Short Palindromic Repeats Cyclin A Cyclins Genes HeLa Cells hygromycin A Malignant Neoplasms Plasmids Puromycin Retroviridae Infections Technique, Dilution Tetracycline Trans-Activators Transfection Transposase
5
RNA-seq Analysis of Cyclin A Depletion
Biological replicates of G2 cells were harvested at 9 h after release from double thymidine synchronization. Immediately after harvesting, total RNA was extracted using NucleoSpin RNA kit (Macherey-Nagel). The samples were then air-dried in RNA stabilization tubes according to the manufacturer’s instructions before dispatched for library preparation and RNA-sequencing (Genewiz).
For data analysis, fastq files were aligned using STAR algorithm (version 2.5.2a) using Homo sapiens GRCh38.83 as the reference genome. Reads were then counted using HTSeq-Counts (69 (link)) prior to downstream analysis. Statistical analyses on read counts were performed using the DESeq2 package (70 (link)) to identify differentially expressed (DE) genes between two experimental groups (±DI). Genes exhibited a fold change >1 or adjusted p value <0.05 were considered DE. Volcano plots were generated using DEBrowser (version 1.10.9; (71 (link))) using R (version 3.6.3; www.R-project.org) to visualize DE genes upon cyclin A depletion.
Ng L.Y., Ma H.T, & Poon R.Y. (2023). Cyclin A–CDK1 suppresses the expression of the CDK1 activator CDC25A to safeguard timely mitotic entry. The Journal of Biological Chemistry, 299(3), 102957.
Full text: Click here
Publication 2023
Biopharmaceuticals Cells Cyclins DNA Library Genes Genome, Human Thymidine

Top products related to «Cyclins»

1
Anti cyclin b1 by Cell Signaling Technology
Sourced in United States, United Kingdom
Anti-cyclin B1 is a laboratory reagent used in research applications. It is an antibody that specifically binds to the cyclin B1 protein, which is a key regulator of the cell cycle. The core function of Anti-cyclin B1 is to enable the detection and analysis of cyclin B1 expression in cells and tissues.
2
Anti cyclin b1 by Santa Cruz Biotechnology
Sourced in United States, United Kingdom
Anti-cyclin B1 is a laboratory reagent that can be used to detect and study the expression of cyclin B1 in biological samples. Cyclin B1 is a key regulator of the cell cycle and plays a crucial role in the progression from the G2 phase to mitosis. The Anti-cyclin B1 product can be used in various research applications, such as immunoblotting, immunoprecipitation, and immunohistochemistry, to investigate the levels and localization of cyclin B1 in cells and tissues.
3
Pvdf membrane by Merck Group
Sourced in United States, Germany, China, United Kingdom, Morocco, Ireland, France, Italy, Japan, Canada, Spain, Switzerland, New Zealand, India, Hong Kong, Sao Tome and Principe, Sweden, Netherlands, Australia, Belgium, Austria
PVDF membranes are a type of laboratory equipment used for a variety of applications. They are made from polyvinylidene fluoride (PVDF), a durable and chemically resistant material. PVDF membranes are known for their high mechanical strength, thermal stability, and resistance to a wide range of chemicals. They are commonly used in various filtration, separation, and analysis processes in scientific and research settings.
4
Anti β actin by Merck Group
Sourced in United States, United Kingdom, Germany, China, Italy, Japan, Canada, Macao, Sao Tome and Principe, France, Israel, Switzerland, Spain, Belgium, Morocco, Netherlands, Sweden, Senegal
Anti-β-actin is a laboratory reagent used to detect and quantify the presence of the β-actin protein, which is a widely expressed cytoskeletal protein found in eukaryotic cells. It is commonly used as a control or reference protein in various biochemical and cell biology techniques, such as Western blotting and immunocytochemistry.
5
Anti cyclin b1 by Abcam
Sourced in United States, United Kingdom
Anti-cyclin B1 is a laboratory reagent used for the detection and quantification of cyclin B1 protein. Cyclin B1 is a key regulator of the cell cycle and plays a critical role in the progression of cells through the G2/M phase transition. The anti-cyclin B1 antibody can be used in various immunodetection techniques, such as Western blotting, immunohistochemistry, and flow cytometry, to study the expression and localization of cyclin B1 in cells and tissues.
6
Anti cleaved caspase 3 by Cell Signaling Technology
Sourced in United States, United Kingdom, China, Germany, Japan, Canada, France
Anti-cleaved caspase-3 is a lab equipment product that detects the cleaved form of caspase-3, a key executioner caspase involved in apoptosis.
7
Anti cyclin d1 by Cell Signaling Technology
Sourced in United States, United Kingdom, China, Canada
Anti-cyclin D1 is a laboratory reagent used to detect the presence and expression levels of the cyclin D1 protein. Cyclin D1 is a key regulator of the cell cycle and plays a crucial role in the progression of cells through the G1 phase. The anti-cyclin D1 reagent can be used in various experimental techniques, such as western blotting, immunohistochemistry, and flow cytometry, to study the expression and regulation of cyclin D1 in cells and tissues.
8
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
9
Dimethyl sulfoxide (dmso) by Merck Group
Sourced in United States, Germany, United Kingdom, China, Italy, Sao Tome and Principe, France, Macao, India, Canada, Switzerland, Japan, Australia, Spain, Poland, Belgium, Brazil, Czechia, Portugal, Austria, Denmark, Israel, Sweden, Ireland, Hungary, Mexico, Netherlands, Singapore, Indonesia, Slovakia, Cameroon, Norway, Thailand, Chile, Finland, Malaysia, Latvia, New Zealand, Hong Kong, Pakistan, Uruguay, Bangladesh
DMSO is a versatile organic solvent commonly used in laboratory settings. It has a high boiling point, low viscosity, and the ability to dissolve a wide range of polar and non-polar compounds. DMSO's core function is as a solvent, allowing for the effective dissolution and handling of various chemical substances during research and experimentation.
10
Anti cyclin e by Santa Cruz Biotechnology
Sourced in United States
Anti-cyclin E is a laboratory reagent used in research applications. It is an antibody that specifically binds to the cyclin E protein, which plays a key role in the regulation of the cell cycle. The core function of Anti-cyclin E is to facilitate the detection and analysis of cyclin E expression in biological samples.

More about "Cyclins"

Cyclins are a family of essential regulatory proteins that play a crucial role in the cell cycle by controlling the activity of cyclin-dependent kinases (CDKs).
These oscillating proteins drive the progression through different phases of the cell cycle, binding to and activating CDKs to allow the cell to move forward.
Proper regulation of cyclins is vital for maintaining normal cell division and proliferation.
Dysregulation of cyclins has been implicated in the development of various cancers, making them an important target for therapeutic interventions.
Understanding the complex roles of cyclins in cellular processes is crucial for advancing research in cell biology and developing effective treatments for cell-cycle related diseases.
Cyclins, such as cyclin B1, cyclin D1, and cyclin E, are closely monitored during the cell cycle.
Anti-cyclin B1 antibodies can be used to detect and quantify cyclin B1 levels, while anti-cyclin D1 and anti-cyclin E antibodies serve a similar purpose for their respective cyclins.
The TRIzol reagent is commonly used for RNA extraction, and PVDF membranes are often employed in Western blotting techniques to analyze protein expression, including that of cyclins.
Additionally, anti-β-actin and anti-cleaved caspase-3 antibodies may be utilized to assess cellular processes related to cyclins, such as apoptosis and cytoskeletal dynamics.
DMSO, a common solvent, can also play a role in cell cycle research involving cyclins.
By leveraging these tools and techniques, researchers can gain deeper insights into the complex regulation and functions of cyclins, ultimately advancing our understanding of cell cycle dynamics and paving the way for more effective treatments for cell-cycle related diseases.