> Chemicals & Drugs > Amino Acid > Cytochrome P450

Cytochrome P450

Q: What are the different types or variations of Cytochrome P450 enzymes?

Cytochrome P450 is a superfamily of heme-containing enzymes, with over 50 different isoforms identified in humans. The major subfamilies include CYP1, CYP2, CYP3, and CYP4, each with multiple individual enzymes that metabolize specific substrates. These enzymes can vary in their tissue distribution, substrate specificity, and role in drug metabolism and endogenous compound biosynthesis.

Q: How do Cytochrome P450 enzymes contribute to drug metabolism and interactions?

Cytochrome P450 enzymes play a crucial role in the metabolism and pharmacokinetics of many drugs. They catalyze the oxidative degradation of a wide variety of xenobiotics, including many therapeutic compounds. This can lead to significant drug-drug interactions, as the activity of CYP enzymes can be induced or inhibited by certain medications, altering the clearance and efficacy of co-administered drugs. Understanding the specific CYP isoforms involved in metabolizing a drug is essential for predicting and managing these interactions in clinical practice and drug development.

Q: What are some of the key applications of studying Cytochrome P450?

Studying Cytochrome P450 enzymes is essentail for several important areas of research and clinical practice, including: 1) Understanding drug-drug interactions and optimizing dosing for personalized medicine 2) Elucidating the mechanisms of chemical toxicity and metabolism of environmental pollutants 3) Investigating the biosynthesis of cholesterol, steroids, and other endogenous lipids 4) Developing new drugs with improved pharmacokinetic profiles and reduced off-target effects

Q: How can PubCompare.ai assist with Cytochrome P450 research?

PubCompare.ai is an AI-driven tool that can greatly streamline and optimize Cytochrome P450 research. The platform allows you to more efficiently screen the literature and identify the most effective protocols related to Cytochrome P450 for your specific research goals. The AI-powered analysis can highlight key differences in protocol effectiveness, enzme isoform specificity, and other critical insights to help you choose the best approach for reproducibility and accuracy. This can save you significant time and effort in locating the optimal methods for your Cytochrome P450 studies.

Cytochrome P450 is a superfamily of heme-containing monooxygenas enzymes that play a crucial role in the metabolism of a wide variety of endogenous and exogenous compounds.
These enzymes catalyze the oxidative degaradation of many drugs and other xenobiotics, contributing to their pharmacokinetics and toxicity.
Cytochrome P450 enzymes are found in most tissues, with the highest levels in the liver, and are invovled in the biosynthesis of cholesterol, steroids, and other lipids.
Studying Cytochrome P450 is essential for understanding drug-drug interactions, personalized medicine, and the mechanisms of chemical toxicity.

Most cited protocols related to «Cytochrome P450»

Tomato Genome Assembly and Annotation

Cited 347 times

A total of 21 Gb of Roche/454 Titanium shotgun and matepair reads and 3.3 Gb of Sanger paired-end reads, including ~200,000 BAC and fosmid end sequence pairs, were generated from the ‘Heinz 1706’ inbred line (Supplementary Sections 1.1-1.7), assembled using both Newbler and CABOG and integrated into a single assembly (Supplementary Sections 1.17-1.18). The scaffolds were anchored using two BAC-based physical maps, one high density genetic map, overgo hybridization and genome-wide BAC FISH (Supplementary Sections 1.8-1.16 and 1.19). Over 99.9% of BAC/fosmid end pairs mapped consistently on the assembly and over 98% of EST sequences could be aligned to the assembly (Supplementary Section 1.20). Chloroplast genome insertions in the nuclear genome were validated using a matepair method and the flanking regions were identified (Supplementary Sections 1.22-1.24). Annotation was carried out using a pipeline based on EuGene that integrates de novo gene prediction, RNA-Seq alignment and rich function annotation (Supplementary Section 2). To facilitate interspecies comparison, the potato genome was re-annotated using the same pipeline. LTR retrotransposons were detected de novo with the LTR-STRUC program and dated by the sequence divergence between left and right solo LTR (Supplementary Section 2.10). The genome of S. pimpinellifolium was sequenced to 40x depth using Illumina paired end reads and assembled using ABySS (Supplementary Section 3). The tomato and potato genomes were aligned using LASTZ (Supplementary Section 4.1). Identification of triplicated regions was done using BLASTP, in-house generated scripts and three way comparisons between tomato, potato and S. pimpinellifolium using MCscan (Supplementary Sections 4.2-4.4). Specific gene families/groups (genes for ascorbate, carotenoid and jasmonate biosynthesis, cytochrome P450s, genes controlling cell wall architecture, hormonal and transcriptional regulators, resistance genes) were subjected to expert curation/analysis, (Supplementary Section 5). PHYML and MEGA were used to reconstruct phylogenetic trees and MCSCAN was used to infer gene collinearity (Supplementary Section 5.2).

The tomato genome sequence provides insights into fleshy fruit evolution. (2012). Nature, 485(7400), 635-641.

Publication 2012

Anabolism Carotenoids Cell Wall Chromosome Mapping Crossbreeding Cytochrome P450 Fishes Genes Genome Genome, Chloroplast Insertion Mutation jasmonate Lycopersicon esculentum Microtubule-Associated Proteins Physical Examination Retrotransposons RNA-Seq Solanum tuberosum Titanium Transcription, Genetic

Molecular Modeling of Protein-Ligand Interactions

Cited 26 times

The MM/GBSA or MM/PBSA calculations were applied to six different protein systems, including α-thrombin (7 ligands), avidin (7 ligands), cytochrome C peroxidase (18 ligands), neuraminidase (8 ligands), P450cam (12 ligands) and penicillopepsin (7 ligands). The experimental binding data and the PDB entries for the six proteins are listed in Table S1 in the supporting materials. The chemical structures of the ligands are shown in Figure S1 in the supporting materials. The protonated states for all ligands are shown in Figure 1 in the Supporting Materials.
For ligands bound to α-thrombin, cytochrome C peroxidase, neuraminidase and penicillopepsin, MD simulations were performed based on the crystal structures of the complexes. The starting structures of the six avidin analogues (b2–b7) were generated based on the avidin-biotin complex (PDB entry: 1avd33 (link)). The biotin molecule in the crystal structure was manually mutated to the other ligands. It has been shown that the neutral form of the guanidinium group in b2 and b5 biotin analogues is dominant when it is bound to the protein.34 (link) Therefore, the neutral form of the guanidinium group was used in our simulations. The crystal structures of the nine P450cam ligands were used for MD simulations. Starting structures of the other three P450 ligands (e3, e5 and e6) were obtained by manually modifying the ligand (e1) in the crystal structure of 2cpp35 (link) with the conformation of the protein unaltered. The preparation of the models was accomplished in the SYBYL molecular simulation package.36
In the cytochrome C peroxidase complexes, the lone-pair electrons of the epsilon nitrogen in His175 form resonant bonds with the iron ion and the hydrogen atom is located at the delta nitrogen of His175. In the P450cam complexes, lone-pair electrons of the sulfur atom in Cys357 form resonant bonds with the iron ion and this cysteine residue is thus deprotonated. All the crystal water molecules were kept in the simulations.
The atomic partial charges of all ligands were derived by semiempirical AM1 geometry optimization and subsequent single-point Hartree-Fock (HF)/6-31G* calculations of the electrostatic potential, to which the charges were fitted using the RESP technique.37 The reason why we chose AM1 for optimization, not usually used HF/6-31G(d), is to reduce computational cost.38 (link) The optimization and the electrostatic potential calculations were conducted by Gaussian03.39 Partial charges and force field parameters of the inhibitors were generated automatically using the antechamber program in AMBER9.0.40 (link)
In molecular mechanics (MM) minimizations and MD simulations, the AMBER03 force field was used for proteins41 (link) and the general AMBER force field (gaff) was used for ligands.42 (link) The force field parameters developed by Giammona were used for the heme groups in the cytochrome C peroxidase and the P450cam systems.43 To neutralize the systems, counter ions of Cl− or Na+ were placed in grids that had the largest positive or negative Coulombic potential around the protein. The whole system was immersed in a rectangular box of TIP3P water molecules. The water box was extended 9 Å from solute atoms in all three dimensions.

Hou T., Wang J., Li Y, & Wang W. (2010). Assessing the performance of the MM/PBSA and MM/GBSA methods: I. The accuracy of binding free energy calculations based on molecular dynamics simulations. Journal of chemical information and modeling, 51(1), 69-82.

Publication 2010

Amber Avidin Biotin Camphor 5-Monooxygenase Cysteine Cytochrome c Group Cytochrome c Peroxidase Cytochrome P450 Electrons Electrostatics Guanidine Heme Hydrogen inhibitors Ions Iron Ligands Mechanics Molecular Structure Neuraminidase Nitrogen Peroxidases poly(tetramethylene succinate-co-tetramethylene adipate) Proteins Respiratory Rate Sulfur Thrombin

Transposable Elements Annotation and Analysis

Cited 16 times

Transposable elements were identified using Repeat-Masker [6 ] and MIPS Repeat Element Database (mips-REdat) and Catalog (mips-REcat) [27 ,28 (link)]. This database provides a hierarchical classification of plant transposable elements and other repeat types. Before use, the database was screened for non-TE related sequences and the following identifiers were removed: 'bsr1' (containing cytochrome P450 and hydrolase sequences), 'k_1' (containing proton-ATPase sequence), and 'magellan_cone' (containing myb transcription factor sequence).
Receiver operating characteristic (ROC) curves were compared by the method of [29 (link)], as implemented in the MedCalc^®statistical software package.

Kurtz S., Narechania A., Stein J.C, & Ware D. (2008). A new method to compute K-mer frequencies and its application to annotate large repetitive plant genomes. BMC Genomics, 9, 517.

Full text: Click here

Publication 2008

Adenosine Triphosphatases Cytochrome P450 DNA Transposable Elements Hydrolase Macrophage Inflammatory Protein-1 Plant Cone Plants Protons Transcription Factor

Analysis of P450 Signature Domains in Fungal Enzymes

Cited 15 times

In order to analyze the P450 signature domains in the selected fungal P450s, we performed ClustalW analysis using Molecular Evolutionary Genetics Analysis (MEGA 5.2.2) software [47] (link). The advantage of using MEGA-based ClustalW is that this program combines both pairwise alignment and multiple alignment as part of ClustalW.
The ClustalW-aligned P450 sequences were analyzed for amino acid patterns in the P450 signature motifs EXXR and CXG. The amino acid residues in P450 signatures were selected from the ClustalW program from MEGA and computed into tabular form. After sorting to ascending order, manual analyses were performed to check the type of amino acids and their count in P450 signature motifs. The proportions of types of amino acids were calculated and presented in both pie charts and tables.
Some P450s showed variations of the EXXR and CXG motifs. The same phenomenon was also reported in the literature [5] (link), [48] (link), [49] (link). Authors have suggested that these P450s may be misaligned or that the P450s are missing the invariant residues at the EXXR and CXG motif. This is unlike the Streptomyces species P450s that did not contain the conserved EXXR domain but rather EVLW and EQILW [27] (link), [28] (link), which had been proved to be functional. Owing to the lack of functional data with regard to the fungal P450s, which lack the EXXR and CXG motifs signature amino acids; we excluded these P450s from this analysis.

Syed K, & Mashele S.S. (2014). Comparative Analysis of P450 Signature Motifs EXXR and CXG in the Large and Diverse Kingdom of Fungi: Identification of Evolutionarily Conserved Amino Acid Patterns Characteristic of P450 Family. PLoS ONE, 9(4), e95616.

Full text: Click here

Publication 2014

Amino Acids Biological Evolution Cytochrome P450 Evolution, Molecular Streptomyces

Comprehensive Genome Annotation of Blattodea

Cited 13 times

The B. germanica genome was annotated with Maker (version 2.31.8)⁶⁸, using the species-specific repeat library, B. germanica transcriptome data (22 whole-body RNA-Seq samples) and the Swiss-Prot/ UniProt database (last accessed: 21 January 2016) plus the C. secundus and Zootermopsis nevadensis protein sequences for evidence-based gene model predictions. AUGUSTUS (version 3.2)^{69 (link)}, GeneMark-ES Suite (version 4.21)^{70 (link)} and SNAP⁷¹ were used for ab initio predictions. C. secundus protein-coding genes were predicted using homology-based, ab initio and expression-based methods, and integrated into a final gene set (see Supplementary Information). Gene structures were predicted by GeneWise^{72 (link)}. The ab initio annotations were predicted with AUGUSTUS^{73 (link)} and SNAP⁷¹, retained if supported by both methods and integrated with the homology-based predictions using GLEAN^{74 (link)}. Transcriptome-based gene models were merged with PASA^{75 (link)} and tested for coding potential with CPC^{76 (link)} and OrfPredictor^{77 (link)}. PASA gene models were merged with the homology-based and ab initio gene set, retaining the PASA models in case of overlap. Desaturases, elongases, chemosensory receptors, cytochrome P450s and genes involved in the juvenile hormone pathway were manually curated in Blattodea.

Harrison M.C., Jongepier E., Robertson H.M., Arning N., Bitard-Feildel T., Chao H., Childers C.P., Dinh H., Doddapaneni H., Dugan S., Gowin J., Greiner C., Han Y., Hu H., Hughes D.S., Huylmans A.K., Kemena C., Kremer L.P., Lee S.L., Lopez-Ezquerra A., Mallet L., Monroy-Kuhn J.M., Moser A., Murali S.C., Muzny D.M., Otani S., Piulachs M.D., Poelchau M., Qu J., Schaub F., Wada-Katsumata A., Worley K.C., Xie Q., Ylla G., Poulsen M., Gibbs R.A., Schal C., Richards S., Belles X., Korb J, & Bornberg-Bauer E. (2018). Hemimetabolous genomes reveal molecular basis of termite eusociality. Nature ecology & evolution, 2(3), 557-566.

Publication 2018

Base Sequence Blattaria citrate carrier Cytochrome P450 DNA Library Gene Products, Protein Genes Genetic Structures Genome Human Body Juvenile Hormones RNA-Seq Transcriptome

Most recents protocols related to «Cytochrome P450»

Biosynthesis of Bisbenzylisoquinoline Alkaloids in Engineered Yeast

Not available on PMC !

Example 5

FIG. 16 illustrates (A) a biosynthetic scheme for conversion of L-tyrosine to bisBlAs and (B) yeast strains engineered to biosynthesize bisBlAs, in accordance with embodiments of the invention. In particular, FIG. 16 illustrates (A) a pathway that is used to produce bisBlAs berbamunine and guattegaumerine. FIG. 16 provides the use of the enzymes ARO9, aromatic aminotransferase; ARO10, phenylpyruvate decarboxlase; TyrH, tyrosine hydroxylase; DODC, DOPA decarboxylase; NCS, norcoclaurine synthase; 6OMT, 6-O-methyltransferase; CNMT, coclaurine N-methyltransferase; CYP80A1, cytochrome P450 80A1; CPR, cytochrome P450 NADPH reductase. Of the metabolites provided in FIG. 16, 4-HPA, 4-HPP, and L-tyrosine are naturally synthesized in yeast. Other metabolites that are shown in FIG. 16 are not naturally produced in yeast.

In examples of the invention, a bisBIA-producing yeast strain, that produces bisBlAs such as those generated using the pathway illustrated in (A), is engineered by integration of a single construct into locus YDR514C. Additionally, FIG. 16 provides (B) example yeast strains engineered to synthesize bisBlAs. Ps6OMT, PsCNMT, PsCPR, and BsCYP80A1 were integrated into the yeast genome at a single locus (YDR514C). Each enzyme was expressed from a constitutive promoter. The arrangement and orientation of gene expression cassettes is indicated by arrows in the schematic. These strains convert (R)- and (S)-norcoclaurine to coclaurine and then to N-methylcoclaurine. In one example, the strains may then conjugate one molecule of (R)—N-methylcoclaurine and one molecule of (S)—N-methylcoclaurine to form berbamunine. In another example, the strains may conjugate two molecules of (R)—N-methylcoclaurine to form guattegaumerine. In another example, the strains may conjugate one molecule of (R)—N-methylcoclaurine and one molecule of (S)-coclaurine to form 2′-norberbamunine. In another embodiment, the strain may be engineered to supply the precursors (R)- and (S)-norcoclaurine from L-tyrosine, as provided in FIG. 5.

The construct includes expression cassettes for P. somniferum enzymes 6OMT and CNMT expressed as their native plant nucleotide sequences. A third enzyme from P. somniferum, CPR, is codon optimized for expression in yeast. The PsCPR supports the activity of a fourth enzyme, Berberis stolonifera CYP80A1, also codon optimized for expression in yeast. The expression cassettes each include unique yeast constitutive promoters and terminators. Finally, the integration construct includes a LEU2 selection marker flanked by loxP sites for excision by Cre recombinase.

A yeast strain expressing Ps6OMT, PsCNMT, BsCYP80A1, and PsCPR is cultured in selective medium for 16 hours at 30° C. with shaking. Cells are harvested by centrifugation and resuspended in 400 μL breaking buffer (100 mM Tris-HCl, pH 7.0, 10% glycerol, 14 mM 2-mercaptoethanol, protease inhibitor cocktail). Cells are physically disrupted by the addition of glass beads and vortexing. The liquid is removed and the following substrates and cofactors are added to start the reaction: 1 mM (R,S)-norcoclaurine, 10 mM S-adenosyl methionine, 25 mM NADPH. The crude cell lysate is incubated at 30° C. for 4 hours and then quenched by the 1:1 addition of ethanol acidified with 0.1% acetic acid. The reaction is centrifuged and the supernatant analyzed by liquid chromatography mass spectrometry (LC-MS) to detect bisBlA products berbamunine, guattegaumerine, and 2′-norberbamunine by their retention and mass/charge.

US11859225B2. Methods of producing epimerases and benzylisoquinoline alkaloids (2024-01-02). The Board of Trustees of the Leland Stanford Junior University [US]. Inventors: Christina D. Smolke [US], Stephanie Galanie [US], Isis Trenchard [US], Catherine Thodey [US], Yanran Li [US].

Full text: Click here

Patent 2024

2-Mercaptoethanol 3-phenylpyruvate Acetic Acid Allopurinol Anabolism Barberry Base Sequence berbamunine Buffers Cells Centrifugation coclaurine Codon Cre recombinase Culture Media Cytochrome P450 Dopa Decarboxylase enzyme activity Enzymes Ethanol Gene Expression Genome Glycerin guatteguamerine higenamine Liquid Chromatography Mass Spectrometry Methyltransferase NADP NADPH-Ferrihemoprotein Reductase norcoclaurine synthase Plants Protease Inhibitors Retention (Psychology) S-adenosyl-L-methionine coclaurine N-methyltransferase S-Adenosylmethionine Saccharomyces cerevisiae Strains Transaminases Tromethamine Tyrosine Tyrosine 3-Monooxygenase

Quantitative Analysis of Intestinal Tight Junctions and Inflammatory Markers

Total RNA was extracted from the jejunum mucosa, using the RNeasy Mini Kit (GeneBetter, Beijing, China). The concentration of each RNA sample was quantified using the NanoDrop 2000 (Nanodrop Technologies, Wilmington, DE, USA). The cDNA was transcribed at 37 °C for 15 min and 85 °C for 5 s using the PrimeScriptTM RT reagent kit with gDNA Eraser (Takara Biomedical Technology in Beijing, China). qRT-PCR with 40 amplification cycles was conducted with a commercial kit (PerfectStart Green qPCR SuperMix, TransGen Biotech, Beijing, China). In detail, a total of 10 μL reaction mixture contain 1 μL of cDNA, 0.4 μL forward primer, 0.4 μL reverse primer, 0.2 μL of ROX, and 3 μL of PCR-grade water. The gene of β-actin was used as an internal control. Primers used were listed in Table 1. The relative gene expression level between the control group and the treatment group was calculated by the 2^-ΔΔCt method, and the value was normalized to the internal control.Table 1

Primer sequences used for real-time PCR

Gene	Primer	Nucleotide sequences (5′ to 3′)
β-actin	F	GCGTAGCATTTGCTGCATGA
β-actin	R	GCGTGTGTGTAACTAGGGGT
ZO-1	F	CTCCAGGCCCTTACCTTTCG
ZO-1	R	GGGGTAGGGGTCCTTCCTAT
Occludin	F	CAGGTGCACCCTCCAGATTG
Occludin	R	TATGTCGTTGCTGGGTGCAT
Claudin-1	F	TCGACTCCTTGCTGAATCTG
Claudin-1	R	TTACCATACCTTGCTGTGGC
IL-1β	F	GCCAGTCTTCATTGTTCAGGTTT
IL-1β	R	CCAAGGTCCAGGTTTTGGGT
IL-6	F	TCCAATCTGGGTTCAATCA
IL-6	R	TCTTTCCCTTTTGCCTCA
IL-8	F	TACGCATTCCACACCTTTC
IL-8	R	GGCAGACCTCTTTTCCATT
IL-10	F	TCGGCCCAGTGAAGAGTTTC
IL-10	R	GGAGTTCACGTGCTCCTTGA
IL-17	F	CTCTCGTGAAGGCGGGAATC
IL-17	R	GTAATCTGAGGGCCGTCTGG
TNF-α	F	CGTCGCCCACGTTGTAGCCAAT
TNF-α	R	GCCCATCTGTCGGCACCACC
AhR	F	CATGCTTTGGTCTTTTATGC
AhR	R	TTCCCTTTCTTTTTCTGTCC
CYP1A1	F	CCTTCACCATCCCTCACAGT
CYP1A1	R	ATCACCTTTTCACCCAGTGC
CYP1B1	F	AATAACGGGGGAAATTCCTG
CYP1B1	R	CACCGAAACACAATGCAATC
RegIIIγ	F	AACCTGGATGGGTGCAGACGTG
RegIIIγ	R	TTGGTTCCAAGCCCTCGGTG
IL-22	F	CTACATCACCAACCGCACCT
IL-22	R	TCAGAGTTGGGGAACAGCAC

ZO-1 Zonula occludens-1, IL-1 Interleukin 1, IL-6 Interleukin 6, IL-8 Interleukin 8, IL-10 Interleukin 10, IL-17 Interleukin17, TNF-α Tumor necrosis factor-alpha, CYP1A1 Cytochrome P450, family 1, subfamily A, polypeptide 1, CYP1B1 Cytochrome P450, family 1, subfamily B, polypeptide 1, IL-22 Interleukin 22

Dang G., Wen X., Zhong R., Wu W., Tang S., Li C., Yi B., Chen L., Zhang H, & Schroyen M. (2023). Pectin modulates intestinal immunity in a pig model via regulating the gut microbiota-derived tryptophan metabolite-AhR-IL22 pathway. Journal of Animal Science and Biotechnology, 14, 38.

Full text: Click here

Publication 2023

Actins Biomedical Technology CYP1B1 protein, human Cytochrome P-450 CYP1A1 Cytochrome P450 DNA, Complementary Gene Expression Genes IL17A protein, human IL22 protein, human Interleukin-1 Interleukin-6 Interleukin-8 Interleukin-10 Interleukins Jejunum Mucous Membrane Oligonucleotide Primers Polypeptides Tight Junctions Tumor Necrosis Factor-alpha

Detoxifying Enzymes and Gene Expression in Whitefly

Activities of three detoxifying enzymes (GST, EST, and P450) were measured as previously described (Wang et al., 2020a (link)) with slight alterations. The median lethal concentration (LC₅₀) treatment comprised adults that survived treatment with the LC₅₀ concentration for 96 h, and the control group was made of insects treated with the control for the same period of time. For each group, 200 mixed-sex B. tabaci individuals were sampled as one replicate. Three replicates were sampled for each of the three detoxifying enzymes. Protein content was measured using bovine serum albumin (BSA) as the standard with the method described by Bradford (1976) (link). Based on previous publications regarding P450-mediated pesticide resistance in B. tabaci (Wang Q. et al., 2020 (link); Zhou et al., 2020 (link)), expression levels of 12 detoxifying genes were measured via quantitative reverse transcription (qRT)-PCR as previously described (Wang et al., 2020a (link)): CYP6CX1v1, CYP6CX3, CYP6CX4, CYP6CX5, CYP6CM1, CYP6DW2, CYP6DW3, CYP6DZ4, CYP6DZ7, CYP303A1, CYP4C64, and CYP4G68. Expression data were normalized using TUB1α and EF-1α as the internal control genes, and the results were conducted in terms of the 2^−△△Ct method (Pfaffl, 2001 (link)). Primer sequences are shown in Supplementary Table S1.

Wang R., Zhang Q., Qu C., Wang Q., Wang J, & Luo C. (2023). Toxicity, baseline of susceptibility, detoxifying mechanism and sublethal effects of chlorogenic acid, a potential botanical insecticide, on Bemisia tabaci. Frontiers in Plant Science, 14, 1150853.

Full text: Click here

Publication 2023

Adult Cytochrome P450 DNA Replication enzyme activity Enzymes Gene Expression Gene Expression Regulation Insecta Oligonucleotide Primers Pesticides Proteins Reverse Transcription Serum Albumin, Bovine

Liver Fibrosis Induction and Treatment

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2023

Captopril CCL4 protein, human Choledochus Cholestasis Cytochrome P450 Fibrosis, Liver Ligation Losartan Mus Phenobarbital

Factors Influencing Bepridil Plasma Concentrations

The collection time of the plasma sample included data from before administration of bepridil to up to 6 h after administration. To assess risk factors for achieving plasma bepridil concentrations ≥800 ng/mL at steady state, the eligible patients were divided into two groups based on their bepridil concentrations: ≥800 ng/mL and < 800 ng/mL.
The C/D ratio was calculated using the following equation:
C/D ratio of bepridil = plasma concentration of bepridil (ng/mL) / dose of bepridil (mg/day/kg body weight).
In this study, we defined the polypharmacy group as those who use six or more drugs, whereas the non-polypharmacy group was those who took fewer than six drugs. The relationship between plasma bepridil concentrations ≥800 ng/mL and baseline characteristics, including sex, age, height, body weight, body mass index, serum creatinine, creatinine clearance (Ccr), number of concomitant drugs used, typical inducers of CYPs (phenytoin, carbamazepine, phenobarbital, and rifampicin) [15 (link)], typical inhibitors of CYPs (erythromycin, clarithromycin, protease inhibitors, and azole antifungals) [15 (link)], aprindine, a competitive inhibitor of CYP2D6 [12 (link)], typical inhibitor of P-gp (amiodarone, diltiazem, nicardipine, nifedipine, propranolol, quinidine, cyclosporin, and tacrolimus) [16 (link)–18 (link)], and left ventricular ejection fraction (LVEF), were examined. LVEF was measured using echocardiographic equipment provided at each hospital. Ccr was estimated using the Cockcroft–Gault formula [19 (link)].
The patient’s medical history and duration of bepridil treatment were collected from medical records.

Asai Y., Arihara H., Omote S., Tanio E., Yamashita S., Higuchi T., Hashimoto E., Yamada M., Tsuji H., Kondo Y., Hayashi M, & Yamamoto Y. (2023). Effect of polypharmacy on plasma bepridil concentration in patients with heart failure: a multicenter retrospective study. Journal of Pharmaceutical Health Care and Sciences, 9, 10.

Full text: Click here

Publication 2023

Amiodarone Antifungal Agents Aprindine Azoles Bepridil Body Weight Carbamazepine Clarithromycin Creatinine Cyclosporine Cytochrome P-450 CYP2D6 Inhibitors Cytochrome P450 Diltiazem Echocardiography Erythromycin Index, Body Mass inhibitors Nicardipine Nifedipine Patients Pharmaceutical Preparations Phenobarbital Phenytoin Plasma Polypharmacy Propranolol Protease Inhibitors Quinidine Rifampin Serum Specimen Collection Tacrolimus Ventricular Ejection Fraction

Top products related to «Cytochrome P450»

Trizol reagent by Thermo Fisher Scientific

Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand

TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.

Formic acid by Merck Group

Sourced in Germany, United States, Italy, United Kingdom, France, Spain, China, Poland, India, Switzerland, Sao Tome and Principe, Belgium, Australia, Canada, Ireland, Macao, Hungary, Czechia, Netherlands, Portugal, Brazil, Singapore, Austria, Mexico, Chile, Sweden, Bulgaria, Denmark, Malaysia, Norway, New Zealand, Japan, Romania, Finland, Indonesia

Formic acid is a colorless, pungent-smelling liquid chemical compound. It is the simplest carboxylic acid, with the chemical formula HCOOH. Formic acid is widely used in various industrial and laboratory applications.

P450 glo assay by Promega

Sourced in United States

The P450-Glo assay is a luminescent-based assay that measures the activity of cytochrome P450 enzymes. It provides a sensitive and quantitative method for determining P450 enzyme activity in vitro.

Ketoconazole by Merck Group

Sourced in United States, Germany, India, Sao Tome and Principe, United Kingdom, Macao, Israel

Ketoconazole is a laboratory product manufactured by Merck Group. It is an antifungal agent used for research and development purposes. The core function of Ketoconazole is to inhibit the synthesis of ergosterol, a key component of fungal cell membranes.

Acetonitrile by Merck Group

Sourced in Germany, United States, Italy, India, China, United Kingdom, France, Poland, Spain, Switzerland, Australia, Canada, Brazil, Sao Tome and Principe, Ireland, Belgium, Macao, Japan, Singapore, Mexico, Austria, Czechia, Bulgaria, Hungary, Egypt, Denmark, Chile, Malaysia, Israel, Croatia, Portugal, New Zealand, Romania, Norway, Sweden, Indonesia

Acetonitrile is a colorless, volatile, flammable liquid. It is a commonly used solvent in various analytical and chemical applications, including liquid chromatography, gas chromatography, and other laboratory procedures. Acetonitrile is known for its high polarity and ability to dissolve a wide range of organic compounds.

Nadph by Merck Group

Sourced in United States, Germany, Sao Tome and Principe, China, United Kingdom, France, Czechia, Spain, India, Italy, Canada, Macao, Japan, Portugal, Brazil, Belgium

NADPH, or Nicotinamide Adenine Dinucleotide Phosphate, is a cofactor essential for various cellular processes. It plays a crucial role in enzymatic reactions, serving as an electron donor in oxidation-reduction reactions. NADPH is a key component in several metabolic pathways, including biosynthesis, antioxidant defense, and energy production.

P450 glo assay kit by Promega

Sourced in United States

The P450-Glo Assay Kit is a luminescent-based assay designed to measure the activity of cytochrome P450 enzymes. The kit provides reagents and a protocol for detecting and quantifying P450 enzyme activity in cell lysates, microsomes, or other biological samples.

P450 glo by Promega

Sourced in United States

The P450-Glo assay is a luminescent-based assay that measures the activity of cytochrome P450 enzymes. The assay uses luciferin-based substrates that are selectively metabolized by specific P450 isoforms, generating a luminescent signal proportional to the enzyme activity.

Methanol by Merck Group

Sourced in Germany, United States, Italy, India, United Kingdom, China, France, Poland, Spain, Switzerland, Australia, Canada, Sao Tome and Principe, Brazil, Ireland, Japan, Belgium, Portugal, Singapore, Macao, Malaysia, Czechia, Mexico, Indonesia, Chile, Denmark, Sweden, Bulgaria, Netherlands, Finland, Hungary, Austria, Israel, Norway, Egypt, Argentina, Greece, Kenya, Thailand, Pakistan

Methanol is a clear, colorless, and flammable liquid that is widely used in various industrial and laboratory applications. It serves as a solvent, fuel, and chemical intermediate. Methanol has a simple chemical formula of CH3OH and a boiling point of 64.7°C. It is a versatile compound that is widely used in the production of other chemicals, as well as in the fuel industry.

Prism 6 by GraphPad

Sourced in United States, United Kingdom, Canada, China, Germany, Japan, Belgium, Israel, Lao People's Democratic Republic, Italy, France, Austria, Sweden, Switzerland, Ireland, Finland

Prism 6 is a data analysis and graphing software developed by GraphPad. It provides tools for curve fitting, statistical analysis, and data visualization.

What are the different types or variations of Cytochrome P450 enzymes?

Cytochrome P450 is a superfamily of heme-containing enzymes, with over 50 different isoforms identified in humans. The major subfamilies include CYP1, CYP2, CYP3, and CYP4, each with multiple individual enzymes that metabolize specific substrates. These enzymes can vary in their tissue distribution, substrate specificity, and role in drug metabolism and endogenous compound biosynthesis.

How do Cytochrome P450 enzymes contribute to drug metabolism and interactions?

Cytochrome P450 enzymes play a crucial role in the metabolism and pharmacokinetics of many drugs. They catalyze the oxidative degradation of a wide variety of xenobiotics, including many therapeutic compounds. This can lead to significant drug-drug interactions, as the activity of CYP enzymes can be induced or inhibited by certain medications, altering the clearance and efficacy of co-administered drugs. Understanding the specific CYP isoforms involved in metabolizing a drug is essential for predicting and managing these interactions in clinical practice and drug development.

What are some of the key applications of studying Cytochrome P450?

Studying Cytochrome P450 enzymes is essentail for several important areas of research and clinical practice, including: 1) Understanding drug-drug interactions and optimizing dosing for personalized medicine 2) Elucidating the mechanisms of chemical toxicity and metabolism of environmental pollutants 3) Investigating the biosynthesis of cholesterol, steroids, and other endogenous lipids 4) Developing new drugs with improved pharmacokinetic profiles and reduced off-target effects

How can PubCompare.ai assist with Cytochrome P450 research?

PubCompare.ai is an AI-driven tool that can greatly streamline and optimize Cytochrome P450 research. The platform allows you to more efficiently screen the literature and identify the most effective protocols related to Cytochrome P450 for your specific research goals. The AI-powered analysis can highlight key differences in protocol effectiveness, enzme isoform specificity, and other critical insights to help you choose the best approach for reproducibility and accuracy. This can save you significant time and effort in locating the optimal methods for your Cytochrome P450 studies.

More about "Cytochrome P450"

Cytochrome P450, also known as CYP450 or CYP, is a superfamily of heme-containing monooxygenase enzymes that play a crucial role in the metabolism of a wide variety of endogenous and exogenous compounds.
These enzymes are responsible for the oxidative degradation of many drugs and other xenobiotics, contributing to their pharmacokinetics and toxicity.
Cytochrome P450 enzymes are found in most tissues, with the highest levels in the liver, and are involved in the biosynthesis of cholesterol, steroids, and other lipids.
Studying these enzymes is essential for understanding drug-drug interactions, personalized medicine, and the mechanisms of chemical toxicity.
When conducting research on Cytochrome P450, it's important to consider the use of related reagents and techniques.
TRIzol reagent can be used for RNA extraction, while formic acid and acetonitrile are commonly used in sample preparation.
The P450-Glo assay and P450-Glo Assay Kit can be utilized to measure Cytochrome P450 activity, and NADPH is a cofactor required for Cytochrome P450-mediated reactions.
Ketoconazole is a known inhibitor of certain Cytochrome P450 enzymes, and can be used to study drug-drug interactions.
Methanol is another solvent that may be employed in Cytochrome P450 research.
Prism 6 is a data analysis software that can be used to interpret the results of Cytochrome P450 studies.
By incorporating these related terms and techniques, researchers can optimize their Cytochrome P450 research and achieve better results.
PubCompare.ai, an AI-driven protocol comparison tool, can assist in identifying the most effective products and procedures for your Cytochrome P450 studies, helping you streamline your research and discover reproducible science.