Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > DNA Polymerase I

DNA Polymerase I

DNA polymerases I are enzymes that catalyze the replication and repair of DNA by adding complementary nucleotides to a DNA template strand.
They play a crucial role in DNA metabolism and are widely used in molecular biology research, including cloning, sequencing, and genetic engineering.
This MeSH term provides a comprehensive overview of DNA polymerase I, its functionalities, and its applications in scientific investigations.

Most cited protocols related to «DNA Polymerase I»

1
Sequencing and Assembly of Rice Genome
The IRGSP clone and PCR sequences of the O. sativa (japonica group, cultivar Nipponbare) genome deposited in the International Nucleotide Sequence Databases as of 25 February 2010 were used in construction of the MTP. In addition, sequence reads generated by the Syngenta rice genome sequencing project (Goff et al. 2002 (link)) were assembled and used to extend contigs.
For the next-generation DNA sequencing of an NIAS individual, total genomic DNA was prepared from nuclei isolated from Nipponbare rice young leaves (two weeks after germination) using the CTAB method (Murray and Thompson 1980 (link)). The DNA samples were fragmented by a nebulizer or Branson Sonifier 250 (Danbury, CT). Sequencing libraries were constructed following the protocols with Illumina Genomic DNA Sample Preparation Kit and Roche GS DNA Library Preparation Kit, respectively. Illumina genome sequencing was performed by Illumina Genome Analyzer II/IIx with the Illumina version 2 sequencing kit. GS-FLX genome sequencing was performed using the Roche GS LR70 Sequencing Kit. The sequence reads are available at the DDBJ Sequence Read Archive (DRA000651).
For the CSHL individual, ~5 μg of Nipponbare rice genomic DNA was used as input for standard Illumina libraries. The DNA was sheared by adaptive focused acoustics using the Covaris (Woburn, MA) instrument and end-repaired using T4 DNA polymerase, Klenow fragment, and T4 polynucleotide kinase. Fragments were then treated with Klenow fragment (3’ - 5’ exonuclease) to add a single 3’ deoxyA overhang and ligated to standard paired-end Illumina adapters. Qiagen (Valencia, CA) columns were used for purification between steps. The fragments were size-selected at ~225 bp (including adapters) using agarose gel electrophoresis. The actual insert size excluding adapters was ~150 bp. The library was then PCR amplified using Phusion DNA polymerase in HF buffer for 14 cycles and quantified using the Agilent BioAnalyzer (Santa Clara, CA). All libraries were normalized to 10 nM before loading on the Illumina sequencers. Production sequencing was performed using Illumina GAIIx instruments with paired-end modules using the Illumina version 3 sequencing kits. The library was sequenced with 76 bp paired-end read lengths. Sequence data was processed using the Illumina GAPipeline v1.1 and v1.3.2 (Firecrest/Bustard v1.9.6 and Firecrest/Bustard v1.3.2). The sequence reads are available at the Sequence Read Archive of NCBI (SRX032913).
Syngenta rice genome sequences (Goff et al. 2002 (link)) were filtered by using IRGSP rice genomic sequences with similarity searches. The filtered sequences were then assembled; 50 large Syngenta contigs (between 4 kb and 40 kb), a total of 748 kb were used for potential gap filling.
Kawahara Y., de la Bastide M., Hamilton J.P., Kanamori H., McCombie W.R., Ouyang S., Schwartz D.C., Tanaka T., Wu J., Zhou S., Childs K.L., Davidson R.M., Lin H., Quesada-Ocampo L., Vaillancourt B., Sakai H., Lee S.S., Kim J., Numa H., Itoh T., Buell C.R, & Matsumoto T. (2013). Improvement of the Oryza sativa Nipponbare reference genome using next generation sequence and optical map data. Rice, 6, 4.
Full text: Click here
Publication 2013
3'-5'-Exonucleases A-748 Acclimatization Acoustics Buffers Cell Nucleus Cetrimonium Bromide Clone Cells DNA-Directed DNA Polymerase DNA Library DNA Polymerase I Electrophoresis, Agar Gel Genome Germination Nebulizers Oryza sativa Polynucleotide 5'-Hydroxyl-Kinase
2
Generation and Characterization of Cre-Expressing Transgenic Mice

Splicer mice were generated with a transgene from pTet-Cre, which contains the Cre recombinase coding sequence from pBS185 (GIBCO BRL) cloned into the EcoRV site of pTet-Splice (GIBCO BRL) as a Klenow-blunted MluI-XhoI fragment. TIE2Cre transgenes were generated with a TIE2 kinase promoter/enhancer cassette described previously 53. The construct pSPTg.T2FXK (pg54) (a gift from Thomas Sato, Beth Israel Hospital, Boston, MA) contained the TIE2 kinase promoter and enhancer with HindIII and NotI sites between the two. These sites allowed us to directionally clone a HindIII-NotI fragment from pTet-Cre, thus introducing the Cre recombinase coding sequence, intronic donor/acceptor sequences, and polyadenylation signal sequences into pg54. This TIE2Cre transgene was then excised from the vector backbone using SalI.
All transgenic mice were generated on a (C3H × C57BL/6)F2 background. Screening of tail DNA for Cre recombinase transgene presence was by PCR with the following primers: forward, 5′-CGATGCAACGAGTGATGAGG-3′; and reverse, 5′-CGCATAACCAGTGAAACAGC-3′. Positive founder mouse lines were then crossed with C57BL/6 mice for two generations before interbreeding with VCAM-1 knock-in mice.
Koni P.A., Joshi S.K., Temann U.A., Olson D., Burkly L, & Flavell R.A. (2001). Conditional Vascular Cell Adhesion Molecule 1 Deletion in Mice: Impaired Lymphocyte Migration to Bone Marrow. The Journal of Experimental Medicine, 193(6), 741-754.
Publication 2001
Clone Cells Cloning Vectors Cre recombinase DNA Polymerase I Introns Mice, Inbred C57BL Mice, Laboratory Mice, Transgenic Oligonucleotide Primers Open Reading Frames Phosphotransferases Polyadenylation Signal Peptides Tail Tissue Donors Transgenes Vascular Cell Adhesion Molecule-1 Vertebral Column
3
In Situ Contact Library Generation
In situ contact libraries were generated according to the in situ Hi-C published protocol5 (link) through the proximity ligation with modifications. In brief, up to 15 million crosslinked cells were resuspended in 500 μL of ice-cold Hi-C lysis buffer (10 mM Tris-HCl pH 7.5, 10 mM NaCl, 0.2% NP-40, 1X Roche protease inhibitors - 11697498001) and rotated at 4° C for 30 minutes. For cell amounts greater than 15 million, the cell pellet was split in half for contact generation and then recombined for the sonication. Nuclei were pelleted at 4° C for 5 minutes at 2500 rcf and the supernatant was discarded. Pelleted nuclei were washed once with 500 μL of ice-cold Hi-C lysis buffer. Supernatant was removed again and pellet was resuspended in 100 μL of 0.5% SDS and incubated at 62° C for 10 minutes with no shaking or rotation. 285 μL of water and 50 μL of 10% Triton X-100 were added and samples were rotated at 37° C for 15 minutes to quench the SDS. 50 μL of NEB Buffer 2 and 15 μL of 25 U/μL MboI restriction enzyme (NEB, R0147) were then added and sample was rotated at 37° C for 2 hours. For lower starting material less restriction enzyme was used: 15 μL was used for 10–15 million cells, 8 μL for 5 million cells, and 4 μL for 1 million cells. MboI was then heat inactivated at 62° C for 20 minutes with no shaking or rotation. To fill in the restriction fragment overhangs and mark the DNA ends with biotin, 52 μL of incorporation master mix was then added: 37.5 μL of 0.4 mM biotin-dATP (Thermo Fisher 19524016), 4.5 μL of a dCTP, dGTP, and dTTP mix at 10 mM each, and 10 μL of 5 U/μL DNA Polymerase I, Large (Klenow) Fragment (NEB, M0210). The reactions were then rotated at 37° C for 1 hour. 948 μL of ligation master mix was then added: 150 μL of 10X NEB T4 DNA ligase buffer with 10 mM ATP (NEB, B0202), 125 μL of 10% Triton X-100, 3 μL of 50 mg/mL BSA (Thermo Fisher AM2616), 10 μL of 400 U/μL T4 DNA Ligase (NEB, M0202), and 660 μL of water. The reactions were then rotated at room temperature for 4 hours. After proximity ligation, the nuclei with in-situ generated contacts were pelleted at 2500 rcf for 5 minutes at room temperature and the supernatant was removed.
Mumbach M.R., Rubin A.J., Flynn R.A., Dai C., Khavari P.A., Greenleaf W.J, & Chang H.Y. (2016). HiChIP: Efficient and sensitive analysis of protein-directed genome architecture. Nature methods, 13(11), 919-922.
Publication 2016
2'-deoxycytidine 5'-triphosphate Biotin Buffers Cell Nucleus Cells Cold Temperature deoxyguanosine triphosphate DNA Polymerase I DNA Restriction Enzymes Ligation Nonidet P-40 Protease Inhibitors Sodium Chloride T4 DNA Ligase thymidine 5'-triphosphate Triton X-100 Tromethamine
4
Construction of Gateway-Adapted Tn7 Delivery Plasmids
Plasmid pCW4 [22 (link)], containing tnsABCD, was digested with PacI and partially digested with DrdI, to liberate a 6636 bp PacI-DrdI fragment. The overhanging ends were made blunt with Klenow fragment and ligated to SmaI linearized pBAD18 [10 (link)]. The plasmid containing tnsABCD in the correct orientation relative to the PBAD promoter was named pGRG2. pGRG2 and pMAK700 [11 (link)], a pSC101 plasmid with a temperature-sensitive replicon, were digested with NaeI, releasing a 9541 bp tnsABCD containing fragment and a 2416 bp pSC101 origin-containing fragment, respectively. These two fragments were ligated together to create pGRG3, which contains the bla gene encoding β-lactamase, the araC gene and the PBAD-tnsABCD genes, and the temperature-sensitive pSC101 origin of replication. KanR and ChlR mini-Tn7s were inserted into pGRG3 using red-gam recombination as follows: The primers ATCATGGCAATTCTGGAAGAAATAGCGCTTTCAGCCtgtgggcggacaaaatagttgggaactggga and CATGAGCAGATCCTCTACGCCGGACGCATCGTGGCCtgtgggcggacaataaagtcttaaactgaa were used to amplify the KanR mini-Tn7 from pGPS1.1 and the ChlR mini-Tn7 from pGPS2.1 (both from New England Biolabs). The lower case letters are complementary to Tn7 and the upper case letters are homologous to sequences in pGRG3. The resulting PCR products were transformed into DH5α carrying the plasmid pTP223 [23 (link)], which expresses the phage λ red recombinase products, and KanR or ChlR recombinants were selected. The resulting KanR and ChlR mini-Tn7 containing plasmids were named pGRG8 and pGRG6. Both Tn7 inserts in the plasmids were sequenced to ensure that no mutations were inserted by PCR. Any mutations were corrected to the wildtype sequence by subcloning from samples that did not contain those mutations. pGRG17 was created by digesting pGRG8 with DraIII and EagI to remove the kanamycin resistance gene. This was replaced with the annealed oligonucleotides GGCCGTGGCGCGCCTCCTAGGTGCTCGAGTGGCGGCCGCTATTGAGGGATCTGATTAATTAAAAC and TTAATTAATCAGATCCCTCAATAGCGGCCGCCACTCGAGCACCTAGGAGGCGCGCCAC to create a multiple cloning site with the following unique restriction sites: AvrII, NotI, PacI, and XhoI.
To provide conjugation as an alternative way to introduce these plasmids into bacterial strains, we cloned the oriT site from the RP4 plasmid sequences in the strain SM10 [24 (link)]. oriT was amplified by PCR using primers GGCGCCGGCCAGCCTCGCAGAGCA and GGCGCCGGGCAGGATAGGTGAAGT, and cloned into pCR2.1-topo using the Topo TA cloning kit (Invitrogen). The sequence and transfer activity was confirmed, then the oriT sequence was moved by moving the 113 bp SfoI fragment into the NaeI site (resulting in the plasmid in parentheses) of pGRG6 (pGRG19), pGRG8 (pGRG20), and pGRG17 (pGRG25). pGRG36 is identical to pGRG25, except that it contains a SmaI site in the multiple cloning site. Both pGRG25 and pGRG36 sequences can be downloaded at GenBank using NCBI accession # DQ460223. The ability of the delivery plasmids to be transferred by conjugation was confirmed using pGRG25-containing SM10 as donor in a standard conjugation assay at 32°C [25 ].
To facilitate the cloning of large fragments into the delivery vehicle we cloned the RfC.1 element from the Gateway cloning system (Invitrogen) into the SmaI site of pGRG36, yielding pGRG37. This allows in vitro movement of transgenes cloned in Gateway cloning vectors into pGRG37, bypassing the need for standard cloning techniques [26 (link)].
McKenzie G.J, & Craig N.L. (2006). Fast, easy and efficient: site-specific insertion of transgenes into Enterobacterial chromosomes using Tn7 without need for selection of the insertion event. BMC Microbiology, 6, 39.
Full text: Click here
Publication 2006
Bacteria Bacteriophages beta-Lactamase Biological Assay Cloning Vectors DNA Polymerase I Genes Genes, araC HMN (Hereditary Motor Neuropathy) Proximal Type I Homologous Sequences Kanamycin Resistance Movement Mutation Obstetric Delivery Oligonucleotide Primers Oligonucleotides Plasmids Recombinase Recombination, Genetic Replication Origin Replicon Strains Tissue Donors Topotecan Transgenes
5
Sequencing the Lotus japonicus Genome
Two types of sequencing approaches were combined to sequence the L. japonicus genome: clone-by-clone sequencing and shotgun sequencing of selected regions of the genome.
TAC/BAC clones were selected from the genomic libraries as seed points using the sequence information from ESTs and cDNA markers from L. japonicus and other legumes. The nucleotide sequence of each clone was determined according to the shotgun strategy with three to five times redundancy. A total of 1909 TAC/BAC clones, those newly sequenced in this study and those that had been sequenced previously,5 (link)–9 (link) were assembled into 954 scaffolds using the Paracel Genome Assembler (PGA; version 2.6.2, Paracel Co., 2002), followed by manual TAC/BAC end-pair scaffolding, resulting in high-quality genomic sequence (HGS) contigs.
In parallel, shotgun sequencing of a selected TAC mixture (STM) enriched in gene spaces and a whole genomic DNA from which highly repetitive and organelle genomic sequences were subtracted (selected genomic regions, SGRs) was carried out. The TAC clones, neither end sequence of which hit repetitive or organelle genomic sequences in the L. japonicus genome, were selected from the libraries, pooled, and subjected to shotgun sequencing. For the SGRs, a genomic library with an average insert size of 2.5 kb was generated using pBluescript SK− as the cloning vector. For subtraction, polymerase chain reaction (PCR)-amplified fragments of LjTR1 were biotinylated using Biotin-High Prime (Roche, Basel, Switzerland) and used as a driver in subtractive hybridization with the WGS library. The WGS library was single-stranded prior to hybridization by combined action of gene II and exonuclease III. Hybrids were removed using Dynabeads M-280 Streptavidin (Invitrogen, Carlsbad, CA, USA) and the remaining single-stranded WGS library was double-stranded using Klenow fragments (Takara Bio, Japan) and transformed into host E. coli ElectroTen-Blue (Agilent Technologies, Santa Clara, CA, USA).
A total of 808 816 reads from STM generated from 4603 TAC inserts and 847 513 SGR reads were assembled into a set of 109 986 contigs, 147 805 446 bp in length (selected genome assembly, SGA) by the Arachne assembler, version 2.01.11 (link) The SGA sequences were then subjected to assemble with the HGS, and finally, a total of 110 940 supercontigs with a total coverage of 315 073 275 tentative genomic sequence (TGS) bases were obtained.
Sato S., Nakamura Y., Kaneko T., Asamizu E., Kato T., Nakao M., Sasamoto S., Watanabe A., Ono A., Kawashima K., Fujishiro T., Katoh M., Kohara M., Kishida Y., Minami C., Nakayama S., Nakazaki N., Shimizu Y., Shinpo S., Takahashi C., Wada T., Yamada M., Ohmido N., Hayashi M., Fukui K., Baba T., Nakamichi T., Mori H, & Tabata S. (2008). Genome Structure of the Legume, Lotus japonicus. DNA Research: An International Journal for Rapid Publication of Reports on Genes and Genomes, 15(4), 227-239.
Publication 2008
Base Sequence Biotin Clone Cells Cloning Vectors Crossbreeding DNA, A-Form DNA, Complementary DNA Library DNA Polymerase I Escherichia coli exodeoxyribonuclease III Expressed Sequence Tags Fabaceae Genes Genome Genomic Library Hybrids M 280 Organelles Polymerase Chain Reaction Streptavidin Subtractive Hybridization Techniques

Most recents protocols related to «DNA Polymerase I»

1
RNA-Seq Library Preparation for Illumina
Total mRNA was isolated from primary B lymphocytes using an RNeasy Mini Kit (Qiagen) following the manufacturer’s instructions. RNA concentrations were quantitated using a NanoDrop 2000 (Thermo Scientific) and library preparation was performed by Novogene. A total amount of 1 µg RNA per sample was used as input material for the RNA sample preparations. Sequencing libraries were generated using NEBNext Ultra TM RNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s recommendations, and index codes were added to attribute sequences to each sample. Briefly, mRNA was purified from total RNA using poly-T oligo-attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEBNext First-strand Synthesis Reaction Buffer (5 X). First-strand cDNA was synthesized using random hexamer primer and M-MuLV Reverse Transcriptase (RNase H-). Second-strand cDNA synthesis was subsequently performed using DNA Polymerase I and RNase H. Remaining overhangs were converted into blunt ends via exonuclease/polymerase activities. After adenylation of 3’ ends of DNA fragments, NEBNext Adaptor with hairpin loop structure was ligated to prepare for hybridization. To select cDNA fragments of preferentially 150~200 bp in length, the library fragments were purified with AMPure XP system (Beckman Coulter, Beverly, USA). Then 3 µl USER Enzyme (NEB, USA) was used with size-selected, adaptor-ligated cDNA at 37°C for 15 min followed by 5 min at 95°C before PCR. Then PCR was performed with Phusion High-Fidelity DNA polymerase, Universal PCR primers, and Index (X) Primer. Lastly, PCR products were purified (AMPure XP system) and library quality was assessed on the Agilent Bioanalyzer 2100 system. The clustering of the index-coded samples was performed on a cBot Cluster Generation System using PE Cluster Kit cBot-HS (Illumina) according to the manufacturer’s instructions. After cluster generation, the library preparations were sequenced on an Illumina NovaSeq 6000 Platform (Illumina, San Diego, CA, USA) using a paired-end 150 run (2 × 150 bases).
Emrich S.M., Yoast R.E., Zhang X., Fike A.J., Wang Y.H., Bricker K.N., Tao A.Y., Xin P., Walter V., Johnson M.T., Pathak T., Straub A.C., Feske S., Rahman Z.S, & Trebak M. (2023). Orai3 and Orai1 mediate CRAC channel function and metabolic reprogramming in B cells. eLife, 12, e84708.
Full text: Click here
Publication 2023
Anabolism B-Lymphocytes Buffers Cations, Divalent cDNA Library Crossbreeding DNA, Complementary DNA-Directed DNA Polymerase DNA Polymerase I Enzymes Exonuclease Fever Moloney Leukemia Virus Oligonucleotide Primers Oligonucleotides Poly T Ribonuclease H RNA, Messenger RNA-Directed DNA Polymerase
2
Transcriptomic Analysis of Wogonin Treatment
RNA sequencing was performed by means of Novogene RNA sequencing. The cells were treated with 80 μM wogonin and without wogonin for 24 h. Next, the total RNA was isolated using the TRIzol reagent. 2 μg total RNA/sample was used for sample preparation for RNA sequencing. Briefly, poly-T oligonucleotide-linked magnetic beads were used for purifying mRNA from the total RNA. The first complementary DNA (cDNA) strand was synthesised using random hexamers plus M-MuLV reverse transcriptase. DNA polymerase I, along with RNase H, was used for the second cDNA strand synthesis. The amplified polymerase chain reaction (PCR) product was purified using the AMPure XP system. The “DESeq2” R package (1.20.0) was used for analysing differentially expressed genes between the two conditions/groups (two biological replicates were used/condition). The “clusterProfiler” R package was used to perform Gene ontology (GO) on differentially expressed genes (DEGs) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment for analysing the pathways significantly enriched by DEGs (|Log2 FC| >1). The gene length deviation was corrected. The expression of transcripts with adjusted p < 0.05 was considered statistically significant.
Liu X., Peng X., Cen S., Yang C., Ma Z, & Shi X. (2023). Wogonin induces ferroptosis in pancreatic cancer cells by inhibiting the Nrf2/GPX4 axis. Frontiers in Pharmacology, 14, 1129662.
Full text: Click here
Publication 2023
Anabolism Biopharmaceuticals Cells DNA, Complementary DNA Polymerase I Genes Genetic Diversity Genome Moloney Leukemia Virus Oligonucleotides Polymerase Chain Reaction Poly T Ribonuclease H RNA, Messenger RNA-Directed DNA Polymerase trizol wogonin
3
Comprehensive Transcriptome Profiling Protocol
Total RNA was extracted according to the manufacturer’s protocol using a Trizol reagent kit (Invitrogen, Carlsbad, CA, USA). RNase-free agarose gel electrophoresis was used to verify RNA quality using an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). Following total RNA extraction, eukaryotic mRNA was isolated using Oligo (dT) beads, whereas prokaryotic mRNA was enriched using the Ribo-ZeroTM Magnetic Kit (Epicentre, Madison, WI, USA) to remove rRNA. The enriched mRNA was then fragmented into small fragments with fragmentation buffer before being reverse transcribed into cDNA with random primers. DNA polymerase I, RNase H, dNTP, and buffer were used to make second-strand cDNA. The cDNA fragments were then purified using a QiaQuick PCR extraction kit (Qiagen, Venlo, The Netherlands), end repaired, poly (A) added, and ligated to the Illumina sequencing platform. The ligation products were sized by using agarose gel electrophoresis, then PCR amplified and sequenced on an Illumina HiSeq2500.
To obtain high-quality clean reads, raw reads obtained from the sequencing machines were further filtered by fastp (version 0.18.0). Reads were mapped to the ribosome RNA (rRNA) database by using the short reads alignment tool Bowtie2 (version 2.2.8) to eliminate the rRNA mapped reads [18 (link)]. The remaining clean reads were further used in assembly and gene abundance calculation. An index of the reference genome was built, and paired-end clean reads were mapped to the reference genome using HISAT2. 2.4. For each transcriptional region, FPKM values (fragment per kilobase of transcript per million mapped reads) were calculated using StringTie (version 1.3.1) software to quantify expression abundance and variation [20 (link)].
RNA differential expression analysis was performed by DESeq2 software between two groups [21 (link)]. The transcripts with the parameter of FDR below 0.05 and absolute fold change ≥ 2 were considered as differentially expressed transcripts. Differential expression genes (DEGs) in two groups were functionally annotated by gene ontology (GO) enrichment analysis. Physiological metabolism events and signal pathways of the DEGs were assessed using KOBAS software to test the statistical enrichments of the DEGs in KEGG pathways. The calculated P-value was gone through FDR correction, taking FDR ≤ 0.05 as a threshold. Pathways of GO and KEGG analysis meeting this condition were defined as significantly enriched pathways in DEGs. After selecting the eleven genes that were enriched in the lipid-related pathway, we conducted quantitative real-time PCR (qPCR) to validate the expression.
The raw reads of transcriptome sequences were deposited into the NCBI SRA database (project number, PRJNA859628 and accession number, SRP386837).
Li Z., Zhao X., Jian L., Wang B, & Luo H. (2023). Rumen microbial-driven metabolite from grazing lambs potentially regulates body fatty acid metabolism by lipid-related genes in liver. Journal of Animal Science and Biotechnology, 14, 39.
Full text: Click here
Publication 2023
Buffers DNA, Complementary DNA Polymerase I Electrophoresis, Agar Gel Endoribonucleases Eukaryota Gene Expression Genes Genome Ligation Lipids Metabolism Oligonucleotide Primers Oligonucleotides physiology Poly A Prokaryotic Cells Real-Time Polymerase Chain Reaction Ribonuclease H Ribosomal RNA Ribosomes RNA, Messenger Signal Pathways Transcription, Genetic Transcriptome trizol
4
RNA-seq Library Preparation Protocol
After total RNA was extracted, mRNA was purified from 5 µg total RNA using Dynabeads Oligo (dT) (Thermo Fisher Scientific) with 2 rounds of purification. Subsequently, the mRNA was fragmented into short pieces using divalent cations by the Magnesium RNA Fragmentation Module (catalog no. E6150; New England Biolabs [NEB], Ipswich, MA, USA) under elevated temperature (94°C for 5-7 minutes). Then, the cleaved RNA fragments were reverse-transcribed to create the cDNA library by SuperScript II Reverse Transcriptase (catalog no. 1896649; Invitrogen), which were next used to synthesize U-labeled second-stranded DNAs with E. coli DNA polymerase I (catalog no. M0209; NEB), RNase H (catalog no. M0297; NEB), and dUTP solution (catalog no. R0133; Thermo Fisher Scientific). After end repair of the cDNA fragments, dual-index adapters were ligated to the fragments, and size selection was performed with AMPure XP beads (catalog no. E7420; NEB). After the heat-labile UDG enzyme (catalog no. M0280; NEB), treatment of the U-labeled second-stranded DNAs, the ligated products were amplified with polymerase chain reaction (PCR) by the following conditions: initial denaturation at 95°C for 3 minutes; 8 cycles of denaturation at 98°C for 15 seconds, annealing at 60°C for 15 seconds, and extension at 72°C for 30 seconds; and then final extension at 72°C for 5 minutes. The average insert size for the final cDNA library was 300 ± 50 bp. Paired-end sequencing (PE150 module) was performed on the Illumina Novaseq 6000 platform (LC-Bio Technology CO., Ltd., Hangzhou, China) following the vendor's recommended protocol.
Xu X., Wei Y., Pang J., Wei Z., Wang L., Chen Q., Wang Z., Zhang Y., Chen K., Peng Y., Zhang Z., Liu J., Zhang Y., Jin Z.B, & Liang Q. (2023). Time-Course Transcriptomic Analysis Reveals the Crucial Roles of PANoptosis in Fungal Keratitis. Investigative Ophthalmology & Visual Science, 64(3), 6.
Publication 2023
Cations, Divalent cDNA Library deoxyuridine triphosphate DNA DNA, Complementary DNA Polymerase I Enzymes Escherichia coli Fever Magnesium Neoplasm Metastasis Oligonucleotides Polymerase Chain Reaction Ribonuclease H RNA, Messenger RNA-Directed DNA Polymerase
5
Reduced Representation Bisulfite Sequencing
1µg genomic DNA was digested using MspI enzyme for 16 hours at 37°C. After digestion, libraries were constructed as the Illumina Pair-End protocol with some modifications. Briefly, purified digested DNA was subsequently treated with a mix of T4 DNA polymerase, Klenow Fragment and T4 polynucleotide kinase to repair, blunt and phosphorylate ends. The DNA fragments were subsequently 3’ adenylated using Klenow Fragment (3’-5’ exo-) and following with ligation to adaptors synthesized with 5’-methylcytosine instead of cytosine using T4 DNA Ligase. the DNA was purified using QIAquick PCR purification kit (Qiagen) after reaction of each step. After purification, the library was subjected to 40°C for 30 min treatment in a thermo cycler with the lid heated at 57°C. After that, centrifuged the reaction mixture at 14,000 X g for 10 min and then transferred the supernatant into a new 0.2 ml PCR tube for the further bisulfite treatment, respectively. Bisulfite conversion treatment was performed using a ZYMO EZ DNA Methylation-Gold Kit (Zymo research, Irvine, CA, USA) according to the manufacturer’s instructions. The final RRBS libraries were generated by PCR amplification using adapter compatible barcode primers, quantified by an Agilent 2100 Bioanalyzer (Agilent Technologies) and real-time PCR assay and then sequenced by Illumina Hiseq.
Wang X., Liu J., Wang Q, & Chen Q. (2023). The transcriptomic and epigenetic alterations in type 2 diabetes mellitus patients of Chinese Tibetan and Han populations. Frontiers in Endocrinology, 14, 1122047.
Full text: Click here
Publication 2023
Biological Assay Cytosine Digestion DNA-Directed DNA Polymerase DNA Library DNA Methylation DNA Polymerase I Enzymes Genome Gold hydrogen sulfite Ligation Oligonucleotide Primers Polynucleotide 5'-Hydroxyl-Kinase Real-Time Polymerase Chain Reaction T4 DNA Ligase

Top products related to «DNA Polymerase I»

1
Agilent 2100 bioanalyzer by Agilent Technologies
Sourced in United States, Germany, Canada, China, France, United Kingdom, Japan, Netherlands, Italy, Spain, Australia, Belgium, Denmark, Switzerland, Singapore, Sweden, Ireland, Lithuania, Austria, Poland, Morocco, Hong Kong, India
The Agilent 2100 Bioanalyzer is a lab instrument that provides automated analysis of DNA, RNA, and protein samples. It uses microfluidic technology to separate and detect these biomolecules with high sensitivity and resolution.
2
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
3
Qiaquick pcr extraction kit by Qiagen
Sourced in Germany, Netherlands, United States, China
The QiaQuick PCR extraction kit is a lab equipment product designed for the rapid purification of PCR amplicons from solution. It utilizes a silica-based membrane technology to efficiently bind, wash, and elute DNA fragments from PCR reactions.
4
Hiseq 2000 by Illumina
Sourced in United States, China, Germany, United Kingdom, Hong Kong, Canada, Switzerland, Australia, France, Japan, Italy, Sweden, Denmark, Cameroon, Spain, India, Netherlands, Belgium, Norway, Singapore, Brazil
The HiSeq 2000 is a high-throughput DNA sequencing system designed by Illumina. It utilizes sequencing-by-synthesis technology to generate large volumes of sequence data. The HiSeq 2000 is capable of producing up to 600 gigabases of sequence data per run.
5
Hiseq 2500 by Illumina
Sourced in United States, China, Germany, United Kingdom, Canada, Switzerland, Sweden, Japan, Australia, France, India, Hong Kong, Spain, Cameroon, Austria, Denmark, Italy, Singapore, Brazil, Finland, Norway, Netherlands, Belgium, Israel
The HiSeq 2500 is a high-throughput DNA sequencing system designed for a wide range of applications, including whole-genome sequencing, targeted sequencing, and transcriptome analysis. The system utilizes Illumina's proprietary sequencing-by-synthesis technology to generate high-quality sequencing data with speed and accuracy.
6
Ampure xp system by Beckman Coulter
Sourced in United States, United Kingdom, Canada
The AMPure XP system is a magnetic bead-based purification tool used to selectively bind and purify nucleic acids, such as DNA and RNA, from complex samples. It allows for efficient recovery and concentration of target molecules while removing unwanted contaminants and impurities.
7
Rnase h by Thermo Fisher Scientific
Sourced in United States, China, Australia
RNase H is a laboratory enzyme that selectively degrades the RNA strand in RNA-DNA hybrids. It is a useful tool for molecular biology applications.
8
Agilent bioanalyzer 2100 system by Agilent Technologies
Sourced in United States, China, Germany, Canada, United Kingdom, Finland, France, Spain, Switzerland
The Agilent Bioanalyzer 2100 system is a microfluidics-based platform designed for the analysis of DNA, RNA, proteins, and cells. It provides automated electrophoretic separation and detection of these biomolecules in a miniaturized format.
9
2100 bioanalyzer by Agilent Technologies
Sourced in United States, Germany, Canada, United Kingdom, France, China, Japan, Spain, Ireland, Switzerland, Singapore, Italy, Australia, Belgium, Denmark, Hong Kong, Netherlands, India
The 2100 Bioanalyzer is a lab equipment product from Agilent Technologies. It is a microfluidic platform designed for the analysis of DNA, RNA, and proteins. The 2100 Bioanalyzer utilizes a lab-on-a-chip technology to perform automated electrophoretic separations and detection.
10
Novaseq 6000 by Illumina
Sourced in United States, China, United Kingdom, Japan, Germany, Canada, Hong Kong, Australia, France, Italy, Switzerland, Sweden, India, Denmark, Singapore, Spain, Cameroon, Belgium, Netherlands, Czechia
The NovaSeq 6000 is a high-throughput sequencing system designed for large-scale genomic projects. It utilizes Illumina's sequencing by synthesis (SBS) technology to generate high-quality sequencing data. The NovaSeq 6000 can process multiple samples simultaneously and is capable of producing up to 6 Tb of data per run, making it suitable for a wide range of applications, including whole-genome sequencing, exome sequencing, and RNA sequencing.

More about "DNA Polymerase I"

DNA Polymerase I (Pol I) is a crucial enzyme involved in DNA replication and repair processes.
As a member of the DNA polymerase family, Pol I catalyzes the addition of complementary nucleotides to a DNA template strand, playing a vital role in maintaining genomic integrity.
This enzyme is widely utilized in molecular biology research, including cloning, sequencing, and genetic engineering applications.
Pol I is particularly known for its 5'→3' polymerase activity, which allows it to synthesize new DNA strands by adding deoxyribonucleotides complementary to the template.
Additionally, Pol I possesses 3'→5' exonuclease activity, enabling it to proofread and correct errors during DNA synthesis.
This proofreading function is essential for ensuring high-fidelity DNA replication and repair.
In scientific investigations, Pol I is commonly employed in various techniques and technologies.
For instance, it is utilized in the Sanger sequencing method, a widely used DNA sequencing approach.
Pol I is also a key component in PCR (Polymerase Chain Reaction) amplification, where it is responsible for synthesizing new DNA strands during the replication process.
To enhance the reproducibility and accuracy of your DNA Polymerase I research, consider using AI-driven platforms like PubCompare.ai.
This tool can help you locate relevant protocols from literature, preprints, and patents, and compare them using advanced AI-powered features.
By identifying the best protocols and products for your Pol I studies, you can streamline your research and improve the quality of your findings.
Additionally, complementary technologies such as the Agilent 2100 Bioanalyzer, TRIzol reagent, QIAquick PCR extraction kit, HiSeq 2000, HiSeq 2500, AMPure XP system, RNase H, and the Agilent Bioanalyzer 2100 system can be leveraged to support your DNA Polymerase I research.
These tools can aid in sample analysis, purification, and quality control, contributing to the overall integrity and reliability of your experiments.
By understanding the critical role of DNA Polymerase I and incorporating the mentioned technologies and resources, you can optimize your research, enhance reproducibility, and gain valuable insights into DNA replication and repair mechanisms.