> Chemicals & Drugs > Amino Acid > DNMT3B protein, human

Dopa →

DNMT3B protein, human

Q: Are there different variants or types of the DNMT3B protein?

Yes, there are several known variants or isoforms of the DNMT3B protein. These isoforms can arise from alternative splicing of the DNMT3B gene and may have distinct localization, expression patterns, and functional roles within the cell. Investigating the specific properties and functions of these DNMT3B variants is an active area of research in epigenetics.

The DNMT3B protein is a DNA methyltransferase enzyme that plays a crucial role in the establishment and maintenance of DNA methylation patterns during embryonic development and cellular differentiation.
It is responsible for de novo DNA methylation, initiating the addition of methyl groups to CpG dinucleotides in the genome.
Dysregulation of DNMT3B has been implicated in various diseases, including cancer and developmental disorders.
Understanding the functons and mechanisms of this protein is essential for advancing research in epigenetics and developing potential therapeutic strategies.

Most cited protocols related to «DNMT3B protein, human»

Evaluating Methylation Measurement Techniques

Cited 46 times

Dataset 1: 450K dataset of a total of 39 methylation laboratory standard control samples reported by [13 (link)]. Human unmethylated DNA (HCT116 double knock out (DKO) of both DNA methyltransferases DNMT1 (-/-) and DNMT3b (-/-)) and fully methylated DNA (HCT116 DKO DNA enzymatically methylated) were obtained commercially (Zymo Research, Irving CA) and mixed together in different proportions to create laboratory control samples with specific methylation levels: 0, 5, 10, 20, 40, 50, 60, 80 and 100% methylated. Replicates for each methylation level (n = 10, 3, 2, 3, 3, 2, 3, 3 and 10, respectively) were independently assayed on different arrays.
Dataset 2: 450K dataset of 22 samples reported by [4 (link)]. These samples included three replicates from the HCT116 WT cell-line, three replicates from the HCT116 DNMT1 and DNMT3B double KO (DKO) cell-line, and 16 other samples (GEO accession number: GSE29290). In particular to evaluate RELIC and other dye-bias correction methods, we used the six replicates from the HCT116 WT and HCT116 DKO cell-lines, and the matched bisulfite pyrosequencing (BPS) data for 15 probes in the two cell-lines reported in the Table one of [4 (link)]. As described in [4 (link)] the fifteen CpGs were selected for technical validation of the 450K array measures (six sites for Infinium I assay and nine sites for Infinium II assay) using the more accurate BPS method as the “gold standard”.
Dataset 3: 450K dataset of 24 samples reported by [6 (link)]. These samples included 12 blood samples and 12 saliva samples for ten individuals, with two individuals having two technical blood/saliva replicates (GEO accession number: GSE73745). More specifically, we used these samples and the matched bisulfite pyrosequencing (BPS) data for three probes (cg19754622, cg16106427, cg08899523) to evaluate RELIC and other dye-bias correction methods.

Xu Z., Langie S.A., De Boever P., Taylor J.A, & Niu L. (2017). RELIC: a novel dye-bias correction method for Illumina Methylation BeadChip. BMC Genomics, 18, 4.

Full text: Click here

Publication 2017

Biological Assay BLOOD Cell Lines cytidylyl-3'-5'-guanosine DNA Modification Methylases DNMT1 protein, human DNMT3B protein, human Gold HCT116 Cells Homo sapiens hydrogen sulfite Methylation Saliva

Maintenance and Manipulation of Mouse ESCs

Cited 15 times

Mouse feeder free E14Tg2A ES cells were maintained on gelatin-coated dishes in Glasgow Minimum Essential medium (GMEM; GIBCO), supplemented with 15% heat-inactivated fetal bovine serum, 55 µM β-mercaptoethanol (GIBCO), 2 mM L-glutamine, 0.1 mM MEM nonessential amino acid, 5,000 units/ml penicillin/streptomycin and 1,000 units/ml of ESGRO (Chemicon) under feeder-free conditions. J1 ES cells and Dnmt1−/−Dnmt3a−/−Dnmt3b−/− (DNMT TKO) ES cells were maintained on gelatin-coated dishes with mitotically inactivated mouse embryonic fibroblasts. Alkaline phosphatase staining was performed with Alkaline Phosphatase Detection Kit (Chemicon). For growth curve analysis, control and knockdown ESCs were plated at 1×10³ cells/cm₂ and counted for 6 consecutive days. For self-renewal analysis cells were plated on 96 well plates at single cell density and the number of colonies on each plate was counted 6 days after plating.
To knockdown Tet proteins, lentiviral transduction was performed in mouse ES cells as described previously ^{19 (link)}. Short-hairpin RNA (shRNA) sequences (Supplementary Table 2) were cloned into pTY vetctor under the U6 promoter. To rescue Tet1 knockdown with Nanog, cDNA of Nanog was placed downstream of puromycin-resistant gene and foot-and-mouth disease virus 2A segment (Fig. S12), which enables multicistronic expression of transgenes in ES cells using a single promoter ^{21 (link)}.
Total RNA from mouse tissues was isolated using Trizol reagent (Invitrogen) and total RNA from cultured cells was isolated using RNeasy Mini Kit (Qiagen), and cDNA was generated with Improm-IITM Reverse Transcription System (Promega). Real-time quantitative PCR reactions were performed on an ABI PRISM 7700 Sequence Detection System (Applied Biosystems) using SYBR Green reagent (Invitrogen). cDNA levels of target genes were analyzed using comparative Ct methods, where Ct is the cycle threshold number and normalized to GAPDH. RT-qPCR primers are listed in Supplementary table 3.

Ito S., D’Alessio A.C., Taranova O.V., Hong K., Sowers L.C, & Zhang Y. (2010). Role of Tet proteins in 5mC to 5hmC conversion, ES cell self-renewal, and ICM specification. Nature, 466(7310), 1129-1133.

Publication 2010

2-Mercaptoethanol Alkaline Phosphatase Amino Acids Cells Cultured Cells DNA, Complementary DNA Modification Methylases DNMT1 protein, human DNMT3B protein, human Embryo Embryonic Stem Cells Enhanced S-Cone Syndrome Feeder Cells Fetal Bovine Serum Fibroblasts Foot-and-Mouth Disease Virus GAPDH protein, human Gelatins Genes Glutamine Hyperostosis, Diffuse Idiopathic Skeletal Mus neuronectin Oligonucleotide Primers Penicillins prisma Promega Proteins Puromycin Reverse Transcription Short Hairpin RNA Streptomycin SYBR Green I Tissues Transgenes trizol

CD8+ T Cell Stimulation and Differentiation

Cited 12 times

CD8+ T cells were purified from spleens of OT-I mice by negative selection with magnetic beads (EasySep, Stemcell Technologies). After purification, cells were 97.7±0.5% CD8+ T cell and contained 0.11±0.04% CD11b+ CD11c- monocytes and 0.09±0.05% CD11b+ CD11c+ dendritic cells. In each well of a 24-well plate, 5x10⁵ of the purified CD8+ T cells/ml were cultured in complete media (RPMI 1640, 10% FBS (Gibco), 1% 2mM L-glutamine (Life Technologies), 1% HEPES (Life Technologies), 1% 100nM Sodium Pyruvate (Life Technologies), 1% non-essential amino acides (Life Technologies), 100U/ml penicillin (Gibco) and 100μg/ml Streptomycin-sulfate (Gibco), 0.05mM Betamercaptoethanol (Sigma)) with IL-15 (5ng/ml, Peprotech, Cat 210–15) and IL-7 (5ng/ml, Peprotech, Cat 210–07) with or without 10ng/ml OVA_(257–264) peptide (Anaspec Cat AS-60193).
For single peptide stimulation, cells were cultured in the presence of OVA_(257–264) peptide for 48 hours. The peptide was then removed by washing the cells two times with complete media. For the remaining 3 days, the cells were cultured in the complete media with cytokines. For repeat peptide stimulation, 10ng/ml OVA_(257–264) peptide was added daily for five days. The cells were washed also on day 2 to allow for comparable culture conditions. Unstimulated control cells were cultured in media with cytokines but without adding peptide. Cells from all three conditions were checked daily, and when the cells were confluent, they were split and cultured with fresh complete media containing cytokines. After day 5, some of the cell were washed two times with complete media and maintained in the media only with cytokines for another three days. In some experiments cell cultures were treated on day 2 with 20μM DNA methyltransferase (DNMT) inhibitor SGI-1027 (Tocris, Bio-techne) that targets DNA methyltransferases DNMT3B, DNMT3A and DNMT1.
On day five, cells were harvested and counted using an automated counting system (Countess, Life Technologies). Cells were stained with DAPI Viability dye (Beckman Coulter, Cat B30437) and Acridine Orange (Biotium, Cat 40039) to distinguish live and dead cells.

Zhao M., Kiernan C.H., Stairiker C.J., Hope J.L., Leon L.G., van Meurs M., Brouwers-Haspels I., Boers R., Boers J., Gribnau J., van IJcken W.F., Bindels E.M., Hoogenboezem R.M., Erkeland S.J., Mueller Y.M, & Katsikis P.D. (2020). Rapid in vitro generation of bona fide exhausted CD8+ T cells is accompanied by Tcf7 promotor methylation. PLoS Pathogens, 16(6), e1008555.

Full text: Click here

Publication 2020

Acridine Orange CD8-Positive T-Lymphocytes Cell Culture Techniques Cells Culture Media Cytokine DAPI Dendritic Cells DNA Modification Methylases DNMT1 protein, human DNMT3B protein, human Glutamine HEPES Interleukin-15 ITGAM protein, human Monocytes Mus Penicillins Peptides Pyruvate SGI-1027 Sodium Stem Cells Streptomycin Sulfate

DNA Methylation Profiling of CpH and CpG Sites

Cited 6 times

Single-stranded DNA oligonucleotides used for generation of double-stranded substrates with CpH or methylated CpG sites embedded in a 10 nucleotide random context were obtained from IDT. The second strand synthesis was conducted by a primer extension reaction using one universal primer. The obtained mix of double-stranded DNA oligonucleotides was methylated by murine DNMT3A or DNMT3B catalytic domain for 60 min at 37 °C in the presence of 0.8 mM S-adenosyl-L-methionine (Sigma) in reaction buffer (20 mM HEPES pH 7.5, 1 mM EDTA, 50 mM KCl, 0.05 mg/mL bovine serum albumin). Reactions were stopped by shock freezing in liquid nitrogen, then treated with proteinase K for 2 h. Afterward, the DNA was digested with the BsaI-HFv2 enzyme and a hairpin was ligated using T4 DNA ligase (NEB). The DNA was bisulfite-converted using EZ DNA Methylation-Lightning kit (ZYMO RESEARCH) according to the manufacturer protocol, purified and eluted with 10 µL ddH₂O.
Libraries for Illumina Next-Generation Sequencing (NGS) were produced with the two-step PCR approach. In the first PCR, 2 µL of bisulfite-converted DNA were amplified with the HotStartTaq DNA Polymerase (QIAGEN) and primers containing internal barcodes using following conditions: 15 min at 95 °C, 10 cycles of 30 s at 94 °C, 30 s at 50 °C, 1 min and 30 s at 72 °C, and final 5 min at 72 °C; using a mixture containing 1x PCR Buffer, 1x Q-Solution, 0.2 mM dNTPs, 0.05 U/µL HotStartTaq DNA Polymerase, 0.4 µM forward and 0.4 µM reverse primers in a total volume of 20 µL. In the second PCR, 1 µL of obtained products were amplified by Phusion Polymerase (Thermo) with another set of primers to introduce adapters and indices needed for NGS (30 s at 98 °C, 10 cycles—10 s at 98 °C, 40 s at 72 °C, and 5 min at 72 °C). PCRII was carried out in 1x Phusion HF Buffer, 0.2 mM dNTPs, 0.02 U/µL Phusion HF DNA Polymerase, 0.4 µM forward and 0.4 µM reverse primers in a total volume of 20 µL. Obtained libraries were pooled in equimolar amounts and purified using NucleoSpin^® Gel and PCR Clean-up kit (Macherey-Nagel), followed by a second purification step of gel extraction and size exclusion with AMPure XP magnetic beads (Beckman Coulter). Sequencing was performed at the Max Planck Genome Centre Cologne.
Bioinformatics analysis of obtained NGS data was conducted with the tools available on the Usegalaxy.eu server^{52 (link)} and with home written programs. Briefly, fastq files were analyzed by FastQC, 3′ ends of the reads with a quality lower than 20 were trimmed and reads containing both full-length sense and antisense strands were selected. Next, using the information of both strands of the bisulfite-converted substrate the original DNA sequence and methylation state of both CpG sites was reconstituted. CpH and CpN data were split into CpG, CpA, CpT, and CpC, as appropriate. In each case average methylation levels of each NNCGNN and NNNCGNNN site were determined. Pearson correlation factors were calculated using Excel. Each experiment was performed in two independent repeats. For downstream analysis, DNMT3A data of repeat 1 and the combined data of DNMT3B were used for further analysis, based on their comparable methylation levels. Sequence logos were calculated using Weblogo 3 (http://weblogo.threeplusone.com/).

Gao L., Emperle M., Guo Y., Grimm S.A., Ren W., Adam S., Uryu H., Zhang Z.M., Chen D., Yin J., Dukatz M., Anteneh H., Jurkowska R.Z., Lu J., Wang Y., Bashtrykov P., Wade P.A., Wang G.G., Jeltsch A, & Song J. (2020). Comprehensive structure-function characterization of DNMT3B and DNMT3A reveals distinctive de novo DNA methylation mechanisms. Nature Communications, 11, 3355.

Full text: Click here

Publication 2020

Anabolism Buffers Catalytic Domain DNA, Double-Stranded DNA, Single-Stranded DNA-Directed DNA Polymerase DNA Methylation DNA Sequence DNMT3B protein, human Edetic Acid Endopeptidase K Enzymes Genome HEPES hydrogen sulfite Methionine Methylation Mus Nitrogen Nucleotides Oligonucleotide Primers Oligonucleotides Serum Albumin, Bovine Shock T4 DNA Ligase

Methyltransferase Enzymatic Assay Protocol

Cited 6 times

The effects of chemical probes and negative controls on the methyltransferase activities of protein, DNA and RNA methyltransferases were tested by radiometric assays using ³H-SAM. For proteins such as MLL1 trimeric complex, MLL3 pentameric complex, EZH1 (PRC2) pentameric complex, EZH2 (PRC2) trimeric complex, as well as G9a, GLP, SUV39H1, SUV39H2, SUV420H1, SUV420H2, SETD2, SETD8, SETDB1, SETD7, PRMT1, PRMT3, PRMT4, PRMT5/ MEP50 complex, PRMT6, PRMT7, PRMT8, PRMT9, PRDM9, SMYD2, SMYD3, DNMT1 and BCDIN3D the incorporation of a tritium-labeled methyl group into biotinylated substrate (Supplementary Table 3) was monitored using scintillation proximity assay (SPA). Briefly, a 10-μL reaction containing ³H-SAM and substrate at concentrations close to the apparent Km values for each enzyme (balanced conditions) was prepared. The reactions were quenched with 10 μL of 7.5 M guanidine hydrochloride; 180 μL of 20 mM Tris buffer (pH 8.0) were added, and the mixture was transferred to a 96-well FlashPlate and incubated for 1 h. The counts per minute (CPM) was measured on a TopCount plate reader. The CPM in the absence of compound or enzyme was defined as 100% activity and background (0%), respectively, for each dataset.
For DNMT1, the double-stranded DNA substrate was prepared by annealing two complementary strands (biotinylated forward strand: B-GAGCCCGTAAGCCCGTTCAGGTCG and reverse strand: CGACCTGAACGGGCTTACGGGCTC) that were synthesized by Eurofins MWG Operon (Louisville, KY, USA).
For proteins which were tested with nucleosome as substrate such as DOT1L, NSD1, NSD2, NSD3 and ASH1L, or unbiotinylated Poly(2′-deoxyinosinic-2′-deoxycytidylic acid) (Cat# 81349-500UG, Sigma Aldrich) such as DNMT3A/3L, and DNMT3B/3L, a filter-based assay was used. In this assay, a trichloroacetic acid (TCA) protein precipitation protocol was employed. A 10 μL reaction mixture was incubated at 23 °C for 1 h, followed by addition of 50 μL of 10% TCA. The mixture was transferred to filter plates (Millipore, Billerica, MA, USA) that were centrifuged at 931 × g (Allegra X-15R; Beckman Coulter, Brea, CA, USA) for 2 min. Samples were washed twice with 10% TCA and once with ethanol (180 μL), and centrifuged (as before). After drying, 100 μL MicroScint-O (Perkin Elmer) was added to each well and the plates were centrifuged to remove the liquid. A 70-μL volume of MicroScint-O was added and the CPM was measured with a TopCount plate reader.

Scheer S., Ackloo S., Medina T.S., Schapira M., Li F., Ward J.A., Lewis A.M., Northrop J.P., Richardson P.L., Kaniskan H.Ü., Shen Y., Liu J., Smil D., McLeod D., Zepeda-Velazquez C.A., Luo M., Jin J., Barsyte-Lovejoy D., Huber K.V., De Carvalho D.D., Vedadi M., Zaph C., Brown P.J, & Arrowsmith C.H. (2019). A chemical biology toolbox to study protein methyltransferases and epigenetic signaling. Nature Communications, 10, 19.

Full text: Click here

Publication 2019

Allegra Biological Assay Deoxycytidine Monophosphate deoxyinosine DNA, Double-Stranded DNMT1 protein, human DNMT3B protein, human DOT1L protein, human Enzymes Ethanol EZH1 protein, human EZH2 protein, human hSet2 protein, human Hydrochloride, Guanidine Methyltransferase MLL3 protein, human NSD1 protein, human Nucleosomes Operon Poly A Protein Methyltransferases Proteins Radiometry SETDB1 protein, human Trichloroacetic Acid Tritium Tromethamine WHSC1 protein, human WHSC1L1 protein, human

Most recents protocols related to «DNMT3B protein, human»

Comprehensive Genomic Profiling of Tumors

Full details of the methodology have been described previously^{15 (link)}. In brief, DNA libraries were prepared using either TruSeq Nano HT Sample Prep Kit (Illumina) or KAPA PCR-Free v2.1 (Roche) and sequenced on the Illumina HiSeq X Ten platform. Germline samples were sequenced to an average depth of 30X and tumour samples 90X. RNA libraries used the TruSeq Stranded mRNA Preparation Kit and sequenced on either the HiSeq 4000 or NextSeq 500 platform to a targeted paired-end read depth of 80 M reads.
WGS germline variants were subtracted from the tumour sequencing data to identify somatic only variants. Somatic variants were individually analysed with prioritisation of variants in cancer related genes and were manually mined for any mutations containing K27M, K27I, G34R, G34V or G34W changes in the following histone genes: H3F3A, H3F3B, H3F3C, HIST1H1A, HIST1H1B, HIST1H2AA, HIST1H2BA, HIST1H3A, HIST1H4A, HIST1H3C, HIST2H3C, HIST3H2BB and HIST3H3. Genes involved in the PRC2 complex and common epigenetic regulators were also mined for molecular aberrations in DNMT1, DNMT3A, DNMT3B, DNMT3L, TET1, TET2, TET3, EED, EZH2, SUZ12, SET, RBAP, KDM6A, BCOR, BCORL1, CREBBP, LZTR1 and ASZL1.

Ajuyah P., Mayoh C., Lau L.M., Barahona P., Wong M., Chambers H., Valdes-Mora F., Senapati A., Gifford A.J., D’Arcy C., Hansford J.R., Manoharan N., Nicholls W., Williams M.M., Wood P.J., Cowley M.J., Tyrrell V., Haber M., Ekert P.G., Ziegler D.S, & Khuong-Quang D.A. (2023). Histone H3-wild type diffuse midline gliomas with H3K27me3 loss are a distinct entity with exclusive EGFR or ACVR1 mutation and differential methylation of homeobox genes. Scientific Reports, 13, 3775.

Full text: Click here

Publication 2023

BCORL1 protein, human Diploid Cell DNA Library DNMT1 protein, human DNMT3B protein, human EZH2 protein, human Gene, Cancer Genes Germ-Line Mutation Germ Line Histones KDM6A protein, human Mutation Neoplasms Polycomb Repressive Complex 2 RNA, Messenger

Epigenetic Regulation in Alzheimer's Disease

mRNA expression profiles were examined for the following genes: DNA methylation writers, DNMT1 (NM_001130823), DNMT3A (NM_022552.5) and DNMT3B (NM_006892.4); readers, MeCP2 (NM_004992.4), ZBTB4 (NM_001128833.2), ZBTB33 (NM_001184742.2), ZBTB38 (NM_001376113.1) and UHRF1 (NM_001048201.3); and erasers, TET1 (NM_030625.3), TET2 (NM_001127208.3), TET3 (NM_001287491.2), TDG (NM_003211.6), MBD4 (NM_001276270.2), AICDA (NM_020661.4), GADD45A (NM_001924.4), GADD45B (NM_015675.4) and GADD45G (NM_006705.4). RNA methylation effector genes examined were as follows: writers, NOP2/NSUN1 (NM_001258308.2), NSUN2 (NM_017755.6), NSUN3 (NM_022072.5), NSUN4 (NM_199044.4), NSUN5 (NM_148956.4), NSUN6 (NM_182543.5), NSUN7 (NM_024677.6) and TRDMT1/DNMT2 (NM_004412.7); readers, ALYREF (NM_005782.4) and YBX1 (NM_004559.5); and erasers, ALKBH1 (NM_006020.3), TET1 (NM_030625.3), TET2 (NM_001127208.3) and TET3 (NM_001287491.2). Expression data were obtained from normalised fragments per kilobase of transcript per million (FPKM) values derived from RNA sequencing and presented as a z-score value of expression.
Individuals were categorised by clinical diagnosis AD versus control and grouped by age of death, APOE4 allele carrier status and Braak and CERAD staging in HIP and STG (Supplementary Table 3) and IPC or WM (Supplementary Table 4). For Braak staging, three groups were generated to represent levels of pathology. Group 1 corresponded to individuals representing low levels of pathology with a Braak stage between 0 and II. Group 2 had a Braak stage between III and IV and had moderate pathology. In the third group, samples had Braak stages between V and VI, indicating the highest level of pathology. To analyse by CERAD ranking, samples were divided into two groups with a CERAD score of 0–1 indicating low amyloid load and a CERAD score of 2–3 representing high amyloid load.
Supplementary Fig. 1 provides a flow chart of our analysis pipeline. In a first phase, differences between age, sex, APOE4 allele status and Braak and CERAD staging in the groups AD and control were assessed. We then tested for significant correlations between diagnosis status, Braak, CERAD and APOE4 across each of the four brain regions. In a second phase, we compared RNA abundance profiles across the 32 effector proteins in AD and control groups for each brain region. Subsequently, differences in gene expression were examined in individuals classified by Braak and CERAD rankings. In the third arm of the study, we assessed differential expression in individuals who self-reported TBI. For this analysis, the cohort was divided into five groups: a TBI-control group of aged individuals without TBI and without AD (referred to as ‘TBI-control’); a group of individuals which includes all TBI individuals, i.e. with and without dementia (All TBI); a third group of individuals with TBI but no AD (TBI + no AD); a fourth group which includes individuals with TBI and AD (TBI + AD); and a final group with no TBI but have AD (no TBI + AD). No differences were observed between gender, age and brain tissue post-mortem interval across the TBI groupings (Supplementary Tables 5 and 6). Similarly, in individuals who reported head injuries, we found no difference between age of first TBI incident, number of TBI incidents with loss of consciousness or duration or across the TBI groupings (Supplementary Table 7).

PerezGrovas-Saltijeral A., Rajkumar A.P, & Knight H.M. (2023). Differential expression of m5C RNA methyltransferase genes NSUN6 and NSUN7 in Alzheimer’s disease and traumatic brain injury. Molecular Neurobiology, 60(4), 2223-2235.

Full text: Click here

Publication 2023

Aged Alleles Apolipoprotein E4 APP protein, human Autopsy Brain Craniocerebral Trauma Dementia Diagnosis DNA Methylation DNMT1 protein, human DNMT2 protein, human DNMT3B protein, human Gene Expression Genes MBD4 protein, human MECP2 protein, human Methylation Proteins RNA, Messenger Tissues ZBTB38 protein, human

Protein Extraction and Antibody Analysis

Following protein extraction, equal amounts of protein were separated using 8–15% sodium dodecyl sulphate-polyacrylamide gel electrophoresis [20 (link)]. Antibodies against COL11A1 (GTX55142), DNMT1 (GTX116011), DNMT3A (GTX129125), and DNMT3B (GTX129127) were obtained from GeneTex (Irvine, CA, USA). An anti-β-actin antibody (sc-47778) was purchased from Santa Cruz Biotechnology (Dallas, TX, USA), whereas antibodies against Akt (9272), phospho-Akt (Ser473, 9271), ubiquitin (58395), mouse IgG (7076), and rabbit IgG (7074) were obtained from Cell Signaling Technology (Danvers, MA, USA). An antibody against phospho-DNMT1 (Ser84) was purchased from Affinity Biosciences (Melbourne, Australia). An antibody against phospho-DNMT1 (Ser154) was purchased from Bioss Antibodies (Woburn, MASS, USA). An antibody against SUMO-3 was purchased from Abcam (Cambridge, UK). An antibody against p16 (AF5484) was purchased from Affinity Biosciences (Bath, UK). 5-aza-2′-deoxycytidine (5-aza) and MG132 were obtained from Sigma-Aldrich. Cisplatin (Fresenius Kabi Oncology, Ltd.) was provided by the Cancer Center of National Cheng Kung University Hospital.

Wu Y.H., Huang Y.F., Wu P.Y., Chang T.H., Huang S.C, & Chou C.Y. (2023). The Downregulation of miR-509–3p Expression by Collagen Type XI Alpha 1-Regulated Hypermethylation Facilitates Cancer Progression and Chemoresistance via the DNA Methyltransferase 1/Small Ubiquitin-like Modifier-3 Axis in Ovarian Cancer Cells. Research Square.

Full text: Click here

Publication Preprint 2023

Actins Antibodies Antibodies, Anti-Idiotypic Azacitidine Bath Cisplatin Decitabine DNMT1 protein, human DNMT3B protein, human Immunoglobulins Malignant Neoplasms MG 132 Mus Neoplasms Proteins Rabbits SDS-PAGE Ubiquitin

ChIP Assay for Epigenetic Regulators

Native protein–DNA complexes were cross-linked via treatment with 1% formaldehyde for 15 min, and ChIP assays were performed as previously reported [20 (link)]. Briefly, equal amounts of isolated chromatin were subjected to immunoprecipitation using anti-DNMT1, anti-DNMT3A, anti-DNMT3B, and IgG monoclonal antibodies. Primers with the following sequences were used for the ChIP assays: miR-509–3p forward, 5′-GGTACAGAACATTCAGCATGTGG-3′ and reverse, 5′-AGAAAACTAGAAAAC TGTACAAA-3′.

Full text: Click here

Publication Preprint 2023

Chromatin DNMT1 protein, human DNMT3B protein, human Formaldehyde HSP40 Heat-Shock Proteins Immunoprecipitation Immunoprecipitation, Chromatin Monoclonal Antibodies Oligonucleotide Primers

Characterization and Validation of iPSC Lines

RNA was extracted from both fibroblast and iPSC cell pellets (passage 10) using the Quick-RNA^TM Miniprep Kit (ZYMO Research). Subsequently, cDNA was synthesized using the SuperScript^TM III First-Strand Synthesis System (Life Technologies). Expression of the selected pluripotency markers (Table 1) was confirmed using RT-qPCR TaqMan® probes (Life Technologies) (Table 2) using a BioRad CFX384 Real-Time system (50 °C 2′, 95 °C 10′, 40x (95 °C 15′', 60 °C 1′)).Table 1

Characterization and validation.

Classification	Test	Result	Data
Morphology	Photography Bright field	Normal	Fig. 1 panel F
Phenotype	Qualitative analysis(Immunocytochemistry)	Staining/expression of pluripotency markers: Oct3/4, Nanog, Sox2, Tra1-60, Tra1-80.	Fig. 1 panel A
Phenotype	Quantitative analysis (RT-qPCR)	Expression of DNMT3B, NANOG, POU5F1 and SOX2	Fig. 1 panel B
Genotype	HumanCytoSNP-12 array	Resolution 72 kb, no major copy number variations	Fig. 1 panel D
Identity	HumanCytoSNP-12 arrayOR	> 99.9 % identical SNPs	Table 3
Identity	STR analysis	N/A	N/A
Mutation analysis (IF APPLICABLE)	Sequencing	Hemizygous BGN c.776G > T	Fig. 1 panel C
Mutation analysis (IF APPLICABLE)	Southern Blot OR WGS	N/A	N/A
Microbiology and virology	Mycoplasma	Negative	Supplementary Fig. 2, Supplementary Fig. 3
Differentiation potential	Trilineage differentiation	Expression of appropriate markers of the respective germ layers, i.e. ectoderm, mesoderm and endoderm.	Fig. 1 panel E
List of recommended germ layer markers	Expression of these markers has to be demonstrated at mRNA (RT PCR) or protein (IF) levels, at least 2 markers need to be shown per germ layer	Endoderm: CXCR4, FOXA2, SOX17Mesoderm: NKX2.5, αSMA (ACTA2), HAND1Ectoderm: HES5, MAP2, PAX6	Fig. 1 panel E
Donor screening (OPTIONAL)	HIV 1 + 2 Hepatitis B, Hepatitis C	N/A	N/A
Genotype additional info (OPTIONAL)	Blood group genotyping	N/A	N/A
Genotype additional info (OPTIONAL)	HLA tissue typing	N/A	N/A

Table 2

Reagents details.

	Antibodies used for immunocytochemistry/flow-cytometry
	Antibody	Dilution	Company Cat #	RRID
Pluripotency Markers	Mouse anti-TRA1-60	1:200	Cell Signaling Technology Cat#4746S	AB_2119059
	Rabbit anti-OCT4	1:100	Thermo Fisher Scientific Cat#PA596860	AB_2808662
	Rabbit anti-SOX2	1:500	Merck Millipore Cat#AB5603	AB_2286686
	Mouse anti-TRA1-81	1:200	Cell Signaling Technology Cat#4745S	AB_2119060
	Rabbit anti-NANOG	1:500	ThermoFisher Scientific Cat#PA1-097	AB_2539867
Secondary antibodies	AF555 Goat anti-Mouse, IgM	1:500	Thermo Fisher Scientific Cat#A21426	AB_2535847
Secondary antibodies	AF488 Goat anti-Rabbit, IgG	1:500	Thermo Fisher scientific Cat#A11034	AB_2576217

	Primers
	Target	Size of band	Forward/Reverse primer (5′-3′)

Pluripotency Markers (RT-qPCR)	DNMT3B	55 bp	Hs00171876_m1
	NANOG	99 bp	Hs04260366_g1
	POU5F1	77 bp	Hs04260367_gH
	SOX2	91 bp	Hs01053049_s1
House-Keeping Genes (RT-qPCR)	GAPDH	93 bp	Hs02758991_g1
House-Keeping Genes (RT-qPCR)	ACTB	63 bp	Hs01060665_g1
Differentiation markers (RT-qPCR)	CXCR4	153 bp	Hs00607978_s1
	FOXA2	66 bp	Hs00232764_m1
	SOX17	149 bp	Hs00751752_s1
	NKX2.5	64 bp	Hs00231763_m1
	αSMA (ACTA2)	105 bp	Hs00426835_g1
	HAND1	54 bp	Hs00231848_m1
	HES5	62 bp	Hs01387463_g1
	MAP2	98 bp	Hs00258900_m1
	PAX6	76 bp	Hs00240871_m1
Targeted mutation sequencing	BGN c.776G > T	319 bp	GTTTTCCCAGTCACGACAAGGGTGATGCCAGAGTCC/ CAGGAAACAGCTATGACGACTGAGGGACTGCCCG
Sendai virus Plasmids (PCR)	SeV	181 bp	GGATCACTAGGTGATATCGAGC/ACCAGACAAGAGTTTAAGAGATATGTATC
	KOS	528 bp	ATGCACCGCTACGACGTGAGCGC/ ACCTTGACAATCCTGATGTGGyc
	Klf4	410 bp	TTCCTGCATGCCAGAGGAGCCC/AATGTATCGAAGGTGCTCAA
	c-Myc	532 bp	TAACTGACTAGCAGGCTTGTCG/ TCCACATACAGTCCTGGATGATGATG

Table 3

Cell line identity testing.

iPSC line	total count	correct count	errors	% identical
CMGANTi003-A P10	288,134	288,131	3	>99.9 %
CMGANTi004-A P10	287,779	287,769	10	>99.9 %

De Kinderen P., Peeters S., Rabaut L., Mortier G., Ponsaerts P., Loeys B., Verstraeten A, & Meester J.A. (2023). IPSC reprogramming of two patients with spondyloepimetaphyseal dysplasia (SEMD, biglycan type). Stem Cell Research, 67, 103024.

Full text: Click here

Publication 2023

ACTA2 protein, human Anabolism Antibodies Cells CXCR4 protein, human DNA, Complementary DNMT3B protein, human Ectoderm Endoderm Fibroblasts Genes Germ Layers Goat Hepatitis A Hepatitis B HIV-1 IgG1 IgM1 Immunocytochemistry Induced Pluripotent Stem Cells MAP2 protein, human Mesoderm Mus Mutation Oligonucleotide Primers Pellets, Drug Plasmids POU5F1 protein, human Proteins Rabbits Reverse Transcriptase Polymerase Chain Reaction RNA, Messenger SOX2 protein, human SOX21 protein, human Tissues Virus

Top products related to «DNMT3B protein, human»

Dnmt3b by Abcam

Sourced in United States, United Kingdom, China

DNMT3B is a DNA methyltransferase enzyme that catalyzes the addition of methyl groups to cytosine residues in DNA, playing a critical role in the regulation of gene expression and genomic imprinting.

Ab2851 by Abcam

Sourced in United States, United Kingdom

Ab2851 is a laboratory reagent used for protein detection and quantification. It is a colorimetric assay kit that employs a copper-based detection method to measure protein concentrations in samples. The kit provides a simple and reliable way to determine the total protein content in a variety of biological samples.

Dnmt3a by Abcam

Sourced in United States, United Kingdom

DNMT3A is a DNA methyltransferase enzyme that catalyzes the transfer of methyl groups to cytosine residues in DNA, playing a key role in the establishment and maintenance of DNA methylation patterns. This enzyme is essential for de novo DNA methylation during embryogenesis and embryonic development.

Lipofectamine 2000 by Thermo Fisher Scientific

Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco

Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.

Pvdf membrane by Merck Group

Sourced in United States, Germany, China, United Kingdom, Morocco, Ireland, France, Italy, Japan, Canada, Spain, Switzerland, New Zealand, India, Hong Kong, Sao Tome and Principe, Sweden, Netherlands, Australia, Belgium, Austria

PVDF membranes are a type of laboratory equipment used for a variety of applications. They are made from polyvinylidene fluoride (PVDF), a durable and chemically resistant material. PVDF membranes are known for their high mechanical strength, thermal stability, and resistance to a wide range of chemicals. They are commonly used in various filtration, separation, and analysis processes in scientific and research settings.

Trizol reagent by Thermo Fisher Scientific

Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand

TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.

Dnmt3b by Santa Cruz Biotechnology

Sourced in United States, China

DNMT3b is a DNA methyltransferase enzyme that catalyzes the addition of methyl groups to cytosine residues in DNA. It plays a key role in the establishment and maintenance of DNA methylation patterns during development and cellular differentiation.

Anti dnmt3b by Abcam

Sourced in United Kingdom, United States

Anti-DNMT3B is a primary antibody that binds to and detects the DNMT3B protein. DNMT3B is a DNA methyltransferase enzyme that is involved in de novo DNA methylation.

Ab13537 by Abcam

Sourced in United States, United Kingdom

Ab13537 is a primary antibody produced in rabbit that targets the human CCL5 protein. It is intended for use in immunohistochemistry, western blotting, and ELISA applications.

Dnmt3b by Cell Signaling Technology

Sourced in United States

DNMT3B is a protein involved in DNA methylation. It is responsible for establishing and maintaining DNA methylation patterns during development and cellular differentiation.

What is the DNMT3B protein and what are its key functions?

The DNMT3B protein is a DNA methyltransferase enzyme that plays a crucial role in establishing and maintaining DNA methylation patterns during embryonic development and cellular differentiation. Its primary function is to initiate the addition of methyl groups to CpG dinucleotides in the genome, a process known as de novo DNA methylation. This enzymatic activity is essential for regulating gene expression and genome stability.

How does dysregulation of DNMT3B contribute to diseases?

Disruptions in the normal function of DNMT3B have been implicated in various diseases, including cancer and developmental disorders. Aberrant DNA methylation patterns caused by DNMT3B dysregulation can lead to altered gene expression and genome instability, which are hallmarks of many disease states. Understanding the role of DNMT3B in these pathological processes is crucial for developing potential therapeutic strategies.

Are there different variants or types of the DNMT3B protein?

How can PubCompare.ai help researchers working with the DNMT3B protein?

PubCompare.ai's AI-powered platform can assist researchers studying the DNMT3B protein in several ways. First, it can help screen protocol literature more efficiently, allowing you to quickly identify the most relevant and effective protocols related to DNMT3B. Second, the platform's AI-driven analysis can highlight key differences in protocol effectiveness, enabling you to choose the best option for your specific research goals and ensrue reproducibility and accuracy in your studies. This can be particularly useful when working with the DNMT3B protein, where minor variations in experimental protocols can have a significant impact on results.

What are some common applications of the DNMT3B protein?

The DNMT3B protein is widely studied in the field of epigenetics due to its central role in establishing and maintaining DNA methylation patterns. Some common applications include investigating its function during embryonic development and cellular differentiation, analyzing its dysregulation in disease states like cancer, and exploring its potential as a therapeutic target. Researchers may also use DNMT3B as a tool to study DNA methylation dynamics and the epigentec mechanisms that control gene expression and genome stability.

More about "DNMT3B protein, human"

Discover the secrets of the DNMT3B (DNA Methyltransferase 3B) protein, a crucial enzyme in epigenetic regulation.
This de novo DNA methyltransferase plays a vital role in establishing and maintaining DNA methylation patterns during embryonic development and cellular differentiation.
Dysregulation of DNMT3B has been linked to various diseases, including cancer and developmental disorders.
Explore the functions and mechanisms of DNMT3B, an enzyme responsible for initiating the addition of methyl groups to CpG dinucleotides in the genome.
Understanding the role of DNMT3B, as well as related proteins like DNMT3A, is essential for advancing research in the field of epigenetics and developing potential therapeutic strategies.
Leverage the power of AI-driven platforms like PubCompare.ai to locate protocols from literature, pre-prints, and patents related to DNMT3B.
Utilize their innovative tools to identify the best protocols and products for your research, enhancing reproducibility and accuracy in your studies.
Investigate the use of various techniques and reagents, such as Lipofectamine 2000 for transfection, PVDF membranes for Western blotting, and TRIzol reagent for RNA extraction, in the context of DNMT3B research.
Explore the availability of antibodies, like Anti-DNMT3B (Ab13537), to facilitate the study of this critical protein.
Delve into the complexities of DNMT3B and its role in epigenetic regulation.
Uncover the secrets of this enigmatic protein and how it shapes the landscape of gene expression and cellular identity.
Empower your research with the resources and insights necessary to push the boundaries of epigenetic understanding.