> Chemicals & Drugs > Amino Acid > Dynamin 2

Dynamin 2

Dynamin 2 (DNM2) is a large GTPase protein that plays a crucial role in membrane trafficking and vesicle formation.
It is involved in the scission of clathrin-coated pits during endocytosis, as well as in the regulation of other membrane dynamics processes.
Dynamin 2 is expressed ubiquitously and is essential for normal cellular function.
Mutations in the DNM2 gene have been linked to several human diseases, including Charcot-Marie-Tooth neuropathy and centronuclear myopathy.
Researchers studying Dynamin 2 can utilize PubCompare.ai, a leading AI-driven platform, to quickly locate the best research protocols from litereture, pre-prints, and patents, and optimize their Dynamin 2 investigations with cutting-edge technology.

Most cited protocols related to «Dynamin 2»

Dynamin Conditional Knockout Strategy

Cited 9 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2009

Animals Chromosomes, Human, Pair 2 Cloning Vectors Dynamin 2 Dynamin I Exons Genes Introns Mice, House Neomycin Thymidine Kinase

Generation and Isolation of WASH-Knockout Mice

Cited 6 times

Generation of conditional WASH-knockout mice and isolation of MEF lines were achieved in collaboration with the Transgenic and Gene Targeted Mouse Shared Resource at the Mayo Clinic (Rochester, MN), using well-established protocols (Dawlaty and van Deursen, 2006 (link)). The WASH-knockout targeting construct was generated using the previously described pNTKV1901-frt-loxP vector system as depicted in Supplemental Figure S1 (Dawlaty and van Deursen, 2006 (link)). Protamine-Cre, ER-Cre, and FLPeR mice were obtained from Jackson Laboratory (Bar Harbor, ME). We first bred germline-transmitted mice to FLPeR mice to delete the Neo cassette and then crossed the resultant WASH^+/flox mice with protamine-Cre mice to generate WASH^−/− animals (not viable). We also bred WASH^+/flox mice with ER-Cre mice to obtain WASH^+/flox/ER-Cre⁺ animals, which were crossed with WASH^+/flox to obtain the appropriate genotypes for MEF isolation (Dawlaty and van Deursen, 2006 (link)). MEFs were immortalized using an SV40-expressing retrovirus obtained from Jan van Deursen (Mayo Clinic). ER-Cre⁺ MEFs were treated with 3 μM 4-OHT as described for Dyn2/1 deletion (Ferguson et al., 2009 (link)). Standard PCR was used to screen for germline transmission (CATGACTTCTGTGCTCTGTG and GCCGCTCCCGATTCGCAGCGCATCG), floxed WASH allele (CGCATTGATCTTCCTATACGC and TGTCAGTCCTATGCTTAGTG), and Cre (ACCAGCCAGCTATCAACTCG and TTACATTGGTCCAGCCACC). Experimental procedures involving laboratory mice were reviewed and approved by the Institutional Animal Care and Use Committee of the Mayo Clinic.

Gomez T.S., Gorman J.A., Artal-Martinez de Narvajas A., Koenig A.O, & Billadeau D.D. (2012). Trafficking defects in WASH-knockout fibroblasts originate from collapsed endosomal and lysosomal networks. Molecular Biology of the Cell, 23(16), 3215-3228.

Publication 2012

Alleles Animals Animals, Transgenic Cloning Vectors Deletion Mutation Dynamin 2 Genes Genotype Germ Line Institutional Animal Care and Use Committees isolation Mice, House Mice, Knockout Mice, Laboratory Protamines Retroviridae Simian virus 40 Transmission, Communicable Disease

Clathrin Light Chain A and Dynamin-2 Fluorescent Tagging

Cited 6 times

Human clathrin light chain A (CLTA) was amplified by PCR from a plasmid that was provided by L. Greene (NIH, USA)^{36 (link)}. This CLTA sequence is identical to the CLTA expressed in SK-MEL-2 cells. The African green monkey CLTA gene was amplified by reverse transcription PCR (RT–PCR) from poly-A mRNA of BSC-1 cells and subcloned into a pEGFP-N1 vector (Clontech) in which GFP was replaced with TagRFP-T (RFP)^{37 (link)}. TagRFP-T was a gift from R. Tsien (UC, San Diego, USA). A GTSGGS linker was placed between CLTA and RFP. Dynamin-2 (DNM2) was amplified by RT–PCR from poly-A mRNA of SK-MEL-2 cells and subcloned into a pEGFP-N1 vector with a GTSGGS linker between DNM2 and GFP.

Doyon J.B., Zeitler B., Cheng J., Cheng A.T., Cherone J.M., Santiago Y., Lee A.H., Vo T.D., Doyon Y., Miller J.C., Paschon D.E., Zhang L., Rebar E.J., Gregory P.D., Urnov F.D, & Drubin D.G. (2011). Rapid and efficient clathrin-mediated endocytosis revealed in genome-edited mammalian cells. Nature cell biology, 13(3), 331-337.

Publication 2011

Cells Cercopithecus aethiops Clathrin Light Chains Cloning Vectors Dynamin 2 Genes Homo sapiens mRNA, Polyadenylated Plasmids Reverse Transcription

Molecular Labeling of Zebrafish Germ Cells

Cited 6 times

Capped sense RNA was synthesized with the mMessageMachine kit (Ambion) and microinjected into one-cell stage embryos. To direct protein expression to the PGCs, the corresponding open reading frames (ORFs) were fused upstream to the 3'UTR of the nanos1 (nos1-3'UTR) gene, facilitating translation and stabilization of the RNA in these cells [11 (link)]. To fluorescently label PGCs, pSP64T-gfp-nos1-3'UTR RNA was injected (210 pg per embryo) [11 (link)]. For studying the subcellular localization of Granulito protein, pSP64T-granulito-eyfp-nos1-3'UTR was used. For labeling the nuclear envelope in PGCs, pSP64T-laminB2-mgfp-nos1-3'UTR was used. To label germ cell granules we used the construct pSP64T-vasa-dsRedEx-nos1-3'UTR. For labeling zebrafish nuclear pore complexes the constructs pSP64T-mgfp-NUPL1-nos1-3'UTR and pSP64T-NUP155-mgfp-nos1-3'UTR were used. For labeling molecular motors, pSP64T-egfp-kinesin11-nos1-3'UTR and pSP64T-Dyn2-egfp-nos1-3'UTR were used. For disruption of Dynein-Dynactin function, zebrafish Dynamitin pSP64T-dynamitin-nos1-3'UTR was overexpressed. The constructs pSP64T-H1M-egfp-nos1-3'UTR, pSP64T-egfp-farnesyl-nos1-3'UTR, and pSP64T-clip170-egfp-nos1-3'UTR were used to label chromatin, plasma membrane and microtubules respectively. To inhibit cytokinesis, mRNA of pSP64T-N19RhoA-nos1-3'UTR was injected.
Full length Tdrd7 was cloned and confirmed with 5'Race (accession number EF643554). For studying the subcellular localization of Tdrd7 protein, pSP64-egfp-Tdrd7-3'UTR was used. The detailed cloning strategy is provided in the Additional file 9.

Strasser M.J., Mackenzie N.C., Dumstrei K., Nakkrasae L.I., Stebler J, & Raz E. (2008). Control over the morphology and segregation of Zebrafish germ cell granules during embryonic development. BMC Developmental Biology, 8, 58.

Full text: Click here

Publication 2008

3' Untranslated Regions Cardiac Arrest Cells Chromatin Cytokinesis Cytoplasmic Granules Dynactin Subunit 1 Dynamin 2 Dynein ATPase Embryo Genes Microtubules NOS1 protein, human Nuclear Envelope Nuclear Pore Open Reading Frames Plasma Membrane Proteins RNA, Messenger Zebrafish

Visualization and Quantification of Endocytosis

Cited 5 times

To visualize endocytic vesicles, cells were exposed to AlexaFluor555 transferrin (Invitrogen) or SLO in Ca²⁺/DME containing 2.5 mg/ml of lysine-fixable 10-kD Texas red (TR) dextran (Invitrogen). After 4 min at 37°C, cells were fixed, mounted in SyberGold (Invitrogen), and examined by confocal microscopy on an LSM510 microscope. Cells expressing dynamin-2 wild-type or K44A GFP constructs in pEGFP-N1 (Clontech Laboratories, Inc.) were examined by confocal microscopy for dextran or transferrin uptake 18 h after transfection (Lipofectamine). For immunofluorescence, cells were fixed in 4% PFA in DME and 10 mM Hepes/NaOH, pH 7, permeabilized in PBS, 0.05% saponin, and 1% BSA, and stained for 1 h with anti–rat Lamp1 mAb (LYIC6; provided by I. Mellman, Genentech, South San Fransisco, CA) or anti-EEA1 mAb (BD Biosciences). Nuclei were stained with DAPI (Sigma-Aldrich) or Sytox green (Invitrogen). Endocytosis was quantified by FACS after SLO or scrape wounding using a trypan blue fluorescence quench assay (Fig. S3 A;Pearson et al., 2003 (link)). Cells were stained on the plasma membrane with 1 μg/ml wheat germ agglutinin (WGA)–FITC for 1 min on ice, washed three times in PBS, wounded by scraping or by incubation with SLO, and incubated for 2 min at 37°C with 0.2% trypan blue before washing and FACS analysis.

Idone V., Tam C., Goss J.W., Toomre D., Pypaert M, & Andrews N.W. (2008). Repair of injured plasma membrane by rapid Ca2+-dependent endocytosis. The Journal of Cell Biology, 180(5), 905-914.

Publication 2008

Biological Assay Cell Nucleus Cells DAPI Dextran Dynamin 2 Endocytic Vesicles Endocytosis Fluorescein-5-isothiocyanate Fluorescence HEPES Immunofluorescence Lipofectamine Lysine lysosomal-associated membrane protein 1, human Microscopy Microscopy, Confocal Plasma Membrane Saponin SYTOX Green Transfection Transferrin Trypan Blue Wheat Germ Agglutinins

Most recents protocols related to «Dynamin 2»

Engineered HeLa Cell Lines for Dyn2 and EHD2 Studies

The HeLa Flp-In T-REx Dyn2-EGFP-P2A-Caveolin1-mCherry, EGFP-EHD2-P2A-Caveolin1-mCherry, and Pac2-EGFP-P2A-Caveolin1-mCherry constructs were generated by linearizing pcDNA/FRT/TO/Caveolin1-mCherry (Hubert et al., 2020b (link)) with the restriction enzyme HindIII (Thermo Fisher Scientific). The DNA encoding the EGFP-fusion proteins and the P2A peptide was amplified by PCR and inserted by Gibson assembly using NEBuilder HiFi DNA assembly master mix (New England BioLabs). For creating flanking insert fragments, the following primers were used for Dyn2-EGFP-P2A: 5′-GACTCTAGCGTTTAAACTTAATGGGCAACCGCGGGATG-3′ paired with 5′-TTCCATCGATCTTGTACAGCTCGTCCATGCC-3′ and 5′-TGGACGAGCTGTACAAGATCGATGGAAGCGGAGCTAC-3′ paired with 5′-TGGATCCGAGCTCGGTACCACCTCTAGGTCCAGGGTTC-3′. Primers used for Pac2-EGFP-P2A were: 5′-GACTCTAGCGTTTAAACTTAAT GTCTGTCACCTACGATG-3′ paired with 5′-TTCCATCGATCTTGTACAGCTCGTCCATGCC-3′ and 5′-TGGACGAGCTGTACAAGATCGATGGAAGCGGAGCTAC-3′ paired with 5′-TGGATCCGAGCTCGGTACCACCTCTAGGTCCAGGGTTC-3′. For creating flanking insert fragments, the following primers were used for EGFP-EHD2-P2A: 5′-GACTCTAGCGTTTAAACTTAATGGTGAGCAAGGGCGAG-3′ paired with 5′-TTCCATCGATTTCAGCAGAGCCCTTCTG-3′ and 5′-CTCTGCTGAAATCGATGGAAGCGGAGCTAC-3′ paired with 5′-GGATCCGAGCTCGGTACC-3′. The HeLa Flp-In T-REx K44A Dyn2-EGFP-P2A-Cav1-mCherry construct was obtained by in vitro mutagenesis of the pcDNA/FRT/TO/Dyn2-EGFP-P2A-Cav1-mCherry construct exchanging lysine at position 44 to an alanine using these primers: 5′-CCAGAGCGCCGGCGCGAGTTCGGTGCTC-3′ and 5′-GAGCACCGAACTCGCGCCGGCGCTCTGG-3′. For creation of the HeLa Flp-In T-REx I684K Dyn2-EGFP-P2A-Cav1-mCherry construct the following primers were used to exchange isoleucine at position 684 to a lysine: 5′-GACCATCATGCACCTCATGAAGAACAACACAAAGGCTTC-3′ and 5′-GAAGGCCTTTGTGTTGTTCTTCATGAGGTGCATGATGGTC-3′. The underlining represents the nucleotides in the primer correspond to specific mutations. The Flp-In TRex HeLa cell lines were maintained in DMEM supplemented with 10% (vol/vol) FBS, 100 μg/ml hygromycin B (Thermo Fisher Scientific), and 5 μg/ml blasticidin S HCl (Thermo Fisher Scientific) for plasmid selection at 37°C, 5% CO₂. Expression at near endogenous levels was induced by incubation with 0.5 ng/ml (Cav1-mCh) and 1.0 ng/ml (EGFP-fusion-P2A-Cav1mCh) doxycycline hyclate (Dox; Sigma-Aldrich) for 16–24 h. All cell lines tested negative for mycoplasma. For generation of the ΔNΔEH EHD2-BFP expression vector, the ΔNΔEH EHD2 mRNA was subcloned from ΔNΔEH EHD2-mCherry construct (Hoernke et al., 2017 (link)) using restriction enzymes XhoI and BamHI (Thermo Fisher Scientific) and inserted into the pTagBFP-C (Evrogen) expression vector.

Larsson E., Morén B., McMahon K.A., Parton R.G, & Lundmark R. (2023). Dynamin2 functions as an accessory protein to reduce the rate of caveola internalization. The Journal of Cell Biology, 222(4), e202205122.

Full text: Click here

Publication 2023

5'-chloroacetamido-5'-deoxythymidine Alanine blasticidin S CAV1 protein, human Cell Lines Cloning Vectors Deoxyribonuclease HindIII DNA Restriction Enzymes Doxycycline Hyclate Dynamin 2 enhanced green fluorescent protein HeLa Cells Hygromycin B Isoleucine Lysine Mutagenesis Mutation Mycoplasma Nucleotides Oligonucleotide Primers Peptides Plasmids RNA, Messenger

Dynamin-mediated Endocytosis in Cav1-mCh HeLa Cells

Cav1-mCh HeLa cells were transfected with Lipofectamine 2000 (Thermo Fisher Scientific) using Opti-MEM I reduced serum medium (Thermo Fisher Scientific) for transient protein expression. For Dyn2, EHD2, Pac2, and Dyn1 depletion, Cav1-mCh HeLa cells were transfected with stealth siRNA, specific against human Dyn1 (#1: 5′-CCGTAGACTTTGAGAAGCGCATTGA-3′, #2: 5′-GAGATCAGCTATGCTAT CAAGAATA-3′, #3: 5′-CATGGCCTTTGAGACCATTGTGAAA-3′), Dyn2 (5′-CCAGATTCTTCTGCTGATCGACATT-3′), and EHD2 (5′-TTTCCGAAAGGGTTGAGTTTGCGGA-3′), all from Thermo Fisher Scientific or ON-TARGETplus siRNA against Pac2 (5′-CAAATTATGTGGAGGCGAT-3′; Dharmacon) or scrambled control (Thermo Fisher Scientific) using Lipofectamine 2000 and Opti-MEM according to manufacturer’s instructions. Cells were transfected twice over a period of 72 h before the experiment. Protein levels were analyzed by SDS-PAGE and immunoblotting to Amersham Hybond P 0.45 polyvinylidene difluoride membrane (MERCK) using rabbit anti-Cav1 (ab2910; Abcam), rabbit anti-Dyn1 (ab52661; Abcam), rabbit anti-Dyn2 (PA1-661; Thermo Fisher Scientific), rabbit anti-EHD2, RRID:AB_2833022 (Morén et al., 2012 (link)), mouse anti-GAPDH (MAB374; Millipore) rabbit anti-Pac2 (2604), and mouse anti-β-actin (3700), both from Cell Signaling. Following HRP-conjugated secondary antibodies were used: goat anti-rabbit (AS09 602; Agrisera) and goat anti-mouse (A9917; MERCK). In some cases, the membrane was cut after blot before probing with antibodies to simultaneously probe for proteins of different sizes. For drug treatments, cells were treated with 30 μM Dyngo 4a or 1 μM Ryngo 1-23 in live cell medium for 30 min, respectively, 20 min prior to experiment. DMSO (0.001%) was used as control. For Tf uptake, cells were incubated 10 min at 37°C, 5% CO₂ with Alexa fluor 647 conjugated Tf (5 μg/ml) followed by two washes with ice-cold PBS for a total of 15 min. Cells were immediately fixed with 3% PFA for 10 min at room temperature.

Full text: Click here

Publication 2023

5'-chloroacetamido-5'-deoxythymidine Actins Alexa Fluor 647 Antibodies CAV1 protein, human Cells Cold Temperature Dynamin 2 Dynamin I dyngo-4a GAPDH protein, human Goat HeLa Cells Homo sapiens lipofectamine 2000 Mus Pharmaceutical Preparations polyvinylidene fluoride Proteins Rabbits RNA, Small Interfering Ryngo 1-23 SDS-PAGE Serum Sulfoxide, Dimethyl Tissue, Membrane Transients

Visualizing Caveolae Dynamics and Dynamin Regulation

Fig. S1 shows mean squared displacement of stable caveolae and the uptake of Tf-647 in Cav1-mCh HeLa FlpIn cells treated with ctrl or Dyn2 siRNA as well as caveolae dynamic parameters following Dyn1 depletion. Fig. S2 provides additional data on the colocalization of Dyn2-GFP and Cav1-mCh imaged by SIM. Fig. S3 shows Dyn2-GFP localization after EHD2 or Pac2 depletion and characterization of GFP-EHD2-Cav1-mCh and Pac2-GFP-Cav1-mCh HeLa FlpIn cells as well as representative FLIM-FRET images of GFP-fusion proteins and Cav1-mCh in FlpIn HeLa cells. Fig. S4 shows the protein titration of the HeLa FlpIn cell lines expressing K44A Dyn2-GFP and Cav1-mCh or I684K Dyn2-GFP and Cav1-mCh after Dox induction. Fig. S5 provides additional information on the effect that Dyngo 4a has on the Dyn2-GFP-Cav1-mCh HeLa FlpIn cells. Video 1 shows single particle tracking of Cav1-mCh in a Cav1-mCh HeLa FlpIn cell treated with ctrl siRNA imaged on TIRF. Video 2 shows single particle tracking of Cav1-mCh in a Cav1-mCh HeLa FlpIn cell treated with EHD2 siRNA imaged on TIRF. Video 3 shows single particle tracking of Cav1-mCh in a Cav1-mCh HeLa FlpIn cell treated with Dyn2 siRNA imaged on TIRF. Video 4 shows live cell imaging of a Dyn2-GFP-Cav1-mCh HeLa FlpIn cell using SIM (SIM² algorithm). Video 5 shows live-cell TIRF imaging of Dyn2-GFP-Cav1-mCh HeLa FlpIn cells treated 30 min with 30 μΜ οf Dyngo 4a.

Full text: Click here

Publication 2023

CAV1 protein, human Caveolae Cells Dynamin 2 Dynamin I dyngo-4a Fluorescence Resonance Energy Transfer HeLa Cells Proteins RNA, Small Interfering Titrimetry

Visualization of Caveolae and Endocytic Regulators

Induced Dyn2-GFP-Cav1-mCh HeLa cells were transfected with the EHD2-BFP expression vector and seeded on precision coverslips (No. 1.5H, Paul Marienfeld GmbH and Co. KG) in 24-well plates at 50 × 10³ cells/well and incubated overnight (37°C, 5% CO₂). Following incubation with Dyngo 4a (30 μM) or DMSO (0.001%) for 30 min, cells were fixed with 3% PFA in PBS (Electron Microscopy Sciences) and subsequent permeabilization and blocking was carried out simultaneously using PBS containing 5% goat serum and 0.05% saponin. Cells were then immunostained with rabbit anti-PTRF, RRID:AB_88224 (Abcam) followed by goat anti-rabbit IgG secondary antibody coupled to Alexa Fluor 647, RRID:AB_2535814 (Thermo Fisher Scientific) as previously described (Lundmark et al., 2008 (link)). Confocal images were acquired using the Zeiss Spinning Disk Confocal microscope (63× lens). Micrographs were prepared using Fiji (Schindelin et al., 2012 (link)) and Adobe Photoshop CS6.

Full text: Click here

Publication 2023

Alexa Fluor 647 anti-IgG CAV1 protein, human Cells Cloning Vectors Dynamin 2 dyngo-4a Electron Microscopy Goat HeLa Cells Immunoglobulins Lens, Crystalline Microscopy, Confocal Rabbits Saponin Serum Sulfoxide, Dimethyl

Cardiac Mitochondrial Protein Expression

Western blot analysis was used to detect and quantify the protein expression of succinate dehydrogenase (Sdha), long-chain-fatty-acid-CoA ligase 1 (Acsl1),2-oxoglutarate dehydrogenase (Ogdh), carnitine O-palmitoyltransferase 1 (Cpt1b) and carnitine O-palmitoyltransferase 2 (Cpt2) in cardiac mitochondrial proteins. We also quantified the main mitochondrial dynamics-related proteins mitofusin 1 (Mfn1), mitofusin 2 (Mfn2) and isoform 2 of dynamin-like 120 kDa protein (Opa1). Cardiac mitochondrial total protein was extracted from the isolated cardiac mitochondria using RIPA buffer and quantified using the BCA Assay. Total protein was separated by SDS‒PAGE and transferred onto PVDF membranes. The membranes were blocked with 5% free-fat milk and subsequently incubated overnight at 4 °C with the respective primary antibodies. Subsequently, the membranes were incubated with secondary antibodies for 1 h. COX IV was the internal control. Finally, the target protein bands were visualized using an ECL chemiluminescence detection kit (Immobilon™ Western, Millipore Corporation, Billerica, USA) and analysed using Image Lab 5.0 software (Bio-Rad). The experiments were repeated in triplicate, and the quantification was normalized to the corresponding value of COX IV expression.

Ding X., Zhang Y., Pan P., Long C., Zhang X., Zhuo L., Zhou Q., Liao W, & Tan G. (2023). Multiple mitochondria-targeted components screened from Sini decoction improved cardiac energetics and mitochondrial dysfunction to attenuate doxorubicin-induced cardiomyopathy. Theranostics, 13(2), 510-530.

Full text: Click here

Publication 2023

ACSL1 protein, human Antibodies Biological Assay Buffers Cardiac Arrest Carnitine O-Palmitoyltransferase Chemiluminescence Dynamin 2 Heart Immobilon Ketoglutarate Dehydrogenase Complex Milk, Cow's Mitochondria, Heart Mitochondrial Proteins mitofusin 2 protein, human OPA1 protein, human polyvinylidene fluoride Protein Isoforms Proteins Radioimmunoprecipitation Assay SDHD protein, human SDS-PAGE Tissue, Membrane Western Blot

Top products related to «Dynamin 2»

Lipofectamine rnaimax by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Japan, France, Canada, Switzerland, Denmark, Belgium, Italy, Australia, Singapore, Spain, Colombia, Sweden, Netherlands, New Zealand, Poland, Pakistan, Lithuania

Lipofectamine RNAiMAX is a transfection reagent designed for efficient delivery of small interfering RNA (siRNA) and short hairpin RNA (shRNA) into a wide range of cell types. It is a cationic lipid-based formulation that facilitates the uptake of these nucleic acids into the target cells.

Ab3457 by Abcam

Sourced in United Kingdom, United States

Ab3457 is a laboratory equipment product offered by Abcam. It is designed to serve a core function without any interpretation or extrapolation on its intended use.

Lipofectamine 2000 by Thermo Fisher Scientific

Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco

Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.

Phalloidin tritc by Merck Group

Sourced in United States, Germany, United Kingdom, Italy, Canada, China, Japan, Spain, Macao

Phalloidin-TRITC is a fluorescent dye used to label and visualize actin filaments in cells. It binds specifically to F-actin and emits a red fluorescent signal when excited by an appropriate light source. This product is commonly used in microscopy and cell biology applications.

Mt1 mmp by Abcam

Sourced in United States

MT1-MMP is a membrane-type matrix metalloproteinase (MMP) that plays a role in the degradation of the extracellular matrix. It is involved in the processing of other MMPs and can cleave a variety of extracellular matrix proteins.

Dynasore by Merck Group

Sourced in United States, Germany, Sao Tome and Principe, United Kingdom, Israel

Dynasore is a small molecule compound used in laboratory research. It functions as a dynamin inhibitor, a protein involved in processes such as endocytosis. The core function of Dynasore is to inhibit the activity of dynamin, which is important for various cellular processes.

Complete protease inhibitor by Roche

Sourced in United States, Switzerland, Germany, United Kingdom, Canada, France, China, Japan, Denmark, Australia, Italy, India

Complete protease inhibitor is a laboratory product that functions to inhibit a broad range of proteases. It is designed to prevent the degradation of proteins during sample preparation and analysis.

β actin by Merck Group

Sourced in United States, United Kingdom, Germany, China, Canada, Japan, Macao, Italy, Sao Tome and Principe, Israel, Spain, Denmark, France, Finland, Australia, Morocco, Ireland, Czechia, Sweden, Uruguay, Switzerland, Netherlands, Senegal

β-actin is a protein that is found in all eukaryotic cells and is involved in the structure and function of the cytoskeleton. It is a key component of the actin filaments that make up the cytoskeleton and plays a critical role in cell motility, cell division, and other cellular processes.

Gfp dynamin 2 k44a plasmid by Addgene

The GFP-Dynamin 2-K44A plasmid is a DNA construct that expresses a mutant form of the Dynamin 2 protein fused with Green Fluorescent Protein (GFP). Dynamin 2 is a GTPase involved in membrane remodeling processes. The K44A mutation renders the Dynamin 2 protein catalytically inactive.

Anti caveolin 1 by Cell Signaling Technology

Sourced in United States, China

Anti-caveolin-1 is a primary antibody that recognizes the caveolin-1 protein. Caveolin-1 is a structural component of caveolae, which are invaginations of the plasma membrane that play a role in various cellular processes.

What are the different variations or types of Dynamin 2?

Dynamin 2 is a single gene that encodes a large GTPase protein. However, there can be different isoforms or splice variants of Dynamin 2 that may have slightly different structures or functions. Researchers have identified multiple Dynamin 2 isoforms that can be expressed in different cell types or have specialized roles in cellular processes like endocytosis or membrane dynamics.

What are some of the key applications of Dynamin 2 research?

Dynamin 2 plays a crucial role in various cellular processes, making it an important target for research in several disease areas. Some key applications of Dynamin 2 research include studying its involvement in neurodegenerative disorders like Charcot-Marie-Tooth neuropathy, as well as its role in muscle wasting conditions like centronuclear myopathy. Researchers also investigate Dynamin 2's function in regulating membrane trafficking and vesicle formation, which can provide insights into cell biology and signaling pathways.

What are common usage challenges in working with Dynamin 2?

One of the main challenges in Dynamin 2 research is the complexity of its cellular functions and the need to use specialized techniques to study its role in different biological processes. Researchers may need to utilize advanced microscopy, biochemical assays, or genetic manipulation methods to properly investigate Dynamin 2 activity and its effects. Additionally, since Dynamin 2 is essential for normal cell function, its complete knockout can be lethal, requiring the use of conditional or inducible knockdown models to study its effects.

How can PubCompare.ai assist with Dynamin 2 research?

PubCompare.ai can be a valuable tool for Dynamin 2 researchers in several ways. First, its advanced search capabilities can help you quickly identify the most relevant protocols and studies related to Dynamin 2 from the literature, pre-prints, and patents. This can save time and effeciently screen a large volume of information. Secondly, the platfrom's AI-powered analysis can highlight critical insights, such as the relative effectiveness of different Dynamin 2 research protocols or the key differences between various experimental approaches. This can help you select the most optimal protocols to ensure reproducibility and accuracy in your Dynamin 2 investigations. Overall, PubCompare.ai can be a powerful ally in optimizing your Dynamin 2 research program.

More about "Dynamin 2"

Dynamin 2 (DNM2) is a critical protein involved in membrane trafficking and vesicle formation.
As a large GTPase, it plays a pivotal role in the scission of clathrin-coated pits during endocytosis, as well as in the regulation of other dynamic membrane processes.
Dynamin 2 is expressed ubiquitously and is essential for normal cellular function.
Mutations in the DNM2 gene have been linked to several human diseases, including Charcot-Marie-Tooth neuropathy and centronuclear myopathy.
Researchers studying Dynamin 2 can utilize PubCompare.ai, a leading AI-driven platform, to quickly locate the best research protocols from literature, pre-prints, and patents, and optimize their Dynamin 2 investigations with cutting-edge technology.
When studying Dynamin 2, researchers may also utilize Lipofectamine RNAiMAX, a transfection reagent used for efficient delivery of small interfering RNAs (siRNAs) to knockdown Dynamin 2 expression.
Additionally, Ab3457, a specific antibody against Dynamin 2, can be used for immunodetection and localization studies.
Dynamin 2 interacts with other key proteins, such as Caveolin-1, which is involved in caveolae-mediated endocytosis.
The GFP-Dynamin 2-K44A plasmid is a common tool used to overexpress a dominant-negative mutant of Dynamin 2, helping researchers investigate its role in various cellular processes.
Researchers may also employ Lipofectamine 2000 for the transfection of Dynamin 2-related plasmids, Phalloidin-TRITC to visualize actin filaments, and Dynasore, a small-molecule inhibitor of Dynamin, to study the functional consequences of Dynamin 2 disruption.
Additionally, the use of Complete protease inhibitor cocktail can help preserve the integrity of Dynamin 2 and other proteins during experimental procedures.
By leveraging the insights gained from the MeSH term description and the capabilities of PubCompare.ai, researchers can optimize their Dynamin 2 investigations and uncover new discoveries in this important area of cell biology and disease research.