Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > Endoglin

Endoglin

Endoglin is a transmembrane glycoprotein that acts as an accessory receptor for transforming growth factor-beta.
It is expressed on endothelial cells and plays a crucial role in angiogenesis and vascular development.
Endoglin has been implicated in various cardiovascular and fibrotic diseases, as well as in cancer progression and metastasis.
Understanding the biology and regulation of endoglin is essential for developing targeted therapies and improving diagnostic and prognostic tools.
PubCompare.ai can help optimize your endoglin research by providing access to the most reliable protocols from literature, preprints, and patents, while offering insightful comparisons to identify the best approaches and products.
This can enhance the reproducibility and accuaracy of your endoglin studies, ultimately advancing our knowledge and treatment of related diseases.

Most cited protocols related to «Endoglin»

1
Genotyping Transgenic Mouse Alleles
Cited 7 times
Ear biopsy (or sperm from mosaic males, taken directly from the uterus of a euthenased female on the day following coitus) was used to prepare genomic DNA as previously described (Arthur et al., 2000 (link)). Mouse genotypes were determined by PCR analysis using primers w and x above, Cre primers Cre-F (GATCGCTGCCAGGATATACG) and Cre-R (AATCGCCATCTTCCAGCAG) which gives a PCR product of 574 bp when a Cre transgene is present; Primer-y (GGTCAGCCAGTCTAGCCAAG) and primer-z (GTGGTTGCCATTCAAGTGTG) amplify products of 411 bp for the wild type allele and 566 bp for the bi-floxed Endoglin allele. PCR using primer-x with primer-y gives a product of 602 bp only in the presence of the EngΔex5-6 allele, and no detectable PCR product is amplified from a wild-type allele.
Allinson K.R., Carvalho R.L., van den Brink S., Mummery C.L, & Arthur H.M. (2007). Generation of a Floxed Allele of the Mouse Endoglin Gene. Genesis (New York, N.Y. : 2000), 45(6), 391-395.
Publication 2007
A 602 Alleles Biopsy Coitus Endoglin Females Genome Genotype Males Mice, Laboratory Oligonucleotide Primers Sperm Transgenes Uterus
2
Isolation and Culture of Lung Endothelial Cells
Cited 6 times
Mice were euthanized and 0.8 ml of dispase (1 mg/ml; Invitrogen, Paisley, UK) was instilled intratracheally, after which lungs were excised, finely minced, and digested with dispase at 37°C for 45 min. Samples were then triturated by pipetting and filtered through a 40-μm sieve (BD Biosciences, Oxford, UK), to produce a lung single-cell suspension. Lung endothelial cells (LEC) were obtained by a two-step magnetic affinity cell-sorting procedure (Miltenyi Biotech, Surrey, UK), comprising of a first step of leukocyte depletion using biotinylated anti-CD45 MAb (eBioscience, Hatfield, UK) followed by LEC enrichment with biotinylated anti-CD31 (PECAM-1) MAb (eBioscience). Purified LEC (CD31+, CD45−) were cultured in gelatin-coated flasks in DMEM with 10% FCS, 12 U/ml heparin, 25 mM HEPES, 75 μg/ml endothelial cell growth supplement (Sigma, Poole, UK), 1% sodium pyruvate, 1% nonessential amino acids, and penicillin-streptomycin, passaged with trypsin-EDTA, and used for experiments between passages 3 and 10. The phenotype of cultured cells was determined by flow cytometry on the basis of staining for CD31 and other surface markers constitutively expressed on endothelial cells including: VE-cadherin, ICAM-1, ICAM-2, endoglin, and CD34, as well as expression of inducible markers VCAM-1 and E-selectin.
O'Dea K.P., Dokpesi J.O., Tatham K.C., Wilson M.R, & Takata M. (2011). Regulation of monocyte subset proinflammatory responses within the lung microvasculature by the p38 MAPK/MK2 pathway. American Journal of Physiology - Lung Cellular and Molecular Physiology, 301(5), L812-L821.
Publication 2011
Amino Acids cadherin 5 CD31 Antigens Cells Cultured Cells Dietary Supplements dispase Edetic Acid Endoglin Endothelial Cells Flow Cytometry Gelatins Heparin HEPES Intercellular Adhesion Molecule-1 Intercellular Adhesion Molecules Leukocytes Lung Mus Penicillins Phenotype Pyruvate SELE protein, human Sodium Streptomycin Trypsin Vascular Cell Adhesion Molecule-1
3
Immunofluorescence Staining of Stem Cells
Cited 5 times
Immunofluorescence staining was performed as described [33 (link), 83 (link), 84 (link)]. Briefly, exponentially growing cells were fixed with 4% paraformaldehyde (PFA) for 10 min, washed with PBS and permeabilized with 1% NP-40 for 10min at room temperature. After being blocked with 10% donkey serum (Jackson Immuno-Research Laboratories, West Grove, PA) for 1h at room temperature, cells were incubated with various primary antibodies, including CD29, CD73, BMPRII, CD90, CD117/c-kit, CD105/endoglin, or BMPR-II antibody (all from Santa Cruz Biotechnology) for 1h at room temperature. Cells were washed with PBS and incubated with FITC-labeled secondary antibodies (Jackson ImmunoResearch Laboratories) for 30 min. DAPI (Invitrogen) was used to visualize nuclei. Stains were examined under a fluorescence microscope. Negative control cells were performed under the same conditions without primary antibodies. Representative images from at least three independent staining experiments are shown.
Hu X., Li L., Yu X., Zhang R., Yan S., Zeng Z., Shu Y., Zhao C., Wu X., Lei J., Li Y., Zhang W., Yang C., Wu K., Wu Y., An L., Huang S., Ji X., Gong C., Yuan C., Zhang L., Liu W., Huang B., Feng Y., Zhang B., Haydon R.C., Luu H.H., Reid R.R., Lee M.J., Wolf J.M., Yu Z, & He T.C. (2017). CRISPR/Cas9-mediated reversibly immortalized mouse bone marrow stromal stem cells (BMSCs) retain multipotent features of mesenchymal stem cells (MSCs). Oncotarget, 8(67), 111847-111865.
Full text: Click here
Publication 2017
Antibodies BMPR2 protein, human Cell Nucleus Cells DAPI Endoglin Equus asinus Fluorescein-5-isothiocyanate Fluorescent Antibody Technique Immunoglobulins Microscopy, Fluorescence Nonidet P-40 NT5E protein, human paraform Serum Thy-1 Antigens
4
Endothelial Cell Maintenance and Knockout
Cited 5 times
βTC-3 and LLC-RFP cells (a gift from V. Mittal, Weill Cornell Medical College, New York, NY) were maintained in RPMI and DMEM (Invitrogen), respectively, supplemented with 10% FCS. EO771 cells (a gift from R. Ray, Saint Louis University School of Medicine, St. Louis, MO) were cultured in DMEM low glucose supplemented with 20% FCS. MS1 and bEND3.1 cells were cultured in Endothelial Cell Basal Medium MV2 kit (PromoCell). Primary endothelial cells from EngiKOe mice carrying the Immortomouse transgene were isolated from the lung (MLEC) and propagated in endothelial cell medium containing 20 U/ml recombinant mouse interferon-γ (PeproTech) at 33°C. All experiments using MLEC were performed at 37°C. Induction of knockout of the endoglin gene was achieved by growing MLEC in endothelial cell medium containing 1 µM 4-OH-tamoxifen (Sigma-Aldrich) for 48 h. Expression of endoglin, Twist, and CD31 was stably knocked down in endothelial cells by lentivirally transduced shRNA-containing vectors (Santa Cruz Biotechnology, Inc.).
Anderberg C., Cunha S.I., Zhai Z., Cortez E., Pardali E., Johnson J.R., Franco M., Páez-Ribes M., Cordiner R., Fuxe J., Johansson B.R., Goumans M.J., Casanovas O., ten Dijke P., Arthur H.M, & Pietras K. (2013). Deficiency for endoglin in tumor vasculature weakens the endothelial barrier to metastatic dissemination. The Journal of Experimental Medicine, 210(3), 563-579.
Publication 2013
BEND3 protein, human Cells Cloning Vectors Endoglin Endothelial Cells Glucose IFNG protein, mouse Induction, Genetic Lung Mus Short Hairpin RNA Tamoxifen Transgenes
5
Generation of Floxed Endoglin Mouse ES Cells
Cited 5 times
Mouse E14 (129/ola) ES cells were electroporated with linearised targeting vector and selected in G418-containing medium. The genotypes of G418-resistant ES clones were first analyzed by PCR using the following primers (all DNA sequences are written in the 5′ to 3′ direction and approximate locations are illustrated in the Figures). Primer-u (ATGTGGCAGGTCTCAAGGTG) and Primer-v (ATCGCCTTCTATCGCCTTC) amplify a 1.8 kb product specific to the targeted recombinant allele, whilst primer-w (GACGCCATTCTCATCCTGC) and primer-x (CCACGCCTTTGTCCTTGC) amplify products of 430 bp from the wild type Endoglin allele and 500 bp from the floxed Endoglin allele. Amplification was performed for 35 cycles with 15 s at 96°C, 30 s at 58°C, and 60 s at 74°C. Further Southern blot analysis used 3′ and 5′ external probes to hybridize to EcoRI digested genomic DNA, as previously described (Arthur et al., 2000 (link)). Ultimately two of 40 (5%) G418-resistant ES clones were found to be homologous recombinants and microinjected into C57BL/6 blastocysts. The resulting chimeras were bred to C57BL/6 females, and germline transmission of the floxed Endoglin allele was obtained.
Allinson K.R., Carvalho R.L., van den Brink S., Mummery C.L, & Arthur H.M. (2007). Generation of a Floxed Allele of the Mouse Endoglin Gene. Genesis (New York, N.Y. : 2000), 45(6), 391-395.
Publication 2007
Alleles antibiotic G 418 Blastocyst Chimera Clone Cells Cloning Vectors Deoxyribonuclease EcoRI DNA Sequence Embryonic Stem Cells Endoglin Females Genome Genotype Germ Line Mus Oligonucleotide Primers Southern Blotting Transmission, Communicable Disease

Most recents protocols related to «Endoglin»

1
Immunofluorescence Staining of Cryosections
Sections were stained with the primary antibodies: anti-human CD105 (endoglin, ENG) biotin-conjugated (1:100, BioLegend, 323214), anti-human CD31-Alexa Fluor 594 conjugated (1:400, BioLegend, 303126), and rabbit anti‐laminin for two hours at room temperature. After PBST washing, the slides were incubated with streptavidin-Alexa Fluor 647 conjugated (1:500, Life Technologies, S21374) and goat anti‐rabbit Alexa Fluor 750-conjugated for an hour. After final PSBT washing, nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (0.5 μg/mL, Sigma-Aldrich) and were mounted with ProLong Gold antifade reagent. Cryosections were imaged with Axio Scan.Z1 slide scanner.
Abbassi-Daloii T., el Abdellaoui S., Voortman L.M., Veeger T.T., Cats D., Mei H., Meuffels D.E., van Arkel E., 't Hoen P.A., Kan H.E, & Raz V. (2023). A transcriptome atlas of leg muscles from healthy human volunteers reveals molecular and cellular signatures associated with muscle location. eLife, 12, e80500.
Full text: Click here
Publication 2023
Alexa594 Alexa Fluor 647 Alexa Fluor 750 Antibodies Biotin Cell Nucleus Cryoultramicrotomy Endoglin Goat Gold Homo sapiens Laminin Rabbits Radionuclide Imaging Streptavidin
2
Cytokine Profiling for Vascular Remodeling
All serum samples, just after centrifugation at 3000 rpm for 10 min, and all CSF samples were immediately stored at − 80 °C until cytokine analysis, other than IL-6. The serum and CSF IL-6 levels were measured on a single detection immediately after centrifugation at room temperature using the electrochemiluminescence immunoassay according to the manufacturer’s instruction (Roche Diagnostics K.K., Tokyo, Japan). The serum cytokine concentrations relevant to the blood vessel regeneration were measured using the MILLIPLEX® (Merck Millipore, Darmstadt, Germany) human angiogenesis/growth factor magnetic bead panel 1 with a single detection, according to the manufacturer's instruction. Fluorescence intensity from the immunoassay was acquired and analyzed using xPONENT 4.2 Software (Luminex Corporation, Austin, TX, USA). The measured cytokines relevant to the vascular remodeling included epidermal growth factor, angiopoietin 2, granulocyte-colony stimulating factor (G-CSF), bone morphogenetic protein-9 (BMP-9), endoglin, leptin, hepatocyte growth factor (HGF), placental growth factor, vascular endothelial growth factor (VEGF)-C, VEGF-D, fibroblast growth factor-2 (FGF-2), and VEGF-A. Values under the dynamic range were replaced by half of the lower sensitivity limit.
Masuda H., Mori M., Uzawa A., Uchida T., Muto M., Ohtani R., Aoki R, & Kuwabara S. (2023). Elevated serum levels of bone morphogenetic protein-9 are associated with better outcome in AQP4-IgG seropositive NMOSD. Scientific Reports, 13, 3538.
Full text: Click here
Publication 2023
Angiogenesis Factor Angiopoietin-2 austin Blood Vessel Centrifugation Cytokine Diagnosis Endoglin Epidermal growth factor Fibroblast Growth Factor 2 Fluorescence Granulocyte Colony-Stimulating Factor Growth Differentiation Factor 2 Growth Factor, Placenta Hepatocyte Growth Factor Homo sapiens Hypersensitivity Immunoassay Leptin Regeneration Serum Vascular Endothelial Growth Factor D VEGFC protein, human VEGF protein, human
3
Quantifying Gene Expression in Ulcerative Colitis
Total RNA was extracted from biopsy specimens of UC patients and murine colorectal tissue using RNeasy Mini kit (Qiagen, Hilden, Germany). TaqMan real-time PCR was performed as previously described37 (link). All gene expression was normalized to 18S ribosomal RNA. The following primer sets (Thermo Fisher Scientific, Waltham, MA) were used: human urokinase-type plasminogen activator (PLAU/uPA, Hs01547054_m1), matrix metalloproteinase-8 (MMP-8, Hs01029057_m1), plasminogen (PLG, Hs00264877_m1), hepatocyte growth factor (HGF, Hs00300159_m1), endoglin (ENG, Hs00923996_m1), 18S (Hs99999901_s1), urokinase-type plasminogen activator receptor (PLAUR, Hs00959822_m1), murine urokinase-type plasminogen activator (Plau/uPA, Mm00447054_m1), urokinase-type plasminogen activator receptor (Plaur, Mm00440913_m1), RANTES (Ccl5, Mm01302427_m1), and Rn18s (Mm03928990_g1).
Kida Y., Okahisa T., Sato Y., Bando M., Fujimoto S., Ma B., Nakagawa T., Kawaguchi T., Nakamura F., Okamoto K., Miyamoto H., Sogabe M., Tsuneyama K, & Takayama T. (2023). Urokinase-type plasminogen activator blockade ameliorates experimental colitis in mice. Scientific Reports, 13, 2899.
Full text: Click here
Publication 2023
Biopsy CCL5 protein, human Endoglin Gene Expression Hepatocyte Growth Factor Homo sapiens Mus Neutrophil Collagenase Oligonucleotide Primers Patients Plasminogen PLAU protein, human PLAUR protein, human Real-Time Polymerase Chain Reaction RNA, Ribosomal, 18S Tissues
4
Isolation and Characterization of Tumor-Associated Fibroblasts from Colorectal Cancer
CRC specimens were obtained from 20 patients (see Table S1) during therapeutic surgery at the Surgical Oncology Unit, IRCCS Ospedale Policlinico San Martino, Genoa, upon signed informed consent (Institutional and Regional Ethic Committee approval, PR163REG2014, renewed in 2017). This cohort of CRC patients was composed of newly-diagnosed patients without any kind of therapeutic treatment before surgery. Samples were anonymized as reported and referred in the paper with the year and serial number for brevity [33 (link)]; all these CRC-TAF have been used within the 8–9th culture passage.
Primary TAF lines were obtained by mincing CRC mucosa, enzyme digestion and debris removal by soft centrifugation as reported [35 (link)]; cell suspensions were then purified by density gradient centrifugation (Lympholyte, Cederlane, Burlington, ON, Canada) and seeded in culture wells for 36 h. Non-adherent cells were removed and adherent cells showing a fibroblast-like morphology were cultured for an additional 7 d in MEMalpha (Euroclone, Milan, Italy) supplemented with 10% foetal calf serum (FCS, Sigma Chemicals Co., St. Louis, MO, USA). At confluence, cell cultures were split and expanded as described [19 (link),31 (link)]. Phenotype for Intercellular Adhesion Molecule 1 (ICAM1), Fibroblast Activation Protein (FAP), Thy-1 Cell Surface Antigen (CD90), Endoglin (CD105), Epidermal Growth Factor Receptor (EGFR) and Epithelial Cell Adhesion Molecule (EPCAM) markers were analyzed by indirect immunofluorescence at different time points, along a culture period of two months as described in Section 2.5. TAF were also tested for the expression of BTN3A1 and BTN2A1.
Fernandez J.L., Benelli R., Costa D., Campioli A., Tavella S., Zocchi M.R, & Poggi A. (2023). Priming of Colorectal Tumor-Associated Fibroblasts with Zoledronic Acid Conjugated to the Anti-Epidermal Growth Factor Receptor Antibody Cetuximab Elicits Anti-Tumor Vδ2 T Lymphocytes. Cancers, 15(3), 610.
Full text: Click here
Publication 2023
Biological Markers Cell Culture Techniques Cells Centrifugation Centrifugation, Density Gradient Digestion Endoglin Enzymes Epidermal Growth Factor Receptor Epithelial Cells Ethics Committees Fibroblasts Indirect Immunofluorescence Intercellular Adhesion Molecule-1 Mucous Membrane Operative Surgical Procedures Patients Phenotype Proteins Surface Antigens Thy-1 Antigens
5
Quantifying Soluble Endoglin Levels
The concentration of hsEng present in mice and human plasma was determined using a Human Endoglin/CD105 Quantikine ELISA kit (DNDG00, R&D Systems, Minneapolis, MN, United States) according to the manufacturers’ instructions in duplicates. Transgenic mice express variable levels of human soluble endoglin (hsEng), so mice expressing plasma levels of hsEng above the 500 ng/mL threshold were selected. On the other hand, their wild-type (WT) littermates presented undetectable hsEng levels in plasma.
Plasma levels of mouse sEng (msEng) levels were determined by Mouse Endoglin/CD105 Quantikine (MNDG00, R&D Systems, Minneapolis, MN, United States) ELISA Kit, used according to the manufacturer’s instructions, in duplicates.
Cristina Igreja Sá I., Tripska K., Alaei Faradonbeh F., Hroch M., Lastuvkova H., Schreiberova J., Kacerovsky M., Pericacho M., Nachtigal P, & Micuda S. (2023). Labetalol and soluble endoglin aggravate bile acid retention in mice with ethinylestradiol-induced cholestasis. Frontiers in Pharmacology, 14, 1116422.
Full text: Click here
Publication 2023
Endoglin Enzyme-Linked Immunosorbent Assay Homo sapiens Mice, Laboratory Mice, Transgenic Plasma

Top products related to «Endoglin»

1
Facscalibur by BD
Sourced in United States, Germany, United Kingdom, China, Canada, Japan, Italy, France, Belgium, Switzerland, Singapore, Uruguay, Australia, Spain, Poland, India, Austria, Denmark, Netherlands, Jersey, Finland, Sweden
The FACSCalibur is a flow cytometry system designed for multi-parameter analysis of cells and other particles. It features a blue (488 nm) and a red (635 nm) laser for excitation of fluorescent dyes. The instrument is capable of detecting forward scatter, side scatter, and up to four fluorescent parameters simultaneously.
2
Cellquest software by BD
Sourced in United States, Germany, United Kingdom, Italy, Canada, China, Japan, Belgium, France, Spain, Switzerland, Poland, Uruguay, Denmark, Singapore
CellQuest software is a data acquisition and analysis software designed for flow cytometry applications. It provides tools for acquiring, processing, and analyzing flow cytometry data.
3
Lipofectamine 2000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
4
Human endoglin cd105 quantikine elisa kit by R&D Systems
Sourced in United States
The Human Endoglin/CD105 Quantikine ELISA kit is a quantitative sandwich enzyme immunoassay designed for the measurement of human endoglin/CD105 levels in cell culture supernates, serum, and plasma.
5
Endoglin by R&D Systems
Sourced in United Kingdom
Endoglin is a cell surface glycoprotein that functions as an accessory receptor for transforming growth factor-beta (TGF-β) superfamily ligands. It plays a role in angiogenesis and vascular development.
6
Facscalibur flow cytometer by BD
Sourced in United States, Germany, United Kingdom, China, Canada, Japan, Belgium, France, Spain, Italy, Australia, Finland, Poland, Switzerland, Cameroon, Uruguay, Denmark, Jersey, Moldova, Republic of, Singapore, India, Brazil
The FACSCalibur flow cytometer is a compact and versatile instrument designed for multiparameter analysis of cells and particles. It employs laser-based technology to rapidly measure and analyze the physical and fluorescent characteristics of cells or other particles as they flow in a fluid stream. The FACSCalibur can detect and quantify a wide range of cellular properties, making it a valuable tool for various applications in biology, immunology, and clinical research.
7
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
8
Rneasy mini kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway
The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.

More about "Endoglin"

Endoglin, also known as CD105, is a transmembrane glycoprotein that serves as an accessory receptor for transforming growth factor-beta (TGF-β).
It is primarily expressed on endothelial cells and plays a crucial role in angiogenesis, the process of new blood vessel formation, as well as vascular development.
The biology and regulation of endoglin have been implicated in various cardiovascular and fibrotic diseases, as well as in cancer progression and metastasis.
Understanding the functions of endoglin is essential for developing targeted therapies and improving diagnostic and prognostic tools for these conditions.
Researchers can utilize the FACSCalibur flow cytometer and CellQuest software to analyze and quantify the expression of endoglin on cell surfaces.
The Human Endoglin/CD105 Quantikine ELISA kit can also be used to measure soluble endoglin levels in biological samples.
To study the regulation and signaling of endoglin, researchers may employ transfection techniques using Lipofectamine 2000 to introduce endoglin-encoding plasmids or siRNAs into cells.
The RNeasy Mini Kit can be used to isolate and purify RNA for gene expression analysis of endoglin and related factors.
Optimizing endoglin research is crucial for advancing our understanding and treatment of endoglin-related diseases.
PubCompare.ai can assist researchers by providing access to the most reliable protocols from literature, preprints, and patents, while offering insightful comparisons to identify the best approaches and products.
This can enhance the reproducibility and accuracy of endoglin studies, ultimately leading to improved patient outcomes.