Enhanced green fluorescent protein

Oligonucleotides encoding P2A, T2A, E2A or F2A (refer to Fig. 1B for sequences) were purchased from
Bioneer (Daejeon, Korea), annealed and then individually cloned into
SphI/BglII sites of a pCS4+ plasmid (provided by Chang-Yeol Yeo).
Oligonucleotides used are as follows. P2A: 5′-CGGAAGCGGAGCTACTAACTTCAGC
CTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCTA-3′(forward) and 5′-GATCT
AGGTCCAGGGTTCTCCTCCACGTCTCCAGCCTGCTTCAGCAGGCTGAAGTTAGTAGCTCCGCTTCCGCATG-3′(reverse). T2A: 5′-CGGAAGC
GGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAAT
CCTGGACCTA-3′ (forward) and 5′-GATCTAGGTCCAGGATTCTCCTCGACGTC
ACCGCATGTTAGCAGACTTCCTCTGCCCTCTCCGCTTCCGCATG-3′(reverse). E2A: 5′-CGGAAGCGGACAGTGTACTAATTATGCTCTCTTGAAATTGGCT
GGAGATGTTGAGAGCAACCCTGGACCTA-3′ (forward) and
5′-GATCTAGGTCC
AGGGTTGCTCTCAACATCTCCAGCCAATTTCAAGAGAGCATAATTAGTACA
CTGTCCGCTTCCGCATG-3′ (reverse). F2A: 5′-CGGAAGCGGAGTGAAACAG
ACTTTGAATTTTGACCTTCTCAAGTTGGCGGGAGACGTGGAGTCCAAC
CCTGGACCTA-3′ (forward) and 5′-GATCTAGGTCCAGGGTTGGACTCCACGTCTCCCGCCAACTTGAGAAGGTCAAAATTCAAAGTCTGTTTCACTCCGCTTCC
GCATG-3′ (reverse). The resulting construct was termed
pCS4+-2A. NLS-EGFP and mCherry-CAAX were PCR-amplified and then ligated
into the ClaI/AflII and BglII/NheI sites of pCS4+-2A, respectively, to
produce pNLS-EGFP-2A-mCherry-CAAX. NLS and EGFP indicate the nuclear
localization sequence and enhanced green fluorescent protein, respectively. All
plasmids constructed were verified by digestion with restriction endonucleases
(NEB; MA, USA) and DNA sequencing (Macrogen; Daejeon, Korea).

Expression of EGFP was achieved by inoculating 500 mL of sterile LB medium containing 50 μg/mL of ampicillin with 5 mL of an overnight culture of E. coli BL21(DE3) + pET-6XHis/TEV/eGFP. Cells were grown to midlog phase (OD₆₀₀~0.6) at 30°C with shaking at 160 rpm and EGFP expression was induced through the addition of 0.5 mL of 1M isopropyl β-d-1-thiogalactopyranoside (IPTG) (Fisher Scientific). After an additional ~1.75 hr of growth post induction, ~250 mL aliquots of cells were pelleted by centrifugation at 5000 X g for 10 min at 4°C. Pellet weights were noted and cells were frozen at -80°C for at least 30 min. To ensure efficient lysis and eliminate nucleic acids that could interfere with protein binding, cell pellets were thawed at roomed temperature and subsequently resuspended in Complete Bacterial Protein Extraction Reagent (B-PER) (Thermo Scientific, Rockford, IL) containing Pierce Complete, mini, EDTA-free Protease inhibitor Cocktail (Thermo Scientific). B-PER was added at a rate of 4 mL per gram of pelleted cells and protease inhibitors at a rate of 1 tablet per 10 mL of B-PER as per the manufacturers’ instructions. An identical procedure was followed using E. coli BL21(DE3) for use as a control except ampicillin was not added to the LB.
Cell lysates (4–6 mL) were placed into 1 L glass media containers. The volume of the solution was brought up to 500 mL using 20 mM Tris-HCl; pH 7.5. Spinbars or SPPs coated with anti-8X His antibodies were warmed to room temperature, added to the appropriate cell lysate with the media containers being subsequently capped, and mixing occurred either at 350 rpms for 10 min on a Digital Magnetic Hotplate Stirrer Pro (spinbars) or by shaking the container at room temp for 10 min at 120 rpm (SPPs). To capture the SPPs for washing purposes, magnets were taped to the outside of the media container and the containers were laid down so that the magnets were positioned at the bottom of the media container. The media bottles then remained in this static position for 30 min to ensure maximum capture of the SPPs. After 30 min, the media bottles were gently rotated so that the magnetic strip was now positioned along the top of the container and the cell lysate was carefully dumped from the container. To remove any loosely bound material, SPPs were washed in 30 mL of 20 mM Tris-HCl; pH 7.5 using gentle circular agitation with the magnets firmly affixed to the media bottles. Media bottles were allowed to stand for 5 min without agitation to ensure capture of the SPPs and the wash solution was then dumped from the media bottle. Magnets were removed from the media bottles and 15 mL of 20 mM Tris-HCl; pH 7.5 was added to resuspend the SPPs. Bottles were swirled to help release the beads with all the solution subsequently passing through a MACS Large Cell Separation Column (Miltenyi Biotec, Germany) placed against a magnet using gravity flow to maximize SPP recovery. Upon removal of the MACS column from the magnet, plunging of the column was performed with 350 μL of 1X Tobacco Etch Virus (TEV) protease buffer (50 mM Tris, 0.5 mM EDTA, 1 mM DTT, pH 8.0).
To wash the spinbars, magnets were used to capture the spinbar against the lid of the media bottles to allow for transfer of the spinbars to a clean 50 mL conical tube containing 30 mL of 20 mM Tris-HCl; pH 7.5 wash solution. Spinbars were agitated for 2 min in the wash solution. They were subsequently transferred to a sterile NEST Scientific 3.5 mL polypropylene plate where they were covered with 350 μL of 1X TEV protease buffer. It is worth noting that spinbars were not touched throughout the duration of the experiment. All transfers were made by placing a magnet on the outside of a container’s lid, exploiting the magnetic forces for movements of the spinbars.