> Chemicals & Drugs > Amino Acid > Enterotoxins

Enterotoxins

Enterotoxins are potent toxins produced by certain bacteria that can cause severe gastrointestinal illness in humans and animals.
These toxins disrupt the normal function of the intestinal epithelium, leading to symptoms like diarrhea, vomiting, and abdominal pain.
Studying enterotoxins is crucial for understanding the mechanisms of foodborne illnesses and developing effective prevention and treatment strategies.
PubCompare.ai's AI-driven platform helps researchers optimize their research protocols for reproducibility and accuracy when investigating these important toxins.
The tool enables you to quickly locate and compare protocols from the literature, preprints, and patents, allowing you to identify the best approaches for your research and streamline your work to achieve more reliable results.

Most cited protocols related to «Enterotoxins»

Comprehensive Protein Interaction Database

Cited 37 times

In addition to the above data, SKEMPI 2.0 also provides data on the location of the mutated residues, the homology between interactions in the dataset, and processed PDB files, which can be easily parsed.
Residue location: Each mutated residue is classified according to the scheme proposed by Levy (2010) (link); residues at the interface are classified as support (mostly buried when unbound and entirely buried upon binding), core (mostly solvent exposed when unbound but buried upon binding) and rim (partly buried upon binding), while residues away from the binding site are classified as interior or surface. Solvent exposed surface area was calculated using CCP4 (Winn et al., 2011 (link)).
Processed PDB files: The PDB files for the interactions, as downloaded from the Protein Data Bank (Berman et al., 2000 (link)), often contain multiple copies of the interacting proteins in the unit cell or other chains irrelevant to the interaction. In one instance, the binding of dimeric myostatin to follistatin-like 3, the myostatin dimer must be created by tessellating the unit cell. Further, some PDB files contain features that are not readily parsed by some software, such as residue insertion codes or negative residue numbers. To help users we provide “cleaned” PDB files which contain only the chains of interest, renumbered from one, as well as waters and other molecules with a non-hydrogen atom within 5 Å of a non-hydrogen atom of any of the chains of interest. Consequently, each mutation is reported with both PDB numbering and renumbered.
Defining homologous interactions: Each entry also specifies which other entries are mutations to homologous interactions. Two interactions are deemed homologous if they have a shared binding partner or homologous binding partner and at least 70% of the corresponding interface residues are common to both interactions. We determine the homology between proteins using the GAP4 program (Huang and Brutlag, 2007 (link)), and define homologous proteins as those with a similarity score greater than 50 and at least 30% sequence identity. Interface residues are defined as those with a non-hydrogen atom within 10 Å of a non-hydrogen atom on the binding partner. Interactions falling within manually assigned clusters of homologous interactions are designated as pMHC/TCR, antibody/antigen or protease/inhibitor. While the names of these clusters have been chosen to reflect the predominant function of their constituent interactions, they reflect the homologies within the dataset and are not functional assignments. Thus, for instance, some nanobodies are classified as antibodies as they bind to the same site as cetuximab, 14.3.d is classified as TCR, even though it is only the β chain, and its binding partner, enterotoxin C3, is classified as a pMHC.

Jankauskaitė J., Jiménez-García B., Dapkūnas J., Fernández-Recio J, & Moal I.H. (2018). SKEMPI 2.0: an updated benchmark of changes in protein–protein binding energy, kinetics and thermodynamics upon mutation. Bioinformatics, 35(3), 462-469.

Publication 2018

Antibodies Antigens Binding Sites Cells Cetuximab Enterotoxins Follistatin GDF8 protein, human Hydrogen Hydrogen-5 Immunoglobulins Mutation Protease Inhibitors Proteins Solvents Staphylococcal Protein A VHH Immunoglobulin Fragments

Detection of Enteric Pathogens in Stool

Cited 14 times

A single, fresh, whole stool specimen was collected from cases and controls at enrollment for the recovery of potential enteropathogens. Various specific growth media were used for detecting the bacterial pathogens. Up to 3 colonies with the appearance of E. coli on MacConkey agar were selected from each sample and tested using multiplex polymerase chain reaction (PCR) for enterotoxigenic E coli (ETEC) (heat-labile [LT] and heat-stable [ST] enterotoxins), enteropathogenic E. coli (EPEC) (eae and bfpA), and EAEC (aaiC and aatA). Any colonies that were positive for either aaiC (chromosomally encoded) or aatA (encoded on the pAA plasmid) were considered EAEC for the purposes of this analysis.

Boisen N., Scheutz F., Rasko D.A., Redman J.C., Persson S., Simon J., Kotloff K.L., Levine M.M., Sow S., Tamboura B., Toure A., Malle D., Panchalingam S., Krogfelt K.A, & Nataro J.P. (2011). Genomic Characterization of Enteroaggregative Escherichia coli From Children in Mali. The Journal of Infectious Diseases, 205(3), 431-444.

Publication 2011

Agar Bacteria Culture Media Enteropathogenic Escherichia coli Enterotoxigenic Escherichia coli Enterotoxins Escherichia coli Feces Multiplex Polymerase Chain Reaction Pathogenicity Plasmids

Surveillance of Acute Diarrheal Diseases in India

Cited 13 times

The Infectious Diseases and Beliaghata General Hospital (ID&BGH), in Kolkata, a 770 bedded hospital, provides treatment for about 20,000 to 25,000 hospitalized patients with acute diarrhoea annually. In the present systematic active surveillance, every fifth patient with diarrhoea or dysentery without other associated illness on two randomly selected days of the week was enrolled as study subjects from cases admitted at the ID&BGH. This study was conducted between November 2007 and October 2009. The dehydration status of each diarrhoea case was classified as no, some or severe dehydration according to WHO guidelines. The clinical, demographic and laboratory data was checked manually and entered into pre-designed data entry proforma developed in visual basic with inbuilt entry validation checking facilitated programme in structure query language (SQL) server by dual entry method by trained data entry professionals. Data was randomly checked and matched to derive consistency and validity for analysis. The edited data was exported and a final analysis was performed using the SPSS.17.0 software (SPSS Inc., Chicago, IL, USA).
This study was approved by the duly constituted Institutional Ethics Committee (IEC). As per the recommendation of IEC, individual informed consent was obtained from each patient enrolled in this study and confidentiality was maintained. Faecal specimens were collected in McCartney bottles using sterile catheters or as rectal swabs in Cary Blair medium and were examined within 2 hrs for 24 enteric pathogens comprising bacterial, viral and parasitic pathogens using a combination of conventional, immunological and molecular methods (Fig. 6). PCR targeting ompW and toxR were performed for the species confirmation of V. cholerae and V. fluvialis, respectively [31 (link),32 (link)]. Confirmed strains of V. parahaemolyticus, Shigella spp and Salmonella spp were serotyped using commercially available antisera (Denka Seiken, Tokyo, Japan, BioRad, Marnes-la-Coquette, France). V. cholerae strains were serotyped using antisera prepared in NICED. Representative strains of V. cholerae O1 were examined by MAMA-PCR to determine the type of cholera toxin B subunit gene (ctxB) [33 (link)]. Three different lactose-fermenting colonies isolated from each sample were picked from MacConkey agar plate and included in the multiplex PCR assay for the detection of different DEC that include enterotoxigenic E. coli (ETEC, inclusive of both heat-labile and heat-stable enterotoxin producers), enteropathogenic E. coli (typical and atypical EPEC) and enteroaggregative E. coli (EAEC) [34 (link)]. Simplex PCR was also performed for the detection of enteroinvasive E. coli (EIEC) and Shiga toxin-producing E. coli (STEC) [35 (link),36 (link)].
Antimicrobial susceptibility testing was performed by disk diffusion (Kirby- Bauer method) using commercially available disks (Becton Dickinson Co., Sparks, MD, USA) with interpretation stipulated by the Clinical and Laboratory Standard Institute [37 ]. Two hundred and thirty representative (one third from the total number of strains) V. cholerae O1 strains covering all the months and all the Shigella strains were included in the testing. Rotavirus was detected by polyacrylamide gel electrophoresis and silver staining [38 (link)]. Norovirus [Group I and II (NVGI and NVGII)], Sapovirus and Astrovirus were detected by RT-PCR using random primers for reverse transcription and specific primers for polymerase chain reaction [24 (link),39 (link)]. Different viruses were detected according to the appropriate amplicon sizes observed in agarose gels stained with ethidium bromide. Adenovirus was detected by the commercially available RotaAdeno VIKIA kit (biomereux, France), which is a qualitative test-based on immunochromatography in lateral flow format [40 (link)]. For detection of enteric parasites, faecal samples were processed separately for microscopic and molecular analysis. For microscopic analysis, the samples were first concentrated using formalin ethyl acetate concentration method [41 ] and an aliquot of each sample was preserved in 10% formalin and stored at 4°C for subsequent use. Aliquots of fresh stool specimens were also preserved at -80°C for ELISA and PCR assays. All the faecal samples were screened using a highly sensitive antigen capture ELISA (Tech Lab, Blacksburg, USA) and PCR for the detection of Giardia lamblia, Cryptosporidium parvum and Entamoeba histolytica. Faecal samples were processed by microscopy using iodine wet mount staining and trichome staining procedure for Blastocystis hominis [42 ].
Using the surveillance data, an estimate of the total number of cases specific for each pathogen in two consecutive years was extrapolated. From the monthly enrolled cases, the isolation rate of different pathogens was calculated for that particular month. An estimate of total number of cases with particular pathogen for a particular month was then extrapolated by multiplying the total admitted cases with particular isolation rate of the pathogenic with an assumption that similar isolation rate would be among non-enrolled cases. In this way, pathogen-specific total number of yearly estimated cases was calculated.
The risk age group was also explored for predominant enteric pathogens such as V. cholerae O1, Rotavirus, shigellae and G. lamblia by Multinomial Logistic Regression (MLR) analysis [43 (link),44 (link)]. This analysis helps to determine the likelihood age of the patient associated with any enteric pathogen. The age groups were classified into 8 categories viz. <1 year, 1-2 years, >2-5 years, >5-14 years, >14-30 years, >30-45 years, >45-60 years and >60 years and were coded from 1 to 8, respectively. Infection caused by an enteric pathogen was coded as '1' for the pathogen present and '2' for its absence. The extreme values of the classified age group was fixed as a reference category.

Nair G.B., Ramamurthy T., Bhattacharya M.K., Krishnan T., Ganguly S., Saha D.R., Rajendran K., Manna B., Ghosh M., Okamoto K, & Takeda Y. (2010). Emerging trends in the etiology of enteric pathogens as evidenced from an active surveillance of hospitalized diarrhoeal patients in Kolkata, India. Gut Pathogens, 2, 4.

Full text: Click here

Publication 2010

Adenoviruses Agar Age Groups Antigens Astroviridae Bacteriophages Biological Assay Blastocystis hominis Catheters Choleragenoid Communicable Diseases Cryptosporidium parvum Dehydration Diarrhea Diffusion Dysentery Entamoeba histolytica Enteroaggregative Escherichia coli Enteroinvasive Escherichia coli Enteropathogenic Escherichia coli Enterotoxigenic Escherichia coli Enterotoxins Enzyme-Linked Immunosorbent Assay Escherichia coli Ethidium Bromide ethyl acetate Feces Formalin Gels Genes Giardia Giardia lamblia Immune Sera Immunochromatography Infection Institutional Ethics Committees Iodine isolation Lactose Microbicides Microscopy Multiplex Polymerase Chain Reaction Norovirus Oligonucleotide Primers Parasites Pathogenicity Patients Polyacrylamide Gel Electrophoresis Population at Risk Rectum Reverse Transcriptase Polymerase Chain Reaction Reverse Transcription Rotavirus Salmonella Sapovirus Sepharose Shiga-Toxigenic Escherichia coli Shiga Toxin Shigella Sterility, Reproductive Strains Susceptibility, Disease Trichomes Vibrio cholerae Virus

Multiplex PCR for Enteric Pathogens

Cited 8 times

DNA was extracted using a QIAmp DNA stool mini kit (QIAGEN, Hilden, Germany), following the manufacturer’s protocol. Extracts were thereafter stored at −20 °C. A part of the stool samples was preserved in 5% formalin to perform the microscopic analysis. PCR investigations were carried out on site. In addition, extracts and formalin samples were sent to the Bernhard–Nocht Institute for Tropical Medicine (BNITM, Hamburg, HH, Germany). During the BNITM microscopy, control examinations and further analysis were performed. Airfreight requirements were fulfilled, the cooling chain was not interrupted (based on the temperature control documentation), and transport was done by a specialized company (World Courier, Frankfurt, HE, Germany).
In-house real-time multiplex PCRs for protozoan and helminthic parasites targeting Entamoeba histolytica, Giardia intestinalis, Cryptosporidium spp., and Cyclospora cayetanensis, as well as Necator americanus, Strongyloides stercoralis, Ascaris lumbricoides, Ancylostoma spp., Trichuris trichiura, Schistosoma spp., Enterobius vermicularis, Taenia saginata, Taenia solium, and Hymenolepis nana were performed as described before [3 (link)]. Further, enteroinvasive bacterial pathogens like Campylobacter jejuni, Salmonella spp., Shigella ssp./enteroinvasive E. coli (EIEC), and Yersinia spp. were assessed by in-house real-time PCR [4 (link)]. To identify diarrheagenic E. coli infections, Rida Gene RT-PCR assays for enterohemorrhagic Escherichia coli (EHEC), enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC), enterotoxin-producing E. coli (ETEC), enteroinvasive E. coli (EIEC), and enteroaggregative E. coli (EAEC) (R-Biopharm AG, Darmstadt, HE, Germany) were used, as described before [5 (link)]. Furthermore, a species-specific PCR for Tropheryma whipplei [6 (link)] was applied [7 (link)]. The DNA of phocid herpesvirus was included as an internal control for the in-house PCRs [8 (link),9 (link)].
In all RT-PCRs runs, positive and negative controls were included: As positive controls, synthetically designed target sequences linked by EcoR1 endonuclease restriction sites and inserted into pEX-A128 vector backbones were used (Eurofins Scientific SE). Negative controls included PCT water samples that had undergone the whole nucleic acid extraction process to exclude sample contamination. All primers and probes of the in-house PCRs were purchased from Eurofins, Hamburg, HH, Germany. The assays were performed on a multi-channel RotorGene Q Cycler (Qiagen, Hilden, HE, Germany).
In addition, light microscopy of all stool samples by direct saline and/or iodine mounts and following a formol-ethyl acetate concentration was performed.

Kann S., Bruennert D., Hansen J., Mendoza G.A., Gonzalez J.J., Quintero C.L., Hanke M., Hagen R.M., Backhaus J, & Frickmann H. (2020). High Prevalence of Intestinal Pathogens in Indigenous in Colombia. Journal of Clinical Medicine, 9(9), 2786.

Full text: Click here

Publication 2020

Ancylostoma Ascaris lumbricoides Bacteria Biological Assay Campylobacter jejuni Cloning Vectors Cryptosporidium Cyclospora DNA Restriction Enzymes Entamoeba histolytica Enteroaggregative Escherichia coli Enterobius vermicularis Enterohemorrhagic Escherichia coli Enteroinvasive Escherichia coli Enteropathogenic Escherichia coli Enterotoxigenic Escherichia coli Enterotoxins Escherichia coli Escherichia coli Infections ethyl acetate Feces Formalin Formol Genes Giardia lamblia Helminths Iodine Light Microscopy Microscopy Necator americanus Nucleic Acids Oligonucleotide Primers Parasites Pathogenicity Physical Examination Polymerase Chain Reaction Real-Time Polymerase Chain Reaction Reverse Transcriptase Polymerase Chain Reaction saginata, Taenia Saline Solution Salmonella Schistosoma Scrapie Shigella Simplexvirus Strongyloides stercoralis Taenia solium Tapeworm, Dwarf Trichuris trichiuras Tropheryma whipplei Vertebral Column Yersinia

Growth and Toxin Production in Bacillus cereus

Cited 7 times

All B. cereus strains used in this study are listed in Table 1 and Supplemental Table S1. Strains were grown at 30°C on CGY plates or in CGY broth. Unless stated otherwise, 30 ml cultures were inoculated from 17 h pre-cultures, and were grown in 300 ml Erlenmeyer flasks with 125 rpm at 30°C. For determination of enterotoxin production and toxicity, all strains listed in Table S1 were routinely grown for 6 h in CGY medium, inoculated with an optical density at 600 nm (OD₆₀₀) of 0.2. For growth tests in this study, CGY medium was inoculated with a 17 h pre-culture to an OD₆₀₀ of 0.05 and OD₆₀₀ was recorded every 30 min. 5 milliliter (at 2 h) and 3 ml (at 6 h) samples were taken and centrifuged for 15 min at RT and 3500 rpm. Cell pellets were immediately frozen at −80°C and used for preparation of RNA and measurement of intracellular protein concentrations. Supernatants were filtered through 0.2 μm filters and separated for measurement of extracellular protein concentrations and enterotoxin production. For the latter, 1 mM EDTA was added to the culture supernatant. Supernatants were frozen and stored at −20°C. All growth tests and sample preparations were carried out in triplicates.

Jeßberger N., Krey V.M., Rademacher C., Böhm M.E., Mohr A.K., Ehling-Schulz M., Scherer S, & Märtlbauer E. (2015). From genome to toxicity: a combinatory approach highlights the complexity of enterotoxin production in Bacillus cereus. Frontiers in Microbiology, 6, 560.

Full text: Click here

Publication 2015

Cells Edetic Acid Enterotoxins Freezing Pellets, Drug Proteins Protoplasm Vision

Most recents protocols related to «Enterotoxins»

Rapid Diagnosis of C. difficile Infection

Stool samples or rectal swabs were obtained from each patient within 48 h of hospital admission. Toxigenic C. difficile carriers were identified with a real-time PCR assay, which simultaneously detects toxin A (TcdA enterotoxin, encoded by tcdA) and toxin B (TcdB cytotoxin, encoded by tcdB) (AdvanSure CD Real-Time PCR Kit; LG Life Science, Seoul, Korea). Enzyme-linked immunosorbent assay (ELISA) (C. DIFFICILE TOX A/B II, TECHLAB, USA) was used to evaluate the stool samples for toxin A and B production.

Lee K.B., Lee M., Suh J.W., Yang K.S., Chung Y., Kim J.Y., Kim S.B., Sohn J.W, & Yoon Y.K. (2023). Clinical prediction rule for identifying older patients with toxigenic clostridioides difficile at the time of hospital admission. BMC Geriatrics, 23, 127.

Full text: Click here

Publication 2023

Biological Assay cellulose acetate-butyrate Cytotoxin Enterotoxins Enzyme-Linked Immunosorbent Assay Feces Patients Real-Time Polymerase Chain Reaction Rectum Toxins, Biological trimethylaminocarboxyldihydroboran

Detecting Bacillus Enterotoxigenic Genes

DNA from B.subtilis isolates and B.cereus ATCC14579 as a positive control were extracted via the boiling method. In the next stage, PCR analyses were carried out to detect 6 enterotoxigenic genes. Table 6 show primer sequencers and PCR conditions^{58 (link)}.Table 6

Primer names and sequences, target size and PCR conditions for enterotoxin genes detection^{58 (link)}.

Primers	Target size (bp)	Sequences (5′–3′)	Reaction conditions
hblA F hblA R	1154	AAGCAATGGAATACAATGGG AGAATCTAAATCATGCCACTGC	94 °C,2 min/(94 °C,60 s56 °C,60 s72 °C,120 s)35cycles /72 °C,5 min
hblC F hblC R	740	GATACCAATGTGGCAACTGC TTGAGACTGCTCGCTAGTTG	94 °C,2 min/(94 °C,60 s58 °C,60 s72 °C,120 s)35cycles /72 °C,5 min
hblD F hblD R	829	ACCGGTAACACTATTCATGC GAGTCCATATGCTTAGATGC	94 °C,2 min/(94 °C,60 s58 °C,60 s72 °C,120 s)35cycles /72 °C,5 min
nheA F nheA R	499	TACGCTAAGGAGGGGCA GTTTTTATTGCTTCATCGGCT	94 °C,2 min /(94 °C,60 s56 °C,60 s72 °C,120 s)35cycles /72 °C,5 min
nheB F nheB R	769	CTATCAGCACTTATGGCAG ACTCCTAGCGGTGTTCC	94 °C,2 min/(94 °C,60 s54 °C,60 s72 °C,120 s)35cycles /72 °C,5 min
nheC F nheC R	581	CGGTAGTGATTGCTGGG CAGCATTCGTACTTGCCAA	94 °C,2 min/(94 °C,60 s58 °C,60 s72 °C,120 s)35cycles /72 °C,5 min

Daneshazari R., Rabbani Khorasgani M., Hosseini-Abari A, & Kim J.H. (2023). Bacillus subtilis isolates from camel milk as probiotic candidates. Scientific Reports, 13, 3387.

Full text: Click here

Publication 2023

Enterotoxins Genes Hereditary Diseases Oligonucleotide Primers

Detection of B. cereus Toxin Genes

For the detection of B. cereus toxin-encoding genes (Smase, sph; enterotoxin Bcet, bcet; enterotoxin FM, entFM; phosphatidylinositol-specific phospholipase; PI-PLC, plcA; cytotoxin K, cytK; NHEA, nheA; NHEB, nheB; and NHEC, nheC), PCR reactions were performed on bacterial genomic DNA. For each gene, primer pairs and amplification conditions were set as previously described [15 (link)].

Tirloni E., Bernardi C., Celandroni F., Mazzantini D., Massimino M., Stella S, & Ghelardi E. (2023). Prevalence, Virulence Potential, and Growth in Cheese of Bacillus cereus Strains Isolated from Fresh and Short-Ripened Cheeses Sold on the Italian Market. Microorganisms, 11(2), 521.

Full text: Click here

Publication 2023

Cytotoxin DNA, Bacterial Enterotoxins Genes Genome Oligonucleotide Primers Phosphatidylinositols Phospholipase Toxins, Biological

Staphylococcal Enterotoxin Detection in Cheese

A staphylococcal enterotoxins (SE) detection was performed in all cheese samples that presented Coagulase Positive Staphylococci levels ≥4.9 × 10⁴ cfu/g. For the detection of SE, ISO 19020:2017 [12 ] was followed. Briefly, 25 g of cheese (10% of the shell and 90% of the inner part) suspended in 40 mL of distilled water at 38 °C ± 2 °C were homogenized in a stomacher, for 1 min and then shaken in an VXR basic Vibrax orbital shaker (Ika^®, Staufen, Germany) at room temperature for 30 to 60 min to allow toxin diffusion. The pH of the slurry was adjusted between 3.5 and 4.0 with HCl and centrifuged at 3130× g for 15 min at 4 °C. The supernatant was collected and the pH adjusted to 7.5 ± 0.1 with NaOH and centrifuged again as described above. The supernatant was concentrated on a dialysis membrane with a molecular cut-off of 6000-8000 Da (Spectrum Laboratories, Rancho Dominguez, CA, USA) against 30% (w/v) of polyethylene glycol 20,000 (Merck, Darmstadt, Germany), overnight, at 4 °C. SE detection was performed using the alternative automated method VIDAS^® Staph enterotoxin II (SET 2) (bioMérieux).

Praça J., Furtado R., Coelho A., Correia C.B., Borges V., Gomes J.P., Pista A, & Batista R. (2023). Listeria monocytogenes, Escherichia coli and Coagulase Positive Staphylococci in Cured Raw Milk Cheese from Alentejo Region, Portugal. Microorganisms, 11(2), 322.

Full text: Click here

Publication 2023

Cheese Coagulase Dialysis Diffusion Enterotoxins Polyethylene Glycols Staphylococcal Enterotoxins Staphylococcal Infections Staphylococcus Tissue, Membrane Toxins, Biological

Multiplex PCR Assay for Virulence Genes

The presence of eight specific VAGs (papC, iucD, irp2, tsh, vat, astA, iss, and cva/cvi) was tested by a multiplex PCR [9 (link)]. The virulence-associated genes encode P-fimbria associated with adhesion [16 (link)], iron acquisition systems (iucD and irp2) [24 (link),25 (link)], and the temperature-sensitive autotransporter protein associated with high virulence [26 (link)]. The vat gene encodes a cytotoxic vacuolating autotransporter protein [27 (link)] the enteroaggregative heat-stable enterotoxin (astA) [28 (link)] a protein for increased serum survival (iss) [29 (link)] and the plasmid-borne genes cva/cvi which cause disruption of the membrane of sensitive cells [30 (link)]. E. coli isolated from MacConkey without any antimicrobials was used (Oxoid, CM0007). In brief, DNA was extracted by using a Maxwell^® RSC Instrument and Cultured Cells DNA kits (AS1620, Maxwell, Nacka, Sweden), as recommended by the manufacturer. PCR running conditions [9 (link)] were followed, except that agarose gels were run for 80 min at 75 V. A GeneRuler 100 bp plus DNA ladder (Thermo Scientific, SM0323, Vilnius, Lithuania) was used as a size marker on each gel.

Poulsen L.L., Bisgaard M, & Christensen H. (2023). Prevalence of Potential Pathogenic and Antimicrobial Resistant Escherichia coli in Danish Broilers. Antibiotics, 12(2), 344.

Full text: Click here

Publication 2023

Autotransporters Bacterial Fimbria Cultured Cells Enterotoxins Escherichia coli Genes Intrauterine Devices Iron Microbicides Multiplex Polymerase Chain Reaction Plasma Membrane Plasmids Proteins Sepharose Serum Serum Proteins Vagina Virulence

Top products related to «Enterotoxins»

Ethidium bromide by Merck Group

Sourced in United States, Germany, United Kingdom, India, Poland, Japan, Italy, China, Switzerland, Sao Tome and Principe, Spain, Canada, France, Brazil, Angola, Macao, Slovakia, Saudi Arabia

Ethidium bromide is a fluorescent dye commonly used in molecular biology laboratories. It is used to visualize and detect the presence of nucleic acids, such as DNA and RNA, in agarose gel electrophoresis.

Cytofix cytoperm by BD

Sourced in United States, Germany, United Kingdom, France, Canada, Belgium, Australia

Cytofix/Cytoperm is a fixation and permeabilization solution developed by BD for use in flow cytometry and immunohistochemistry applications. It is designed to facilitate the intracellular staining of proteins and other cellular components while preserving cellular structure and antigenicity.

Golgiplug by BD

Sourced in United States, United Kingdom, Germany, France, Macao, Switzerland, Canada, Belgium, Australia, China, Denmark

GolgiPlug is a laboratory product designed to inhibit protein transport from the Golgi apparatus to the cell surface. It functions by blocking the secretory pathway, preventing the release of proteins from the Golgi complex. GolgiPlug is intended for use in cell biology research applications.

Roswell park memorial institute (rpmi) by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, Italy, Canada, France, Switzerland, Australia, India, Spain, China, Belgium, Ireland, Netherlands, Austria, Macao, Japan, Hong Kong

RPMI is a type of cell culture medium that is widely used in biological research and cell-based assays. It provides a balanced salt solution and essential nutrients to support the growth and maintenance of a variety of cell types, including human and animal cells, in vitro.

Streptomycin by BioConcept

Sourced in Switzerland

Streptomycin is a broad-spectrum antibiotic used to treat various bacterial infections. It is a product of the bacterium Streptomyces griseus and functions by inhibiting protein synthesis in susceptible microorganisms.

Qiaamp dna mini kit by Qiagen

Sourced in Germany, United States, France, United Kingdom, Netherlands, Spain, Japan, China, Italy, Canada, Switzerland, Australia, Sweden, India, Belgium, Brazil, Denmark

The QIAamp DNA Mini Kit is a laboratory equipment product designed for the purification of genomic DNA from a variety of sample types. It utilizes a silica-membrane-based technology to efficiently capture and purify DNA, which can then be used for various downstream applications.

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

Ridascreen set total by R-Biopharm

Sourced in France

The RIDASCREEN® SET Total is a quantitative enzyme-linked immunosorbent assay (ELISA) for the determination of staphylococcal enterotoxins A, B, C, D, and E in food samples. The test kit provides a reliable and standardized method for the detection of these toxins.

Duopath cereus enterotoxins by Merck Group

Sourced in Germany

Duopath Cereus Enterotoxins is a lab equipment product manufactured by Merck Group. It is designed to detect and identify Bacillus cereus enterotoxins. The product provides a reliable and efficient method for analyzing the presence of these toxins in various samples.

Penicillin by BioConcept

Sourced in Switzerland

Penicillin is a type of antibiotic laboratory equipment used for the production and purification of the penicillin drug. It is a critical component in the pharmaceutical manufacturing process.

What are the key features of enterotoxins?

Enterotoxins are potent toxins produced by certain bacteria, such as Staphylococcus aureus and Bacillus cereus. These toxins disrupt the normal function of the intestinal epithelium, leading to severe gastrointestinal symptoms like diarrhea, vomiting, and abdominal pain in humans and animals. Studying enterotoxins is crucial for understanding the mechanisms of foodborne illnesses and developing effective prevention and treatment strategies.

How can PubCompare.ai help researchers investigating enterotoxins?

PubCompare.ai's AI-driven platform can assist researchers studying enterotoxins in several ways. The tool allows you to screen protocol literature more efficiently, leveraging AI to pinpoint critical insights. By helping researchers identify the most effective protocols related to enterotoxins for their specific research goals, the platform's analysis can highlight key differences in protocol effectiveness, enabling you to choose the best option for reproducibility and accuracy.

What are some common challenges in working with enterotoxins?

One of the main challenges in working with enterotoxins is ensuring the reproducibility and accuracy of research protocols. Enterotoxins can be complex to study, and small variations in experimental conditions can lead to inconsistent results. Researchers must carefully optimize their protocols to obtain reliable data that can inform effective prevention and treatment strategies for enterotoxin-related illnesses.

Are there different types or variations of enterotoxins?

Yes, there are several different types and variations of enterotoxins. The most well-known are the Staphylococcal enterotoxins (SEs), which are produced by Staphylococcus aureus bacteria. There are also enterotoxins produced by other bacteria, such as Bacillus cereus, which can cause a distinct set of gastrointestinal symptoms. Understanding the unique properties and mechanisms of these different enterotoxin types is crucial for developing targeted interventions.

What are some specific applications of enterotoxin research?

Enterotoxin research has a range of important applications, including: 1) Improving food safety by identifying sources of enterotoxin contamination and developing more effective decontamination methods. 2) Enhancing the development of vaccines and therapeutics to prevent and treat enterotoxin-related illnesses. 3) Advancing our understanding of the pathogenic mechanisms of enterotoxins, which can inform the design of novel interventions. 4) Leveraging enterotoxin properties for potential biotechnological applications, such as in the development of novel biosensors.

More about "Enterotoxins"

Enterotoxins are powerful toxins produced by certain bacteria that can cause severe gastrointestinal illness in humans and animals.
These toxins disrupt the normal function of the intestinal epithelium, leading to distressing symptoms like diarrhea, vomiting, and abdominal pain.
Studying enterotoxins is crucial for understanding the mechanisms of foodborne illnesses and developing effective prevention and treatment strategies.
PubCompare.ai's AI-driven platform can help researchers optimize their research protocols for reproducibility and accuracy when investigating these important toxins.
The tool enables you to quickly locate and compare protocols from the literature, preprints, and patents, allowing you to identify the best approaches for your research and streamline your work to achieve more reliable results.
In addition to enterotoxins, researchers may also encounter related terms and concepts, such as Ethidium bromide (a DNA-binding dye used in molecular biology), Cytofix/Cytoperm (a fixation and permeabilization solution for flow cytometry), GolgiPlug (a protein transport inhibitor), RPMI (a commonly used cell culture medium), Streptomycin (an antibiotic), QIAamp DNA Mini Kit (a DNA extraction kit), FBS (Fetal Bovine Serum, a common cell culture supplement), RIDASCREEN® SET Total (a commercial kit for detecting enterotoxins), Duopath Cereus Enterotoxins (a rapid test for detecting Bacillus cereus enterotoxins), and Penicillin (an antibiotic commonly used in cell culture).
Understanding these related terms and techniques can help researchers effectively investigate the complex topic of enterotoxins and their effects.