> Chemicals & Drugs > Amino Acid > EWSR1 protein, human

EWSR1 protein, human

EWSR1 protein is a fusion protein involved in several types of cancer, including Ewing sarcoma.
It is characterized by the presence of the Ewing sarcoma breakpoint region 1 (EWSR1) gene, which can fuse with other genes to form oncogenic fusion proteins.
Understanding the role of EWSR1 protein in disease pathogenesis is crucial for developing effective treatments.
Researchers can use PubCompare.ai's AI-powered protocol optimization to identify the most accurate and effective protocols from literature, preprints, and patents, advancing their EWSR1 protein research with confidence.

Most cited protocols related to «EWSR1 protein, human»

FISH Assay for Sarcoma Fusion Genes

Cited 50 times

FISH on interphase nuclei from paraffin embedded 4-micron sections was performed applying custom probes using bacterial artificial chromosomes (BAC), covering and flanking EWSR1 in 22q12, FUS in 16p11, PBX1 in 1q23, ZNF444 in 19q13 and POU5F1 in 6p21 (Fig. 1). BAC clones were chosen according to USCS genome browser (http://genome.uscs.edu). The BAC clones were obtained from BACPAC sources of Children's Hospital of Oakland Research Institute (CHORI) (Oakland, CA) (http://bacpac.chori.org). DNA from individual BACs was isolated according to the manufacturer’s instructions, labeled with different fluorochromes in a nick translation reaction, denatured, and hybridized to pretreated slides. Slides were then incubated, washed, and mounted with DAPI in an antifade solution, as previously described (Agaram et al., 2008 (link)). The genomic location of each BAC set was verified by hybridizing them to normal metaphase chromosomes. Two hundred successive nuclei were examined using a Zeiss fluorescence microscope (Zeiss Axioplan, Oberkochen, Germany), controlled by Isis 5 software (Metasystems). A positive score was interpreted when at least 20% of the nuclei showed a break-apart signal. Nuclei with incomplete set of signals were omitted from the score.
All cases were first tested with an EWSR1 probe. The EWSR1-rearranged tumors were then evaluated for break-apart signals using probes for PBX1, ZNF444, and POU5F1. The EWSR1 negative tumors were then tested for FUS break-apart, since FUS may substitute for the EWSR1 gene in certain translocation-associated sarcomas. In selective cases, two-color FISH was applied using probe-sets centromerically flanking one gene and telomerically flanking the partner gene, in order to confirm the fusion between EWSR1 and the partner genes. In one case a G-banded karyotype was obtained after short term culture.

Antonescu C.R., Zhang L., Chang N.E., Pawel B.R., Travis W., Katabi N., Edelman M., Rosenberg A.E., Nielsen G.P., Cin P.D, & Fletcher C.D. (2010). EWSR1-POU5F1 Fusion in Soft Tissue Myoepithelial Tumors. A Molecular Analysis of 66 Cases, Including Soft Tissue, Bone and Visceral Lesions, Showing Common Involvement of the EWSR1 gene. Genes, chromosomes & cancer, 49(12), 1114-1124.

Publication 2010

Bacterial Artificial Chromosomes Cell Nucleus Chromosomes Clone Cells DAPI EWSR1 protein, human Fishes Fluorescent Dyes Genes Genome Interphase Karyotyping Metaphase Microscopy, Fluorescence Neoplasms Paraffin pbx1 protein, human POU5F1 protein, human Sarcoma Translocation, Chromosomal

FISH Analysis of EWSR1 and Fusion Partners

Cited 14 times

Formalin-fixed paraffin-embedded tissues were available in each case for FISH analysis. FISH for EWSR1 was performed on all cases and followed by subsequent FISH for various fusion partners, including CREM, CREB1, and ATF1. FISH was performed on 4 μm-thick formalin-fixed paraffin-embedded (FFPE) tissue sections. Custom probes were made by bacterial artificial chromosomes (BAC) clones (Supplementary Table 2) flanking the target genes, according to UCSC genome browser (http://genome.ucsc.edu) and obtained from BACPAC sources of Children’s Hospital of Oakland Research Institute (Oakland, CA; http://bacpac.chori.org). DNA from each BACs was isolated according to the manufacturer’s instructions. The BAC clones were labeled with fluorochromes by nick translation and validated on normal metaphase chromosomes. The slides were deparaffinized, pretreated, and hybridized with denatured probes. After overnight incubation, the slides were washed, stained with DAPI, mounted with an antifade solution, and then examined on a Zeiss fluorescence microscope (Zeiss Axioplan, Oberkochen, Germany) controlled by Isis 5 software (Metasystems).

Kao Y.C., Sung Y.S., Zhang L., Chen C.L., Vaiyapuri S., Rosenblum M.K, & Antonescu C.R. (2017). EWSR1 fusions with CREB family transcription factors define a novel myxoid mesenchymal tumor with predilection for intracranial location. The American journal of surgical pathology, 41(4), 482-490.

Publication 2016

Bacterial Artificial Chromosomes Child Chromosomes Clone Cells DAPI EWSR1 protein, human Fishes Fluorescent Dyes Formalin Genes Genome Metaphase Microscopy, Fluorescence Paraffin Paraffin Embedding Tissues

Validation of MSK-Fusion Solid Panel

Cited 11 times

The validation of the MSK-Fusion Solid panel was performed according to NYS DOH standard requirements. The panel was fully approved by NYS DOH for use in our clinical laboratory. In brief, the accuracy study included 132 unique tumor RNA samples from formalin-fixed paraffin-embedded sections. These samples were previously profiled in our clinical laboratory and were confirmed to be positive for fusions by alternate methods. The assay called 99% of the expected fusions with high confidence. The reproducibility and precision studies included 8 samples positive for known fusions sequenced in triplicate within the same and across 3 separate runs; 100% of the expected calls were made. Finally, the analytical sensitivity of the assay was determined using 3 cell lines harboring 3 different fusions: A673 (EWSR1-FLI1), SYO1 (SS18-SSX2) and H3122 (EML4-ALK). Serial dilutions were prepared by mixing each positive sample with RNA from a normal sample previously characterized as fusion negative. The sensitivity results demonstrated that gene fusion detection sensitivity of the assay is at approximately 3% positive tumor RNA. This assay sensitivity should be viewed as an estimate, recognizing that it can also affected by differences in the expression levels of different fusions.

Zhu G., Benayed R., Ho C., Mullaney K., Sukhadia P., Rios K., Berry R., Rubin B.P., Nafa K., Wang L., Klimstra D.S., Ladanyi M, & Hameed M.R. (2018). Diagnosis of known sarcoma fusions and novel fusion partners by targeted RNA sequencing with identification of a recurrent ACTB-FOSB fusion in pseudomyogenic hemangioendothelioma. Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc, 32(5), 609-620.

Publication 2018

Biological Assay Cell Lines Clinical Laboratory Services EWSR1 protein, human Formalin Gene Fusion Hypersensitivity Paraffin Embedding RNA, Neoplasm Technique, Dilution

Whole-Genome Sequencing of Ewing Sarcoma

Cited 7 times

Our discovery cohort comprised 112 patients with Ewing sarcoma; both tumor and germline samples underwent whole-genome sequencing. All tumors selected for WGS were predicted to contain a large proportion of tumor cells based on pathology reports, previous CGH or SNP arrays, and/or a low Ct (cycle threshold) of EWSR1–ETS fusion assessed by RT-QPCR. Eighteen Ewing sarcomas were obtained from the St. Jude tissue resource core facility for genome sequence analysis with St Jude Institutional Review Board (IRB) approval for the Pediatric Cancer Genome Project (PCGP). The remaining cases were those referred to Institut Curie from all over France for molecular diagnosis of Ewing sarcoma. Samples were stored in a tumor bank at the Institut Curie. The genetic study was approved by the Institutional Review Board of the Institut Curie (Paris, France) and by the Comité de Protection de Personnes Ile-de-France I (regional ethics committee; GenEwing n° IC 2009-02); specific informed consent was provided. Most patients were treated according to the EuroEwing protocol (47 (link)). An anonymization procedure was performed before compilation of clinical, histologic, and biological information in a secure database with restricted access. All tumors included in this study were positive for the EWSR1–ETS fusion. Detailed clinicopathologic and sequencing information is provided in Fig. 1 and Supplementary Table S1.
The follow-up set comprising 199 tumor DNAs from EWSR1–ETS-positive Ewing sarcomas was distinct from the discovery set and consisted of patients treated according to the EuroEwing99 protocol.

Tirode F., Surdez D., Ma X., Parker M., Le Deley M.C., Bahrami A., Zhang Z., Lapouble E., Grossetête-Lalami S., Rusch M., Reynaud S., Rio-Frio T., Hedlund E., Wu G., Chen X., Pierron G., Oberlin O., Zaidi S., Lemmon G., Gupta P., Vadodaria B., Easton J., Gut M., Ding L., Mardis E.R., Wilson R.K., Shurtleff S., Laurence V., Michon J., Marec-Bérard P., Gut I., Downing J., Dyer M., Zhang J, & Delattre O. (2014). Genomic landscape of Ewing sarcoma defines an aggressive subtype with co-association of STAG2 and TP53 mutations. Cancer discovery, 4(11), 1342-1353.

Publication 2014

Biopharmaceuticals Cells DNA, Neoplasm Ethics Committees, Research EWSR1 protein, human Genome Germ Line Malignant Neoplasms Molecular Diagnostics Neoplasms Patients Regional Ethics Committees Tissues

Temporal Transcriptional Profiling of EWSR1/FLI1 Modulation

Cited 6 times

RNA was extracted at five time points—0 h, 18 h, 36 h, 53 h, 72 h—and subjected to microarray analysis where 0 h marks the time point when doxycycline was added, and 18 h the time point when modulation of EWSR1/FLI1 protein was first observed as determined by immunoblot analysis. RNA was hybridized to Affymetrix GeneChip Human Genome U133A 2.0 Arrays. cRNA target synthesis and GeneChip processing were performed according to standard protocols (Affymetrix). Processing of CEL files, normalizing, and filtering were done in the R statistical environment using Bioconductor packages (Wu et al. 2004 ). Each time point was replicated at least twice.
Affymetrix CEL files were read into the R statistical environment and normalized using the “gcrma” algorithm (Wu et al. 2004 ). Probe sets with very low expression values across all samples (R package “panp”) were filtered out. Subsequently, probe sets associated with the same gene identifier were averaged and merged to one symbol, yielding 12,928 unique genes. Principal component analysis was performed using the GNU scientific library Singular Value Decomposition routines. Pearson correlation coefficients with |r| > 0.8 of comparing individual genes with the first three principal components were used to identify significantly correlated genes.

Bilke S., Schwentner R., Yang F., Kauer M., Jug G., Walker R.L., Davis S., Zhu Y.J., Pineda M., Meltzer P.S, & Kovar H. (2013). Oncogenic ETS fusions deregulate E2F3 target genes in Ewing sarcoma and prostate cancer. Genome Research, 23(11), 1797-1809.

Publication 2013

Anabolism Complementary RNA DNA Library Doxycycline EWSR1 protein, human Gene Chips Genes Genome, Human Immunoblotting Maritally Unattached Microarray Analysis

Most recents protocols related to «EWSR1 protein, human»

Generating Engineered DLD-1 Cell Line

To establish the (AID-EWSR1/AID-EWSR1) DLD-1 cell line, CRISPR/Cas9 system was employed to tag the 5’ end of EWSR1 gene with mini-AID (mAID).
The donor plasmid of mAID was generated by following the procedure of the previous report with a minor modification (Hassebroek et al., 2020 (link)). First, the homology arms (left/up and right/down) that targets the EWSR1 locus were amplified from genomic DNA extracted from DLD-1 using following primers, respectively. Note that mutations were introduced in PAM sequences on the homology arms to avoid the Cas9 dependent degradation of the donor plasmid. The PCR products for the homology arms were inserted into the donor plasmid (containing hygromycin resistant gene/P2A sequence and 3x mini-AID and 3X Flag sequence) using PciI/SalI and SpeI/NotI sites, respectively (Hassebroek et al., 2020 (link)).
The guide RNA sequence was designed using the CRISPR Design Tool; Zhang laboratory, MIT. The suggested guide RNA sequences are listed below.

- EWSR1 gRNA1 F: ATGGCGTCCACGGGTGAGTA

- EWSR1 gRNA1 R: TACTCACCCGTGGACGCCAT

- EWSR1 gRNA2 F: AGTTCCACCATACTCACCCG

- EWSR1 gRNA2 R: CGGGTGAGTATGGTGGAACT

The oligonucleotides (synthesized by Integrated DNA technologies, IDT) were annealed, inserted into pX330 at its BbsI site (Addgene, #42230), and its sequence was confirmed by the DNA sequencing (ACGT Inc.).
The EWSR1-mCherry and EWSR1:R565A-mCherry DNA constructs that targets the AAVS1 locus of the (AID-EWSR1/AID-EWSR1) DLD-1 cell line are generated as described below. The mCherry, hEWSR1,hEWSR1:R565A genes were individually amplified using pCDNA4-His-maxC-mCherry, pSG5-2XFLAG-hEWSR1 or pSG5-2XFLAG-hEWSR1:R565A plasmids as a template using the following primers (Park et al., 2014 (link)).

- MluI-hEWS F: 5′-GATACGCGTATGGCTGCCACGGATTAC-3′

- NotInostop3′huEWS 1965to1945hEWS R: 5′-CTGCGGCCGCGTAGGGCCGATCTCTGC-3′

- NotI mChe F: 5′-GCGGCCGCAGGCGCTGG-3′

- SalI stop mChe R: 5′-CTTGTCGACTTACTTGTACAGCTCGTCC-3′

The PCR products of hEWSR1, hEWSR1:R565A and mCherry were inserted to SalI and MluI sites of pMK243 that had been modified at its multicloning sites in the previous study (Tet-OSTIR1-PURO) (Natsume et al., 2016 (link); Hassebroek et al., 2020 (link); Park et al., 2021 (link)).

Kim H., Park H., Schulz E.T., Azuma Y, & Azuma M. (2023). EWSR1 prevents the induction of aneuploidy through direct regulation of Aurora B. Frontiers in Cell and Developmental Biology, 11, 987153.

Publication 2023

Arm, Upper Cell Lines Clustered Regularly Interspaced Short Palindromic Repeats EWSR1 protein, human fluorinated trisacryl conjugate Genes Genome Homologous Sequences hygromycin A Mutation Oligonucleotide Primers Oligonucleotides Plasmids Tissue Donors

Validating Tumor Mutations Using NGS and LP-WGS

Targeted sequencing results from primary or metastatic tumors profiled with our clinical NGS-panel, OncoKids®, were reviewed for 26 cases^{34 (link)}. The LP-WGS data from the LB samples were assessed to determine whether the same mutations could be detected. For mutations identified by OncoKids®, we used GetBaseCountsMultisample, to verify the presence of a mutation in LP-WGS (https://github.com/mskcc/GetBaseCountsMultiSample). We further verified the presence of mutations by LP-WGS using Integrative Genomics Viewer (IGV)³⁹.
For detection of the EWSR1 and FOXO1 fusions in Ewing sarcoma and ARMS patients, respectively, we designed a custom panel to test in tumor DNA using a hybridization-based capture method (Twist Bioscience, South San Francisco, CA). Since UMIs only help with correcting PCR and chemistry artifacts when detecting point mutations, we trimmed the UMIs using the Dragen 3.7.3 aligner and realigned the reads to build 37 of the human reference genome. This increased the sensitivity to detect fusions. We used Illumina Manta (version 1.6.0) in the “targeted” mode (Manta">https://github.com/Illumina/Manta) to detect structural variants. All statistical analysis was carried out using R version 4.0.4.

Christodoulou E., Yellapantula V., O’Halloran K., Xu L., Berry J.L., Cotter J.A., Zdanowicz A., Mascarenhas L., Amatruda J.F., Ostrow D., Bootwalla M., Gai X., Navid F, & Biegel J.A. (2023). Combined low-pass whole genome and targeted sequencing in liquid biopsies for pediatric solid tumors. NPJ Precision Oncology, 7, 21.

Publication 2023

Arm, Upper Crossbreeding DNA, Neoplasm Ewings Sarcoma EWSR1 protein, human Genome, Human Hypersensitivity Mutation Neoplasm Metastasis Patients Point Mutation

Protein Extraction and Western Blot Analysis

Protein extraction was performed using gentle hypotonic lysis buffer (10 mM Tris pH 7.5, 10 mM NaCl, 2 mM EDTA, 0.5% Triton-X-100) supplemented with 1 × complete protease inhibitor (Roche). After 30 min incubation on ice, the NaCl concentration was adjusted to 150 mM, followed by another 5 min incubation on ice. The lysate was cleared by centrifugation at 16000xg for 15 min at 4 °C. Western blot analyses were performed according to the already published protocol from our laboratory^{16 (link)}. Briefly, 30 μg of proteins were separated by SDS–polyacrylamide gel electrophoresis, transferred to polyvinylidene difluoride (PVDF) membranes (Millipore), blocking was done with 5% skim milk diluted in PBS or TBS with 0.1% Tween-20 (PBS-T or TBS-T), and then incubated for 1.5–2 h at room temperature (RT) with anti-FUS (Santa Cruz, 4H11, 1:3000 dilution in PBS-T), home-made polyclonal rabbit anti-FUS^{9 (link)}, anti-actin (MP Biomedicals, 691,001, 1:25,000 dilution in PBS-T), anti-FBL (Santa Cruz, sc-25397, 1:500 dilution in TBS-T), anti-NOP56 (Santa Cruz, sc-23701, 1:500 dilution in TBS-T), anti-EWSR1 (Santa Cruz, sc-48404, 1:500 dilution in TBS-T) primary antibodies. After washing, the membrane was incubated for 1 h at RT with species-specific horseradish peroxidase (HRP)-coupled secondary antibody (Santa Cruz, sc-2005, goat anti-mouse; Santa Cruz, sc-2357, mouse anti-rabbit; Santa Cruz, sc-2020, monkey anti-goat; 1:3000 dilution in PBS-T). The signal was detected using the enhanced chemiluminescence method (ECL, GE Healthcare) and quantified using Image J software. Immunofluorescence was performed according to the protocol described in^{16 (link)}. Images were acquired using an Olympus Fluoview 1200 IX83 confocal scanning microscope with a 60 × oil-immersion objective. Two channels were used to acquire images with the following excitation parameters: 488 nm for Alexa Fluor 488 and 405 nm for DAPI. The obtained images were analyzed using ImageJ software.

Gawade K., Plewka P., Häfner S.J., Lund A.H., Marchand V., Motorin Y., Szczesniak M.W, & Raczynska K.D. (2023). FUS regulates a subset of snoRNA expression and modulates the level of rRNA modifications. Scientific Reports, 13, 2974.

Publication 2023

Actins alexa fluor 488 Antibodies Buffers Centrifugation Chemiluminescence DAPI Edetic Acid EWSR1 protein, human Goat Horseradish Peroxidase Immunofluorescence Immunoglobulins Microscopy, Confocal, Laser Scanning Milk, Cow's Monkeys Mus polyvinylidene fluoride Proteins Rabbits SDS-PAGE SERPINA1 protein, human Sodium Chloride Submersion Technique, Dilution Tissue, Membrane Triton X-100 Tromethamine Tween 20 Western Blot

Quantifying EWSR1::FLI1 Protein Levels

To assess EWSR1::FLI1 protein levels, cells were harvested in 2X SDS-loading buffer with 2-mercaptoethanol and boiled. To assess proteins enriched by immunoprecipitation, eluted proteins were diluted 1:1 in 2X SDS-loading buffer with 2-mercaptoethanol and incubated at 95°C for 5 min. For all western blots, proteins were resolved by SDS/PAGE (BioRad) and were transferred onto a nitrocellulose membrane (BioRad). After blocking in 5% BSA in PBS, membranes were probed using the appropriate primary antibody (Table 3) and fluorescent secondary antibodies (LiCor). Quantification was performed using Image Studio Lite (LiCor, version 5.2).

Vital T., Wali A., Butler K.V., Xiong Y., Foster JP I.I., Marcel S.S., McFadden A.W., Nguyen V.U., Bailey B.M., Lamb K.N., James L.I., Frye S.V., Mosely A.L., Jin J., Pattenden S.G, & Davis I.J. (2023). MS0621, a novel small-molecule modulator of Ewing sarcoma chromatin accessibility, interacts with an RNA-associated macromolecular complex and influences RNA splicing. Frontiers in Oncology, 13, 1099550.

Publication 2023

2-Mercaptoethanol Buffers Cells EWSR1 protein, human Fluorescent Antibody Technique Immunoglobulins Immunoprecipitation Nitrocellulose Proteins SDS-PAGE Tissue, Membrane Western Blot

Atypical Ewing Sarcoma Case Report

The retrospective patient population is derived from the Department of Pathology at the University of Debrecen, from the period of January 2015–December 2022. Cases diagnosed as “atypical Ewing sarcoma” without EWSR1 rearrangement being detected by FISH were investigated. Due to its rarity, we found only one case that met these criteria.
For research purposes, this patient consented and agreed, according to the ethical guidelines of the University of Debrecen, to the use of tissue blocks and clinical information for this report. All protocols have been approved by the authors’ respective Institutional Review Boards for human subjects (IRB reference number: 60355-2/2016/EKU and IV/8465-3/2021/EKU). This study was managed according to the Declaration of Helsinki.

Chang Chien Y.C., Madarász K., Csoma S.L., Mótyán J.A., Huang H.Y., Méhes G, & Mokánszki A. (2023). Molecular Identification and In Silico Protein Analysis of a Novel BCOR-CLGN Gene Fusion in Intrathoracic BCOR-Rearranged Sarcoma. Cancers, 15(3), 898.

Publication 2023

Ewings Sarcoma EWSR1 protein, human Fishes Patients Tissues

Top products related to «EWSR1 protein, human»

Isis 5 by MetaSystems

Sourced in Germany, United States

Isis 5 is a software application developed by MetaSystems for the analysis and interpretation of chromosomal data. The software provides tools for karyotyping, fluorescence in situ hybridization (FISH) analysis, and other cytogenetic applications. Isis 5 offers an intuitive user interface and advanced image processing capabilities to assist researchers and clinicians in their cytogenetic research and diagnostic work.

Fluorescence microscope by Zeiss

Sourced in Germany, United States, United Kingdom, China, Italy, Japan, Canada, France, Switzerland

The Zeiss Fluorescence Microscope is an optical instrument used to study the properties of fluorescent materials. It employs specific wavelengths of light to excite fluorescent molecules, causing them to emit light at a different wavelength, which is then observed and analyzed.

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

Trizol reagent by Thermo Fisher Scientific

Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand

TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.

Puromycin by InvivoGen

Sourced in United States, France, China, Japan, United Kingdom, Hong Kong, Germany, Switzerland

Puromycin is a laboratory reagent used as a selection marker in cell culture experiments. It is an antibiotic that inhibits protein synthesis, allowing for the identification and selection of cells that have successfully incorporated a gene of interest.

Trusight rna fusion panel by Illumina

Sourced in United States

The TruSight RNA Fusion Panel is a targeted gene enrichment panel designed to detect RNA fusion transcripts. It enables the identification of gene fusions across multiple cancer types. The panel targets known and novel fusion partners, providing comprehensive coverage of fusion genes implicated in various cancers.

Lipofectamine 2000 by Thermo Fisher Scientific

Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco

Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.

Penicillin streptomycin by Lonza

Sourced in United States, Switzerland, Belgium, United Kingdom, Germany, Italy, France, Spain, Netherlands, Australia, Canada, Austria, Sweden, Gabon, New Zealand

Penicillin/streptomycin is a solution containing two antibiotics commonly used in cell culture and molecular biology applications. The solution provides a way to prevent bacterial contamination in laboratory settings.

Ab54708 by Abcam

Ab54708 is a primary antibody product from Abcam. It is a polyclonal antibody that binds to a specific target protein. The core function of this antibody is to detect and bind to the target protein for research and analytical purposes.

Lipofectamine rnaimax by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Japan, France, Canada, Switzerland, Denmark, Belgium, Italy, Australia, Singapore, Spain, Colombia, Sweden, Netherlands, New Zealand, Poland, Pakistan, Lithuania

Lipofectamine RNAiMAX is a transfection reagent designed for efficient delivery of small interfering RNA (siRNA) and short hairpin RNA (shRNA) into a wide range of cell types. It is a cationic lipid-based formulation that facilitates the uptake of these nucleic acids into the target cells.

What is the EWSR1 protein, and what is its role in cancer?

The EWSR1 protein is a fusion protein that plays a crucial role in the development of several types of cancer, including Ewing sarcoma. It is characterized by the presence of the EWSR1 gene, which can fuse with other genes to form oncogenic fusion proteins. Understanding the function of the EWSR1 protein in disease pathogenesis is essential for developing effective treatments.

How can PubCompare.ai help with EWSR1 protein research?

PubCompare.ai's AI-powered protocol optimization can assist researchers in identifying the most accurate and effective protocols for EWSR1 protein research. The platform allows you to screen protocol literature more efficiently and leverage AI to pinpoiunt critical insights. This can help you choose the best protocols for reproducibility and accuracy, advancing your EWSR1 protein research with confidence.

What are some common usage challenges with EWSR1 protein, human?

One of the key challenges in working with the EWSR1 protein, human is the complexity of the fusion proteins it can form. Researchers must be careful to identify the specific fusion partners and understand how they impact the protein's structure and function. Additionally, the EWSR1 protein is invlodd in multiple cancer types, requiring researchers to carefully select the most relevant protocols and experimental models.

Can you explain the different variations or types of EWSR1 protein?

The EWSR1 protein can form a variety of fusion proteins, depending on the gene it fuses with. Some of the most common fusion partners include FLI1, ERG, and FET family proteins. Each fusion protein has unique characteristics and is associated with different types of cancer. Researchers must be mindful of these variations when designing experiments and interpreting results.

What are some specific applications of the EWSR1 protein, human?

The EWSR1 protein is a key target for cancer research and drug development. Researchers are exploring its role in the pathogenesis of Ewing sarcoma, as well as other malignancies such as myxoid liposarcoma and clear cell sarcoma. Understanding the function of the EWSR1 protein and its fusion partners can lead to the development of targeted therapies and improved patient outcomes. PubCompare.ai's AI-powered protocol optimization can help researchers identify the most effective protocols for these applications.

More about "EWSR1 protein, human"

The EWSR1 protein is a critical player in various types of cancer, including the devastating Ewing sarcoma.
This fusion protein, characterized by the presence of the EWSR1 gene, can combine with other genes to form potent oncogenic fusion proteins.
Understanding the complex role of EWSR1 in disease pathogenesis is crucial for developing effective treatments.
Researchers can leverage the power of PubCompare.ai's AI-powered protocol optimization to identify the most accurate and effective protocols from literature, preprints, and patents.
This advanced tool can help advance EWSR1 protein research with confidence.
When studying the EWSR1 protein, researchers may utilize techniques like fluorescence microscopy, which can visualize the subcellular localization of the protein using fluorescent labels.
Cell culture experiments with EWSR1-expressing cell lines may involve the use of Isis 5 software for data analysis, FBS for cell growth, TRIzol reagent for RNA extraction, and Puromycin for selecting transfected cells.
To further understand the EWSR1 fusion partners and their impact, the TruSight RNA Fusion Panel can be employed to detect and characterize fusion transcripts.
Transfection of EWSR1-related constructs into cells may be facilitated by Lipofectamine 2000, a common transfection reagent.
Maintaining a healthy cell environment is crucial, and the use of Penicillin/Streptomycin can help prevent bacterial contamination.
Antibodies, such as Ab54708, may be utilized to detect and quantify the EWSR1 protein.
By combining the insights gained from the MeSH term description and the Metadescription, researchers can confidently navigate the complexities of EWSR1 protein research and unlock new possibilities for advancing cancer treatments.