Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > Exonuclease

Exonuclease

Exonucleases are enzymes that catalyze the removal of nucleotides from the ends of DNA or RNA molecules.
They play a crucial role in DNA replication, repair, and recombination, as well as in RNA processing and degradation.
Exonucleases can be classified based on their directionality (5' to 3' or 3' to 5'), their substrate specificity (DNA or RNA), and their mechanism of action.
These enzymes have diverse applications in molecular biology, including in the optimization of experimental protocols and the enhancement of reproducibility in research.
PubCompare.ai's AI-powered platform can help researchers discover and compare the best exonuclease methods from publications, preprints, and patents, providing data-driven insights to streamline experimentation and elevate their research.

Most cited protocols related to «Exonuclease»

1
PacBio Sequencing by Synthesis Protocol
Cited 147 times
Genomic DNA was sheared to 8 kb using an ultrasonicator (Covaris Inc, Woburn, MA) and was converted into the proprietary SMRTbell™ library format using RS DNA Template Preparation Kit (Pacific Biosciences, Melon Park, CA). Briefly, sheared DNA was end repaired, and hairpin adapters were ligated using T4 DNA ligase. Incompletely formed SMRTbell templates were degraded with a combination of Exonuclease III and Exonuclease VII. The resulting DNA templates were purified using SPRI magnetic beads (AMPure, Agencourt Bioscience, Beverly, MA) and annealed to a two-fold molar excess of a sequencing primer that specifically bound to the single-stranded loop region of the hairpin adapters.
SMRTbell templates were subjected to standard SMRT sequencing using an engineered phi29 DNA polymerase on the PacBio RS system according to manufacturer's protocol. The PacBio RS system continuously monitors zero-mode waveguides (ZMWs) in sets of 75000 at a time. Within each ZMW a single DNA polymerase molecule is attached to the bottom surface such that it permanently resides within the detection volume where it can be watched as it performs sequencing by synthesis. Within each chamber, Phospholinked nucleotides, each type labeled with a different colored fluorophore, are then introduced into the reaction solution at high concentrations that promote enzyme speed, accuracy, and processivity. Pulse calling, utilized a threshold algorithm on the dye weighted intensities of fluorescence emissions, and read alignments, achieved using a Smith-Waterman algorithm. Reads were filtered after alignment to remove low quality sequences derived from doubly-loaded ZMWs.
English A.C., Richards S., Han Y., Wang M., Vee V., Qu J., Qin X., Muzny D.M., Reid J.G., Worley K.C, & Gibbs R.A. (2012). Mind the Gap: Upgrading Genomes with Pacific Biosciences RS Long-Read Sequencing Technology. PLoS ONE, 7(11), e47768.
Full text: Click here
Publication 2012
Anabolism DNA DNA-Directed DNA Polymerase DNA Library Enzymes exodeoxyribonuclease III Exonuclease Fluorescent Dyes Genome Melons Molar NCOR2 protein, human Nucleotides Oligonucleotide Primers Pulse Rate T4 DNA Ligase
2
ChIP-Seq Mapping of Transcription Factor Binding
Cited 64 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2011
Endopeptidase K Ethanol Exonuclease Genome Immunoprecipitation, Chromatin Oligonucleotide Primers Protein Microarrays Proteins Resins, Plant Sepharose
3
Hairpin-Adapted DNA Sequencing Protocol
Cited 40 times
Sets of ∼35-base ssDNA oligonucleotides (Figs. 1-4 and Supplementary Fig. 1) were purchased (Trilink Biotechnologies, San Diego, CA). Presence of base modifications within these single-stranded oligonucleotides was verified by mass spectrometry. After hybridization and ligation, each end of the resulting dsDNA oligonucleotides was ligated to a hairpin oligonucleotide. Samples were treated with exonucleases to remove any molecules that were not covalently closed. Sequences for the resulting DNA templates, which were 199 bases in length and consisted of a central 84-bp double-stranded region with single-stranded loops at each end, are shown (Supplementary Note).
For sequencing of the full fosmid (Supplementary Figs. 2 and 5), a fosmid clone (clone id: WRM0639cE06) containing an ∼40 kb C. elegans genomic insert was obtained from Geneservice (Cambridge, UK, http://www.geneservice.co.uk/products/clones/Celegans_Fos.jsp) in dam+ E. coli strain EPI300, and cultured and amplified using the inducible origin (CopyControl system, Epicentre, Madison, WI). Fosmid DNA was purified using standard methods. DNA templates were then created directly from fosmid DNA or from whole genome amplified (WGA) fosmid DNA. For WGA libraries, 25 ng of fosmid DNA was amplified using the manufacturer recommended conditions in the GenomiPhi HY DNA Amplification Kit (GE Healthcare, U.K.).
For sequencing of the subsection of the fosmid (Fig. 5 and Supplementary Figs. 3 and 4), an ∼3.7 kb segment (corresponding to positions 12797-16484 within the fosmid) containing 13 instances of the GATC sequence context was PCR amplified from the fosmid using Phusion High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA) and the following primers: Forward 5′-AGTCCTGATGCTTTCACCAAAT-3′; Reverse 5′-ATTTAGATTGCCAAAGCCGTAA-3′. PCR products were cloned into the pCR-Blunt vector using the Zero Blunt PCR Cloning Kit (Invitrogen, Carlsbad, CA) and propagated in the dam+ E. coli strain TOP10 (Invitrogen, Carlsbad, CA). Approximately 25 ng of the DNA was amplified using the REPLI-g Mini Kit (QIAGEN, Valencia, CA) for the generation of the unmethylated control sample.
Fosmid DNA, or an equivalent quantity of WGA fosmid DNA, was sheared to a mean size of 500 bp (Fig. 5 and Supplementary Figs. 3 and 4) or 200 bp (Supplementary Fig. 5) using an ultrasonicator (Covaris Inc, Woburn, MA). Sheared DNA was then end-repaired with a cocktail of T4 DNA polymerase and T4 polynucleotide kinase, purified, and subjected to 3′ A-tailing with Klenow(exo-). The A-tailed fragments were ligated to hairpin oligonucleotides that contained a single 3′ T overhang and 5′ phosphate. Samples were treated with a mixture of exonucleases to remove any molecules that were not covalently closed. The resulting DNA templates were purified using SPRI magnetic beads (AMPure, Agencourt Bioscience, Beverly, MA) and annealed to a two-fold molar excess of a sequencing primer (5′-GGAGGAGGAGGA -3′) that specifically bound to the single-stranded loop region of the hairpin adapters.
Flusberg B.A., Webster D., Lee J., Travers K., Olivares E., Clark T.A., Korlach J, & Turner S.W. (2010). Direct detection of DNA methylation during single-molecule, real-time sequencing. Nature methods, 7(6), 461-465.
Publication 2010
Cloning Vectors Crossbreeding DNA, Double-Stranded DNA, Single-Stranded DNA-Directed DNA Polymerase Escherichia coli Exonuclease Genome Genomic Library Ligation Mass Spectrometry Molar Oligonucleotide Primers Oligonucleotides Phosphates Polynucleotide 5'-Hydroxyl-Kinase Strains
4
Hairpin-Adapted DNA Sequencing Protocol
Cited 40 times
Sets of ∼35-base ssDNA oligonucleotides (Figs. 1-4 and Supplementary Fig. 1) were purchased (Trilink Biotechnologies, San Diego, CA). Presence of base modifications within these single-stranded oligonucleotides was verified by mass spectrometry. After hybridization and ligation, each end of the resulting dsDNA oligonucleotides was ligated to a hairpin oligonucleotide. Samples were treated with exonucleases to remove any molecules that were not covalently closed. Sequences for the resulting DNA templates, which were 199 bases in length and consisted of a central 84-bp double-stranded region with single-stranded loops at each end, are shown (Supplementary Note).
For sequencing of the full fosmid (Supplementary Figs. 2 and 5), a fosmid clone (clone id: WRM0639cE06) containing an ∼40 kb C. elegans genomic insert was obtained from Geneservice (Cambridge, UK, http://www.geneservice.co.uk/products/clones/Celegans_Fos.jsp) in dam+ E. coli strain EPI300, and cultured and amplified using the inducible origin (CopyControl system, Epicentre, Madison, WI). Fosmid DNA was purified using standard methods. DNA templates were then created directly from fosmid DNA or from whole genome amplified (WGA) fosmid DNA. For WGA libraries, 25 ng of fosmid DNA was amplified using the manufacturer recommended conditions in the GenomiPhi HY DNA Amplification Kit (GE Healthcare, U.K.).
For sequencing of the subsection of the fosmid (Fig. 5 and Supplementary Figs. 3 and 4), an ∼3.7 kb segment (corresponding to positions 12797-16484 within the fosmid) containing 13 instances of the GATC sequence context was PCR amplified from the fosmid using Phusion High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA) and the following primers: Forward 5′-AGTCCTGATGCTTTCACCAAAT-3′; Reverse 5′-ATTTAGATTGCCAAAGCCGTAA-3′. PCR products were cloned into the pCR-Blunt vector using the Zero Blunt PCR Cloning Kit (Invitrogen, Carlsbad, CA) and propagated in the dam+ E. coli strain TOP10 (Invitrogen, Carlsbad, CA). Approximately 25 ng of the DNA was amplified using the REPLI-g Mini Kit (QIAGEN, Valencia, CA) for the generation of the unmethylated control sample.
Fosmid DNA, or an equivalent quantity of WGA fosmid DNA, was sheared to a mean size of 500 bp (Fig. 5 and Supplementary Figs. 3 and 4) or 200 bp (Supplementary Fig. 5) using an ultrasonicator (Covaris Inc, Woburn, MA). Sheared DNA was then end-repaired with a cocktail of T4 DNA polymerase and T4 polynucleotide kinase, purified, and subjected to 3′ A-tailing with Klenow(exo-). The A-tailed fragments were ligated to hairpin oligonucleotides that contained a single 3′ T overhang and 5′ phosphate. Samples were treated with a mixture of exonucleases to remove any molecules that were not covalently closed. The resulting DNA templates were purified using SPRI magnetic beads (AMPure, Agencourt Bioscience, Beverly, MA) and annealed to a two-fold molar excess of a sequencing primer (5′-GGAGGAGGAGGA -3′) that specifically bound to the single-stranded loop region of the hairpin adapters.
Flusberg B.A., Webster D., Lee J., Travers K., Olivares E., Clark T.A., Korlach J, & Turner S.W. (2010). Direct detection of DNA methylation during single-molecule, real-time sequencing. Nature methods, 7(6), 461-465.
Publication 2010
Cloning Vectors Crossbreeding DNA, Double-Stranded DNA, Single-Stranded DNA-Directed DNA Polymerase Escherichia coli Exonuclease Genome Genomic Library Ligation Mass Spectrometry Molar Oligonucleotide Primers Oligonucleotides Phosphates Polynucleotide 5'-Hydroxyl-Kinase Strains
5
Whole-Genome Amplification and Sequencing
Cited 37 times
An aliquot of ∼25 ng of plasmid DNA was whole-genome amplified (WGA) using the REPLI-g Midi Kit (Qiagen, Valencia, CA, USA). Amplification factors were typically approximately 1600× (∼40 ug output), translating to <0.06% of residual methylated DNA in the control samples. Further trimming of 5% of data from the top and bottom of the IPD distributions (see data analysis section) removed any remaining spurious signal from modified DNA. WGA and native plasmid DNA was sheared to an average size of 300 bp via adaptive focused acoustics (Covaris, Woburn, MA, USA). SMRTbell template sequencing libraries were prepared as previously described (30 (link)). Briefly, sheared DNA was end repaired, A-tailed and hairpin adapters with a single T-overhang were ligated. Incompletely formed SMRTbell templates were degraded with a combination of Exonuclease III (New England Biolabs; Ipswich, MA, USA) and Exonuclease VII (USB; Cleveland, OH, USA). Primer was annealed and samples were sequenced on the PacBio RS as previously described (31 (link),32 (link)).
Clark T.A., Murray I.A., Morgan R.D., Kislyuk A.O., Spittle K.E., Boitano M., Fomenkov A., Roberts R.J, & Korlach J. (2011). Characterization of DNA methyltransferase specificities using single-molecule, real-time DNA sequencing. Nucleic Acids Research, 40(4), e29.
Publication 2011
Acclimatization Acoustics exodeoxyribonuclease III Exonuclease Genome Oligonucleotide Primers Plasmids

Most recents protocols related to «Exonuclease»

1
RNA Decoy Sequence Design and Flanking
Not available on PMC !

Example 24

Examples of appropriate flanking sequences for RNA decoys are as follows:

TAR DECOY SEQ
(SEQ ID NO: 14)
GUGCUCGCUUCGGCAGCACGTCGAC
(SEQ ID NO: 15)
UCUAGAGCGGACUUCGGUCCGCUUUU
RRE DECOY SEQ
(SEQ ID NO: 16)
GUGCUCGCUUCGGCAGCACGTCGAC
(SEQ ID NO: 17) 
UCUAGAGCGGACUUCGGUCCGCUUUU.
See FIG. 17D.

Previously, it was demonstrated that decoy sequences flanked by hairpins on either side, 19 nucleotides (ntds) of the U6 RNA on the 5′ side as well as a 3′ stem immediately preceding a poly U terminator for POLIII, showed greater stability. This arrangement is expected to protect against 3′-5′ exonuclease attack, and to reduce the chances of the 3′ trailer interfering with the insert RNA folding. Since only the first ¾ of the tRNA sequence is present, the 5′ end of the insert should be protected and export from the nucleus should be prevented (Good et al., 1997).

US11859168B2. Electroporation, developmentally-activated cells, pluripotent-like cells, cell reprogramming and regenerative medicine (2024-01-02). None [US]. Inventors: Christopher B. Reid [US], Melissa Braga [US], Lilian N. Santamaria [US], Ashley N. Wickrema [US], Marinne D. Wickrema [US], Anthony Hao Dinh [US], Yaman Eksioglu [US], Mat Hoang Ho [US].
Full text: Click here
Patent 2024
Exonuclease Nuclear Export Nucleotides Poly A-U Stem, Plant Transfer RNA U6 small nuclear RNA
2
RNA-Seq Library Preparation for Illumina
Total mRNA was isolated from primary B lymphocytes using an RNeasy Mini Kit (Qiagen) following the manufacturer’s instructions. RNA concentrations were quantitated using a NanoDrop 2000 (Thermo Scientific) and library preparation was performed by Novogene. A total amount of 1 µg RNA per sample was used as input material for the RNA sample preparations. Sequencing libraries were generated using NEBNext Ultra TM RNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s recommendations, and index codes were added to attribute sequences to each sample. Briefly, mRNA was purified from total RNA using poly-T oligo-attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEBNext First-strand Synthesis Reaction Buffer (5 X). First-strand cDNA was synthesized using random hexamer primer and M-MuLV Reverse Transcriptase (RNase H-). Second-strand cDNA synthesis was subsequently performed using DNA Polymerase I and RNase H. Remaining overhangs were converted into blunt ends via exonuclease/polymerase activities. After adenylation of 3’ ends of DNA fragments, NEBNext Adaptor with hairpin loop structure was ligated to prepare for hybridization. To select cDNA fragments of preferentially 150~200 bp in length, the library fragments were purified with AMPure XP system (Beckman Coulter, Beverly, USA). Then 3 µl USER Enzyme (NEB, USA) was used with size-selected, adaptor-ligated cDNA at 37°C for 15 min followed by 5 min at 95°C before PCR. Then PCR was performed with Phusion High-Fidelity DNA polymerase, Universal PCR primers, and Index (X) Primer. Lastly, PCR products were purified (AMPure XP system) and library quality was assessed on the Agilent Bioanalyzer 2100 system. The clustering of the index-coded samples was performed on a cBot Cluster Generation System using PE Cluster Kit cBot-HS (Illumina) according to the manufacturer’s instructions. After cluster generation, the library preparations were sequenced on an Illumina NovaSeq 6000 Platform (Illumina, San Diego, CA, USA) using a paired-end 150 run (2 × 150 bases).
Emrich S.M., Yoast R.E., Zhang X., Fike A.J., Wang Y.H., Bricker K.N., Tao A.Y., Xin P., Walter V., Johnson M.T., Pathak T., Straub A.C., Feske S., Rahman Z.S, & Trebak M. (2023). Orai3 and Orai1 mediate CRAC channel function and metabolic reprogramming in B cells. eLife, 12, e84708.
Full text: Click here
Publication 2023
Anabolism B-Lymphocytes Buffers Cations, Divalent cDNA Library Crossbreeding DNA, Complementary DNA-Directed DNA Polymerase DNA Polymerase I Enzymes Exonuclease Fever Moloney Leukemia Virus Oligonucleotide Primers Oligonucleotides Poly T Ribonuclease H RNA, Messenger RNA-Directed DNA Polymerase
3
Site-Directed Mutagenesis of E. coli Exonuclease ε
Site direct mutagenesis was
used to create the two active site mutants of the E.
coli exonuclease ε. The methionine 18 to alanine
(ε18) was created using the forward primer 5′-GAAACCACCGGTGCGAACCAGATTGGTGCG-3′
and reverse primer 5′-CGCACCAATCTGGTTCGCACCGGTGGTTTC-3.′
The valine 65 to alanine mutation (ε65) was created
using the forward 5′-GGAAGCCTTTGGCGCACATGGTATTGCCGATG-3′
and reverse primer 5′-CATCGGCAATACCATGTGCGCCAAAGGCTTCC-3.′
Botto M.M., Murthy S, & Lamers M.H. (2023). High-Throughput Exonuclease Assay Based on the Fluorescent Base Analogue 2-Aminopurine. ACS Omega, 8(9), 8285-8292.
Publication 2023
Alanine Escherichia coli Exonuclease Methionine Mutagenesis Mutation Oligonucleotide Primers Valine
4
Mitochondrial Genome Sequencing of Plasmodium vivax
DNA samples that were determined to be positive for P. vivax were used for subsequent amplification. The DNA was dissolved in TE buffer (10 mM Tris–HCl, pH 8.0, 0.1 M EDTA) and stored at − 20 °C until use. The whole mt DNA sequences (approx. 6 Kb) of the P. vivax isolates from Hainan were amplified by PCR and sequencing using oligonucleotide primers as previously described, with minor modifications [13 (link)].
Long-range, high-fidelity PCR amplification was performed using PrimeSTAR GXL DNA polymerase (Takara, Beijing, China), which has efficient 3ʹ → 5ʹ exonuclease proofreading activity. PCRs of 100 μl contained DNA template, each oligonucleotide primer at 0.2 μM, 1 × GXL PCR Buffer, 200 μM deoxynucleosides (dNTPs), and 5 units of polymerase mix. PCR was performed at 98 °C for 30 s, followed by 40 cycles of 98 °C for 10 s, 55 °C for 15 s, and 68 °C for 40 s. A final extension was performed at 68 °C for 3 min. PCR products were purified and sequenced by an ABI 3730XL DNA Analyzer at Guangzhou Tian Yihui Gene Technology Co., Ltd. All the PCR-amplified fragments were sequenced in both the forwards and reverse directions (6 × coverage), and two fragments of the complete mt genome in P. vivax were sequenced with 13 pairs of primers (Additional file 1).
The mt genome sequences were assembled, aligned, and annotated using the Geneious 11.0 program. DNA alignment of the whole mtDNA sequences of the P. vivax isolates was performed by Clustal W. The single complete mt sequences without repeat sequences were deposited in GenBank (OP250985-OP251004, OP320684-OP320708).
Li Y., Huang X., Qing L., Zeng W., Zeng X., Meng F., Wang G, & Chen Y. (2023). Geographical origin of Plasmodium vivax in the Hainan Island, China: insights from mitochondrial genome. Malaria Journal, 22, 84.
Full text: Click here
Publication 2023
Buffers DNA, Mitochondrial DNA-Directed DNA Polymerase Edetic Acid Exonuclease Genes Genome Oligonucleotide Primers Repetitive Region Tromethamine
5
Full-Length Transcriptome Sequencing
The main process of library construction was as follows: The Clonetech SMARTerTM PCR cDNA Synthesis Kit was used to synthesize full-length cDNA of mRNA. Primer with Oligo dT was used for A-T base pairing with the polyA tail at the 3’ terminal of mRNA as primer for reverse synthesis of cDNA, and primer was added to the terminal of full-length cDNA synthesized in reverse. Full-length cDNA was obtained using PCR, PB magnetic beads were used to purify the amplified full-length cDNA, and small fragments of cDNA less than 1 kb were removed. The terminus of the full-length cDNA was repaired and connected to the SMRT dumbbell adapter. The fragments that were not connected to the adaptor were digested by exonuclease. PB magnetic beads were used to purify the fragments, and the sequencing library was obtained. After library construction, Qubit 3.0 was used for accurate quantification, and Agilent 2100 was used to detect the size of the library. After qualified detection, a PacBio sequencer was used to perform full-length transcriptome sequencing. The raw sequence generated by the PacBio sequencer totaled 86.4 Gbp and was deposited into the NCBI Sequence Read Archive (SRA) with accession number SRR22263802.
Zhang L., Tang X., Wang Z, & Tang F. (2023). The transcriptomic response of Hyphantria cunea (Drury) to the infection of Serratia marcescens Bizio based on full-length SMRT transcriptome sequencing. Frontiers in Cellular and Infection Microbiology, 13, 1093432.
Full text: Click here
Publication 2023
Anabolism cDNA Library DNA, Complementary Exonuclease mRNA, Polyadenylated NCOR2 protein, human oligo (dT) Oligonucleotide Primers Poly(A) Tail RNA, Messenger Tail

Top products related to «Exonuclease»

1
T5 exonuclease by New England Biolabs
Sourced in United States, United Kingdom, Germany
T5 exonuclease is an enzyme that catalyzes the removal of nucleotides from the 5' end of DNA or RNA molecules. It exhibits high processivity and can rapidly degrade single-stranded nucleic acids in the 5' to 3' direction.
2
Ampure xp system by Beckman Coulter
Sourced in United States, United Kingdom, Canada
The AMPure XP system is a magnetic bead-based purification tool used to selectively bind and purify nucleic acids, such as DNA and RNA, from complex samples. It allows for efficient recovery and concentration of target molecules while removing unwanted contaminants and impurities.
3
Lambda exonuclease by New England Biolabs
Sourced in United States, United Kingdom
Lambda exonuclease is a DNA-specific 5' to 3' exonuclease enzyme. It catalyzes the stepwise removal of mononucleotides from the 5' terminus of double-stranded DNA.
4
Bioanalyzer 2100 system by Agilent Technologies
Sourced in United States, Germany, China, Canada, United Kingdom, France, Switzerland
The Bioanalyzer 2100 system is a lab equipment product from Agilent Technologies. It is designed to perform automated electrophoretic analysis of DNA, RNA, and proteins. The system provides quantitative and qualitative data on the size, concentration, and integrity of these biomolecules.
5
Taqman 5 exonuclease assay by Thermo Fisher Scientific
Sourced in United States, Japan
The TaqMan 5′ exonuclease assay is a real-time PCR technology used for the detection and quantification of specific DNA sequences. It employs a target-specific probe labeled with a fluorescent reporter and a quencher. During PCR amplification, the probe hybridizes to the target sequence and is cleaved by the 5′ exonuclease activity of the DNA polymerase, releasing the reporter dye and generating a fluorescent signal proportional to the amount of amplified product.
6
Agilent bioanalyzer 2100 system by Agilent Technologies
Sourced in United States, China, Germany, Canada, United Kingdom, Finland, France, Spain, Switzerland
The Agilent Bioanalyzer 2100 system is a microfluidics-based platform designed for the analysis of DNA, RNA, proteins, and cells. It provides automated electrophoretic separation and detection of these biomolecules in a miniaturized format.
7
Terminator 5 phosphate dependent exonuclease by Illumina
Sourced in United States
Terminator 5′-phosphate-dependent exonuclease is a lab equipment product that functions as an enzyme. It catalyzes the removal of nucleotides from the 5′ end of DNA or RNA strands in a phosphate-dependent manner.
8
Taq dna ligase by New England Biolabs
Sourced in United States, China
Taq DNA ligase is a thermostable enzyme used for the covalent joining of double-stranded DNA fragments. It catalyzes the formation of a phosphodiester bond between adjacent 3'-hydroxyl and 5'-phosphate termini in duplex DNA or RNA.
9
G tube by Covaris
Sourced in United States, United Kingdom
The G-TUBE is a sample preparation device designed for efficient genomic DNA extraction from a wide range of sample types. It utilizes Covaris' proprietary acoustic technology to gently and effectively lyse cells and tissues, releasing high-quality genomic DNA for downstream applications.
10
Exonuclease 3 by New England Biolabs
Sourced in United States
Exonuclease III is a DNA exonuclease that catalyzes the stepwise removal of nucleotides from the 3' ends of double-stranded DNA. It has a 3' to 5' exonuclease activity and can be used for various molecular biology applications.

More about "Exonuclease"

Exonucleases are a class of enzymes that catalyze the removal of nucleotides from the ends of DNA or RNA molecules.
These enzymes play a crucial role in various cellular processes, such as DNA replication, repair, and recombination, as well as RNA processing and degradation.
Exonucleases can be classified based on their directionality (5' to 3' or 3' to 5'), their substrate specificity (DNA or RNA), and their mechanism of action.
Some notable exonucleases include T5 exonuclease, which is commonly used in molecular biology for DNA manipulation and library construction, and Lambda exonuclease, which is used for the selective digestion of one strand of a DNA duplex.
The AMPure XP system, which utilizes magnetic beads, is often used for the purification and size selection of DNA and RNA fragments, often in conjunction with exonucleases.
The TaqMan 5′ exonuclease assay is a widely used technique for the quantitative detection of nucleic acids, where an exonuclease is used to cleave a fluorogenic probe and release a fluorescent signal.
The Agilent Bioanalyzer 2100 system, on the other hand, is a microfluidic-based platform used for the analysis and quantification of DNA, RNA, and proteins, often employing exonucleases to prepare samples.
Terminator 5′-phosphate-dependent exonuclease is a specialized exonuclease that selectively degrades 5′-phosphorylated DNA or RNA, which is useful for the removal of unwanted primer or adapter sequences.
Taq DNA ligase, another enzyme often used in molecular biology, can be used in conjunction with exonucleases for the assembly of DNA fragments.
The G-TUBE is a device used for the mechanical shearing of DNA, which can be combined with exonuclease treatment to generate specific fragment sizes.
Exonuclease III is a commonly used enzyme that catalyzes the stepwise removal of nucleotides from the 3' end of DNA, and is widely employed in various DNA manipulation and analysis techniques.
Overall, exonucleases are versatile tools with diverse applications in molecular biology, genomics, and biotechnology, and PubCompare.ai's AI-powered platform can help researchers optimize their exonuclease-based protocols and boost the reproducibility of their research.