> Chemicals & Drugs > Amino Acid > Gal-VP16

Gal-VP16

Q: What are some common challenges researchers face when using Gal-VP16?

One of the main challenges with Gal-VP16 is ensuring consistent and robust target gene activation. Factors like cell type, promoter design, and expression levels can all impact the efficiency of the Gal-VP16 system. Researchers also need to carefully optimize the Gal-VP16 construct and delivery method to avoid potential toxicity or off-target effects.

Gal-VP16 is a fusion protein consisting of the DNA-binding domain of the yeast transcriptional activator GAL4 and the transactivation domain of the herpes simplex virus protein VP16.
This powerful combination allows for highly efficient activation of target gene expression, making Gal-VP16 a valuable tool in molecular biology and biotechnology reseach.
Gal-VP16 is commonly used to drive ectopic gene expression in cell culture and animal models, enabling researchers to study the effects of specific genes and pathways.
Dsicover optimized Gal-VP16 protocols from a wealth of literature, pre-prints, and patents using PubCompare.ai's AI-driven analysis platform.
Effortlessly identify the best techniuqes and products to elevate your research and take your studies to new heights.

Most cited protocols related to «Gal-VP16»

Drosophila Maternal Triple Driver Gal4 Line

Cited 115 times

The maternal triple driver (MTD)-Gal4 stock^{6 (link)} was a gift from L. Cooley (Yale University). The stock contained homozygous insertions of three Gal4 constructs, which together provide robust germline and maternal Gal4 expression. The genotype was P{COG-Gal4:VP16}; P{Gal4-nos.NGT}40; P{nos-Gal4-VP16} (Bloomington stock 31777). P{COG-Gal4:VP16}^{7 (link)} contained a promoter from the otu gene and the 3′ untranslated region (UTR) from the K10 gene. Gal4:VP16 expression from this transgene was weak or absent in the germarium and robust beginning in stage-1 egg chambers. P{nos-Gal4-VP16} contained both the promoter and 3′ UTR from the nanos gene^{15 (link)} and was expressed throughout the germarium and in all stages of egg chambers, with lower expression in young egg chambers (~stages 2–6)^{7 (link)}. P{Gal4-nos.NGT}40 contained the nanos promoter and αTub84E 3′ UTR^{16 (link)}, and was made for maternal loading of Gal4 to drive expression during embryogenesis.
GMR-Gal4 and C96-Gal4 were used to drive expression in the eye and wing, respectively, as described previously^{5 (link)}. Their descriptions are available from FlyBase (http://flybase.org/). Details on the full genotype of all the lines used in this study are available on the TRiP website (http://www.flyrnai.org/TRiP-HOME.html).

Ni J.Q., Zhou R., Czech B., Liu L.P., Holderbaum L., Yang-Zhou D., Shim H.S., Tao R., Handler D., Karpowicz P., Binari R., Booker M., Brennecke J., Perkins L.A., Hannon G.J, & Perrimon N. (2011). A genome-scale shRNA resource for transgenic RNAi in Drosophila. Nature methods, 8(5), 405-407.

Publication 2011

3' Untranslated Regions Debility Embryonic Development Gal-VP16 Genes Genotype Germ Line Homozygote Insertion Mutation Mothers Promoter, Genetic Transgenes Untranslated Regions VP-16

Zebrafish Microglia Behavior Imaging

Cited 14 times

Zebrafish (Danio rerio) were maintained at 28°C in a 13 h light and 11 h dark cycle. Embryos were collected by natural spawning and raised at 28.5°C in E3 solution according to standard protocols (Westerfield, 2000 ). Experimental protocols were approved by Macquarie University Animal Ethics Committee (Zebrafish models of neural disorders; protocol no. 2012/050).
The behavior of “activated” microglia was studied between 48 hours post fertilization (hpf) and 5 days post fertilization (dpf). In order to allow high-resolution confocal live-imaging of individual neuron-microglia interactions, we utilized the following previously characterized zebrafish lines: Tg(mpeg1:GAL4,UAS:mCherry) (gl22Tg), referred to as mpeg1:mCherry in the text (Ellett et al., 2011 (link)); rwTg(isl1:GFP), referred to as islet1:GFP in the text (Higashijima et al., 2000 (link)); Tg(met:GAL4,UAS:EGFP) (ed6), referred to as cmet:GFP in the text (Hall et al., 2007 (link)); s1020tEt(-0.6hsp70l:GAL4-VP16) (s1020t) and Tg(UAS:Kaede), referred to as s1020t:Kaede in the text (Scott et al., 2007 (link)). Expression constructs and novel transgenic lines were generated using the Tol2 kit (Kwan et al., 2007 (link)). Tg(mnx1:mKOFP2-CAAX) (mq7Tg) (Flanagan-Steet et al., 2005 (link); Arkhipova et al., 2012 (link); Acosta et al., 2014 (link)), referred to as mnx1:mKO2 in the text was generated using recombined p5E-mnx1 (-6 to -2869bp mnx1, Arkhipova et al., 2012 (link)), pME-mKO2caax (synthesised by GeneArt), p3E-pA (Kwan et al., 2007 (link)) and pDest-Tol2-pA2-acrys-EGFP (Berger and Currie, 2013 (link)). Tg(-3.5ubb:secAnnexinV-mVenus) (mq8Tg), referred to as ubiq:secAnnexinV-mVenus in the text was generated using recombined p5E-ubb (Mosimann et al., 2011 (link)), pMEsecAnnexinA5-NS (Addgene ID 67718), p3E-mVenus (ID 67719) and pDEST-Tol2-pA2 (Kwan et al., 2007 (link)). pME-secAnnexinA5-NS was based on the initial design of Van Ham et al. (2010 (link), 2012 (link)). It incorporates the human ANXA5 fused to a mammalian codon optimized consensus secretion signal. The ubiq:secAnnexinV-mVenus fish line expresses fluorescent AnnexinV ubiquitously throughout the zebrafish and allows the detection of any cell that expresses phosphatidylserine (PS) on the outer leaflet of the plasma membrane. PS is normally constrained to the inner leaflet of the plasma membrane and gets exposed to the outer leaflet in various conditions, including oxidative stress and apoptosis (Kuan et al., 2000 (link); Valencia and Morán, 2001 (link)).

Morsch M., Radford R., Lee A., Don E.K., Badrock A.P., Hall T.E., Cole N.J, & Chung R. (2015). In vivo characterization of microglial engulfment of dying neurons in the zebrafish spinal cord. Frontiers in Cellular Neuroscience, 9, 321.

Full text: Click here

Publication 2015

Animal Ethics Committees Animals, Transgenic Apoptosis Codon Embryo Fertilization Fishes Gal-VP16 Homo sapiens Light Mammals MET protein, human Microglia MPEG1 protein, human Nervous System Disorder Neurons Oxidative Stress Phosphatidylserines Plasma Membrane secretion Zebrafish

Transgenic Zebrafish Line Evaluation

Cited 13 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2011

Animals, Transgenic Embryo Fertilization Fishes Gal-VP16 Larva Strains Walkers Zebrafish

Zebrafish Transgenic Lines for Vascular Development

Cited 12 times

All zebrafish husbandry was performed under standard conditions in accordance with institutional (UCSF and MPG) and national ethical and animal welfare guidelines. Tg(kdrl:EGFP)^s843 (Jin et al., 2005 (link)), Tg(kdrl:NLS-EGFP)^ubs1 (Blum et al., 2008 (link)), Tg(kdrl:Has.HRAS-mcherry)^s896 (Chi et al., 2008 (link)), Tg(fli1a:EGFP)^y1 (Lawson and Weinstein, 2002 (link)), TgBAC(etv2:EGFP)^ci1 (Proulx et al., 2010 (link)), Tg(-0.8flt1:tdTomato)^hu5333 (Bussmann et al., 2010 (link)), TgBAC(flt1:YFP)^hu4624 (Hogan et al., 2009a (link)), Tg(elavl3:gal4-vp16)^psi1 (Stevenson et al., 2012 (link)), TgBAC(gfap:gfap-gfp)^zf167 (Lam et al., 2009 (link)), Tg(gfap:GFP)^mi2001 (Bernardos and Raymond, 2006 (link)), Tg(elavl3:EGFP)^knu3 (Park et al., 2000 (link)), Tg(UAS-E1b:NfsB-mCherry)^c264 (Davison et al., 2007 (link)), Tg(mpx:gal4)^sh267 (Robertson et al., 2014 (link)), Tg(-4.9sox10:EGFP)^ba2(Carney et al., 2006 (link)), Tg(hsp70l:nog3)^fr14 (Chocron et al., 2007 (link)), irf8^st96 (Shiau et al., 2015 (link)), pdgfrb^um148 (Kok et al., 2015 (link)), erbb2^st61 (Lyons et al., 2005 (link)), and flt1^fh390 (Rossi et al., 2016 (link)) were used in this study. Fish embryos/larvae were raised at 28°C.

Matsuoka R.L., Marass M., Avdesh A., Helker C.S., Maischein H.M., Grosse A.S., Kaur H., Lawson N.D., Herzog W, & Stainier D.Y. (2016). Radial glia regulate vascular patterning around the developing spinal cord. eLife, 5, e20253.

Full text: Click here

Publication 2016

Embryo Fishes FLT1 protein, human Gal-VP16 Glial Fibrillary Acidic Protein Larva Renal Adysplasia tdTomato Zebrafish

Imaging Zebrafish Development with Modulators

Cited 12 times

All cell culture, cell staining, UV irradiation, and imaging were done using MDCK cells, as previously described^{6 (link)}. Cells were treated with 10μM SKI-II (Calbiochem), 10μM JTE-013 (Tocris Bioscience), 10 μM SP600125, 10μM Gd³⁺, (both Sigma-Aldrich), or 1% DMSO as a control. Flow cytometry was done use a Beckman-Dickinson FACScan after treating cells with 1μg/250μL of propidium iodide (Sigma-Aldrich). The Huntsman Cancer Institute Tissue Resource and Applications Core provided human colon sections. Developing wild-type AB zebrafish were treated with 10mM Gd³⁺ at 28.5°C until 60hpf, and immunostained according to^{6 (link)} or filmed with a Nikon spinning disc confocal microscope using Andor software. For the photo-MO experiments, the translation blocking antisense morpholino was mixed at 1:1 molar ratio with a 25bp sense photo-morpholino and injected into 1–2 cell stage wild-type AB or Et(Gal4-VP16)^zc1044a;Tg(UAS-E1b:Kaede)^s1999t zebrafish embryos. At 28-32hpf, embryos were exposed to 350nm light for 20 seconds to release the caging sense-morpholino, then fixed and immunostained at 60 hpf.

Eisenhoffer G.T., Loftus P.D., Yoshigi M., Otsuna H., Chien C.B., Morcos P.A, & Rosenblatt J. (2012). Crowding induces live cell extrusion to maintain homeostatic cell numbers in epithelia. Nature, 484(7395), 546-549.

Publication 2012

Cell Culture Techniques Cells Colon Embryo Flow Cytometry Gal-VP16 Homo sapiens JTE 013 Light Madin Darby Canine Kidney Cells Malignant Neoplasms Microscopy, Confocal Molar Morpholinos Neoplasm Metastasis Propidium Iodide SP600125 Sulfoxide, Dimethyl Tissues Ultraviolet Rays Zebrafish

Most recents protocols related to «Gal-VP16»

Karyosome Morphology Screening in Drosophila Ovaries

To silence each candidate gene in the female germline cells, three males from the respective RNAi stock were crossed with three virgin females from the nos-GAL4-VP16 MVD1 driver line. Fly food used in crosses was supplemented with some dry yeast. The vials were incubated for 7 days at 25 °C before removing the parents. Ten days after crossing, non-balanced female progeny was selected for maturation and dissection. To stimulate oogenesis, five females were incubated in the presence of three males and dry yeast on fly food for 2–3 days at 25 °C prior to dissection.
The workflow for each candidate gene comprised four steps: (1) RNAi-mediated knockdown of the candidate gene in ovaries, (2) stimulation of oogenesis in females, (3) dissection of ovaries and DNA staining, and (4) examination of the karyosome using confocal microscopy. The ovary size of females was noted during dissection and classified as either normal, small, or no/tiny in comparison to wild-type females. In the initial round of the screen, the karyosome was examined in about six oocytes between oogenesis stage 3 and stage 9 per candidate gene. The karyosome could not be examined when the candidate gene knockdown resulted in tiny or completely underdeveloped ovaries. The karyosome was classified as “normal” when its shape was spherical, slightly deformed, or slightly elongated. The karyosome was classified as “abnormal” when the chromatin formed a strongly distorted mass or discontinuous chromatin masses. To assess how candidate gene knockdown affects karyosome morphology, both the frequency and severity of observed karyosome defects were considered. All candidate genes with dissectible ovaries were classified based on karyosome morphology. The genes were considered to have “abnormal” karyosomes, when at least three out of six examined oocytes showed abnormal karyosome morphology. In addition, when one or two oocytes showed an abnormal karyosome morphology, the genes may be considered to have “abnormal” karyosomes depending on the overall impression across the karyosomes. These genes with “abnormal” karyosomes were selected for the second round of the screen for validation of the karyosome defects.

Nieken K.J., O’Brien K., McDonnell A., Zhaunova L, & Ohkura H. (2023). A large-scale RNAi screen reveals that mitochondrial function is important for meiotic chromosome organization in oocytes. Chromosoma, 132(1), 1-18.

Full text: Click here

Publication 2023

Chromatin Dissection Females Food Gal-VP16 Gene Knockdown Techniques Genes Germ Cells Males Microscopy, Confocal Oocytes Oogenesis Ovary Parent RNA Interference Saccharomyces cerevisiae

Fertility Evaluation of Germline Gene Silencing

To test how silencing of a candidate gene in the germline affects fertility, a test vial was set up 10 days after crossing the respective RNAi fly stock with the nos-GAL4-VP16 MVD1 driver. In this vial, five females and three males from the non-balanced F1 progeny were incubated for 15 days at 25 °C before recording fertility. The F1 progeny was considered to be fertile when the number of progeny in the F2 generation was comparable to wild-type flies. When the number of F2 progeny was substantially reduced, the F1 progeny was considered to have reduced fertility. The F1 progeny was considered sterile in the complete absence of larvae or pupae.

Full text: Click here

Publication 2023

Boys Diptera Females Fertility Gal-VP16 Gene Silencing Germ Line Larva Pupa RNA Interference Sterility, Reproductive

Yeast Strains and Plasmid Construction

For the microscopy in Figs 2 and 3, yeast strains were derivatives of SEY6210a (MATa ura3-52 leu2-3, 112 his3-Δ100 trp1-Δ901 lys2-801 suc2-Δ9), obtained as a kind gift from Dr. Derek Prosser. For all other studies, yeast strain BY4742 (MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0) was used. In order to create yeast strains that activate GAL1 promoters via the addition of β-estradiol, strains were transformed with linearized pAGL (a gift from Dr. Daniel Gottschling, University of Washington), which introduces the gene encoding for the Gal4-estrogen receptor-VP16 (GEV) chimeric protein into the leu2Δ0 locus [46 (link)]. S288C yeast strains expressing either Abp1p-RFP or Abp140-3xGFP were a kind gift from Dr. Bruce Goode (Brandeis University).
To create the wBm0076-mRuby2 expressing pYES2NTA plasmid, the yomRuby2 gene was amplified from the plasmid pFA6a-link-yomRuby2-SpHis5 [87 (link)] using primers 5’- AGCTTTTCTTATAAAACAATTGATGGTGTCCAAAGGAGAGGAG and 5’- AGGGATAGGCTTAGCTGCAATTTACTTATACAATTCATCCATA, containing homology to both the C-terminus of the wBm0076 gene and the pYES2NTA-wBm0076 vector. BY4742-pAGL was co-transformed with pYES2NTA-wBm0076, previously digested with PmeI, and the mRuby2 amplicon and were plated to CSM-uracil to select for gap-repaired plasmids. Transformants were screened for red fluorescence via microscopy.
All plasmid clones were purified and sequenced for confirmation (Eton Bioscience Inc.)

Mills M.K., McCabe L.G., Rodrigue E.M., Lechtreck K.F, & Starai V.J. (2023). Wbm0076, a candidate effector protein of the Wolbachia endosymbiont of Brugia malayi, disrupts eukaryotic actin dynamics. PLOS Pathogens, 19(2), e1010777.

Full text: Click here

Publication 2023

Chimera Clone Cells Cloning Vectors derivatives Estradiol estrogen receptor alpha, human Figs Fluorescence Gal-VP16 Genes Microscopy Oligonucleotide Primers Plasmids Proteins Saccharomyces cerevisiae Strains tyrosinase-related protein-1 Uracil

Quantitative Cell-Cell Fusion Assay

On day one, 293T target cells were transfected in a 6-well plate overnight with 0.5 μg plasmid encoding a Gal4 response element driven TurboGFP-luciferase reporter (Gal4-TurboGFP-Luciferase). The 293T effector cells were transfected in a 6-well plate overnight either with 1 µg empty vector pNCS-mNeonGreen or AX571 SFVmmu-AX585 DPZ9524_1_CMVie-YFP (ST1) or DPZ9524_1_ R289hybAGMenv_CMVie-YFP (ST2) and 0.5 μg VP16-Gal4 transactivator plasmid. On day two, 16 h after transfection, the medium on the cells was completely removed and exchanged with fresh medium. Twenty-four hours after transfection, the effector cells were trypsinized and seeded in 96-well plates at 50,000 cells/well. On day three, the target cells were trypsinized and added to the effector cells. After 48 h, the cells were lysed in 65 μL 1× Luciferase Cell culture lysis buffer (E1531, Promega, Madison, WI, USA) for 20 min at room temperature and centrifuged for 10 min at 4 °C. Fifty microliters of each cell lysate were used to measure luciferase activity using the Beetle-Juice Luciferase Assay (PJK Biotech, Kleinblittersdorf, Germany) according to manufacturer’s instructions on a Biotek Synergy 2 plate reader. Four independent experiments were performed. Each experiment was normalized to fusion signal of 293T effector cells transfected just with empty vector pNCS-mNeonGreen and VP16-Gal4 fused with 293T target cells. A paired t-test was performed to compare the results of the four experiments.
For testing cell-cell fusion activity of Env expressed from CMVie promoter-driven expression plasmids, A549 target cells were transduced with the lentiviral Gal4-driven TurboGFP-luciferase reporter construct as described previously [33 (link)], and were selected using 10 µg/mL of Blasticidin for three passages prior to the experiment. On 96-well, 293T cells (30,000/well) were seeded as the effector cells. After attachment, 31.25 ng of the transactivator (Gal4-VP16) plasmid were transfected together with 93.75 ng of the respective Env expression plasmid or empty vector per well. One day post transfection, A549 target cells (40,000/well) were added to 293T effector cells. The coculture was incubated for 48 h and then processed to measure luciferase activity as described above.

Fricke T., Schlagowski S., Liu S., Yang X., Fiebig U., Kaul A., Ensser A, & Hahn A.S. (2023). Comparison of a Genotype 1 and a Genotype 2 Macaque Foamy Virus env Gene Indicates Distinct Infectivity and Cell-Cell Fusion but Similar Tropism and Restriction of Cell Entry by Interferon-Induced Transmembrane Proteins. Viruses, 15(2), 262.

Full text: Click here

Publication 2023

A549 Cells Beetles Biological Assay Buffers Cell Culture Techniques Cells Cloning Vectors Coculture Techniques Fusions, Cell Gal-VP16 HEK293 Cells Luciferases Plasmids Promega Response Elements Signal Transduction Trans-Activators Transfection VP-16

Chromatin-based In Vitro Transcription Assay

NE preparation from HeLa S3 cells, IVT and looping assays, and chromatin reconstitution of the IVT templates were conducted as described (48 (link)). All IVT assays involved 0.2 pmoles of chromatinized template, 50µg NE, and 1 pmole of activator (ERα or GAL4-VP16) or repressor (GAL4-SID) where indicated. All reactions contained 100 nM E2. The template and all reagents as indicated were mixed to a volume of 45 µL at RT to allow the formation of preinitiation complex. Transcription was initiated by addition of 5 µL NTPs mix (5 mM) and shifting the reactions to 30 °C. IVT reactions described in Fig. 3A were carried out slightly differently. The 5′biotinylated CompF chromatin was first immobilized on M280 streptavidin beads. Preinitiation complex was formed with NE without or with ERα, and the unbound proteins were washed with Buffer D. Protein-bound CompF-chromatin on beads were resuspended in 45 µL buffer mix that provided the final composition of 12 mM HEPES-KOH (pH 7.9), 12% glycerol, 60 mM KCl, 12 mM MgCl2, 0.12 mM EDTA, 0.3 mM DTT, 1 mM ATP, 0.9 mM acetyl CoA. control oligos, ASOs, and RNase H were added as indicated, and transcription was initiated with NTPs and shifting the reactions to 30 °C. After 45 min, transcription was terminated with 250 µL TriReagent. RNA was extracted, digested with DNase with the Ambion DNase-free kit as per the manufacturer’s instruction, and the RNA was used in qRT-PCR. Aqueous solutions of 1,6HD, and 2,5HD were added to the reactions prior to NTPs at final concentrations as indicated.

Panigrahi A.K., Lonard D.M, & O’Malley B.W. (2023). Enhancer–promoter entanglement explains their transcriptional interdependence. Proceedings of the National Academy of Sciences of the United States of America, 120(4), e2216436120.

Publication 2023

2',5'-oligoadenylate Biological Assay Buffers Chromatin Coenzyme A, Acetyl Deoxyribonuclease I Edetic Acid Gal-VP16 Glycerin HeLa Cells HEPES Magnesium Chloride Proteins Ribonuclease H Streptavidin Transcription, Genetic

Top products related to «Gal-VP16»

Matα4 gal vp16 by Bloomington Drosophila Stock Center

Matα4-GAL-VP16 is a genetic construct that contains the promoter from the maternal alpha4 tubulin gene fused to the yeast GAL4 transcriptional activator domain and the VP16 activation domain. This construct is used to drive high-level, ubiquitous gene expression in Drosophila.

Mmessage mmachine sp6 transcription kit by Thermo Fisher Scientific

Sourced in United States, Germany

The MMESSAGE mMACHINE SP6 Transcription Kit is a reagent kit designed for in vitro transcription of RNA using the SP6 RNA polymerase. The kit provides the necessary components to synthesize capped and/or polyadenylated RNA transcripts from DNA templates.

Pcdna3 by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Japan, Canada, France, Sweden, Netherlands, Italy, Portugal, Spain, Australia, Denmark

The PcDNA3.1 is a plasmid vector used for the expression of recombinant proteins in mammalian cells. It contains a powerful human cytomegalovirus (CMV) promoter, which drives high-level expression of the inserted gene. The vector also includes a neomycin resistance gene for selection of stable transfectants.

Phenol red solution by Merck Group

Sourced in United States

Phenol red solution is a laboratory reagent used as a pH indicator. It changes color at different pH levels, allowing for the visual determination of the acidity or basicity of a solution.

Nos gal4 vp16 by Bloomington Drosophila Stock Center

Sourced in United States

Nos-Gal4-VP16 is a genetic tool that drives the expression of target genes in the germline of Drosophila. It consists of the nanos (nos) promoter fused to the yeast Gal4 transcriptional activator and the VP16 activation domain.

Trizol by Thermo Fisher Scientific

Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines

TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.

Victor x3 multilabel plate reader by PerkinElmer

Sourced in United States, Italy

The VICTOR X3 Multilabel Plate Reader is a versatile microplate reader that can perform a variety of detection methods, including absorbance, fluorescence, and luminescence. It is designed to provide accurate and reliable data for a wide range of applications in life science research and drug discovery.

2 apb by Merck Group

Sourced in United States, Germany, United Kingdom, Canada

2-APB is a chemical compound used as a laboratory reagent. It functions as an inhibitor of inositol 1,4,5-trisphosphate (IP3) receptors, which are responsible for the release of calcium from intracellular stores. The core function of 2-APB is to modulate cellular calcium signaling processes in various experimental settings.

Slc25a46 by OriGene

SLC25A46 is a gene that encodes a mitochondrial carrier protein. This protein is involved in the transport of various metabolites and ions across the mitochondrial membrane.

Mitofilin myc by OriGene

Mitofilin-myc is a protein that is found in the mitochondria of cells. It plays a role in maintaining the structure and function of the mitochondria.

What are some common challenges researchers face when using Gal-VP16?

Are there different variations or types of Gal-VP16 available?

Yes, there are several variations of the Gal-VP16 system that researchers can utilize. For example, some studies have used modified Gal-VP16 constructs with altered DNA-binding domains or transactivation domains to fine-tune the level of target gene expression. Additionally, inducible or cell-type specific Gal-VP16 systems have been developed to provide more precise control over when and where the fusion protein is expressed.

What are some common applications of Gal-VP16 in molecular biology and biotechnology research?

Gal-VP16 is a versatile tool that has been used in a variety of applications. It is commonly employed to drive ectopic gene expression in cell culture and animal models, allowing researchers to study the effects of specific genes and pathways. Gal-VP16 has also been used to create reporter systems, actuate inducible expression systems, and engineer cell lines with tightly regulated gene expression profiles. Its ability to potently activate target genes makes it a valuable asset for genetic manipulation, cellular reprogramming, and other advanced biotechnology techniques.

How can PubCompare.ai assist researchers in optimizing their use of Gal-VP16?

PubCompare.ai's AI-driven analysis platform can help researchers optimize their use of Gal-VP16 in several ways. First, it allows you to more efficiently screen the wealth of literature, pre-prints, and patents related to Gal-VP16 protocols. The platform's intelligent comparisons can then help you identify the most effective techniques and products for your specific research goals, enabling you to choose the best options for reproducibiltiy and accuracy. By leveraging PubCompare.ai's Critical Insights, you can ensure your Gal-VP16 experiments are designed for maximal efficiency and impact, taking your studies to new heigths.

More about "Gal-VP16"

Gal-VP16, a powerful fusion protein, has become an invaluable tool in molecular biology and biotechnology research.
Composed of the DNA-binding domain from the yeast transcriptional activator GAL4 and the transactivation domain of the herpes simplex virus protein VP16, this combination enables highly efficient activation of target gene expression.
Researchers commonly utilize Gal-VP16 to drive ectopic gene expression in cell culture and animal models, allowing them to study the effects of specific genes and pathways.
Matα4-GAL-VP16, a variant of Gal-VP16, has also found use in various applications.
To optimize Gal-VP16 protocols, scientists can leverage the wealth of literature, pre-prints, and patents available.
PubCompare.ai's AI-driven analysis platform can help researchers effortlessly discover and identify the best techniques and products, taking their studies to new heights.
Beyond Gal-VP16, other related tools and reagents are also widely used in molecular biology research.
The MMESSAGE mMACHINE SP6 Transcription Kit, for example, facilitates the in vitro synthesis of capped and polyadenylated mRNA.
The pCDNA3.1 vector is a popular expression system, while Phenol red solution is a commonly used pH indicator.
Nos-Gal4-VP16, a fusion of the Gal4 DNA-binding domain and the VP16 activation domain, is another variant that has been employed in diverse research applications.
TRIzol, a reagent used for RNA extraction, and the VICTOR X3 Multilabel Plate Reader, a versatile instrument for various assays, are also relevant in this field.
Advancements in the understanding of mitochondrial biology, such as the study of the SLC25A46 protein and its interaction with Mitofilin-myc, have further expanded the horizons of molecular research.
By incorporating these insights and related terms, researchers can enhance their understanding and leverage the full potential of Gal-VP16 and associated technologies, unlocking new possibilities in their scientific endeavors.