Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > Green Fluorescent Proteins

Green Fluorescent Proteins

Green fluorescent proteins (GFPs) are a class of fluorescent proteins derived from the jellyfish Aequorea victoria.
These proteins emit a bright green fluorescence when exposed to blue or ultraviolet light, making them valuable tools in biomedical research and microscopy.
GFPs can be genetically engineered and expressed in a variety of cell types, allowing for the visualization of cellular structures, protein localization, and gene expression.
Their ability to fluoresce without the need for additional substrates or cofactors has made GFPs a popular marker for tracking and imaging in live cells and organisms.
GFPs have a wide range of applications, including cell biology, developmental biology, neuroscyence, and protein engineering.
Reseachers can optimzie their GFP experiments using PubCompar.ai, an AI-driven platform that helps locate the best protocols and products from literature, preprints, and patents, enhancing the reproducibility and accuracy of their work.

Most cited protocols related to «Green Fluorescent Proteins»

1
Efficient CRISPR Editing in Cell Lines
Cited 68 times
K562 cells (American Type Culture Collection) were cultured in RPMI 1640 (Gibco) supplemented with 10% fetal bovine serum (FBS, HyClone), 1% penicillin/streptomycin. A pool of K562 cells stably expressing green fluorescent protein (GFP) was generated by transduction with the lentivirus construct pCCLsin.PPT.hPGK.GFP.pre (10 (link)). Because the lentiviral construct integrates randomly, the distribution of GFP expression levels is broad. This cell pool also includes cells that that were not transduced and do not express GFP at all. For transient transfection with CRISPR vectors, 1 × 106 K562 cells were resuspended in Nucleofector Solution V (Lonza) with 1 μg plasmid DNA, and electroporated in an Amaxa 2D Nucleofector using program T-016. In case of LBR editing, a clonal K562 line stably transformed with Cas9 was used.
Human retinal pigment epithelial (RPE) cells were cultured in a 1:1 mixture of Dulbecco's modified Eagle's medium (Gibco) with Nutrient F12 (Gibco) supplemented with 10% FBS (HyClone), 1% penicillin/streptomycin. CRISPR vectors were transfected with 5 μl Lipofectamine 2000 Reagent (Invitrogen) and 2.5 μg plasmid DNA in 250 μl antibiotic-free medium (Gibco).
Kc167 cells were cultured in Shields and Sang M3 Insect Medium (Sigma-Aldrich) with 0.25% Bacto Peptone (BD), 0.1% Yeast Extract (BD), 5% heat-inactivated FBS and 1% penicillin/streptomycin. Note that 1 × 106 cells were electroporated with 1 μg each of Cas9 and sgRNA expression plasmid using a BioRad Gene Pulser II (450 μF, 86 V).
Brinkman E.K., Chen T., Amendola M, & van Steensel B. (2014). Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Research, 42(22), e168.
Full text: Click here
Publication 2014
5-hydroxyethoxy-N-acetyltryptamine Antibiotics Bacto-peptone Cells Clone Cells Cloning Vectors Clustered Regularly Interspaced Short Palindromic Repeats Epithelial Cells Genes Genetic Vectors Green Fluorescent Proteins Homo sapiens Insecta K562 Cells Lentivirus lipofectamine 2000 Nutrients Penicillins Plasmids Retinal Pigments Streptomycin Transients Yeast, Dried
2
FRET Biosensor Assay in HeLa and Cos7 Cells
Cited 35 times
HeLa cells were purchased from the Human Science Research Resources Bank (Sennanshi, Japan). The Cos7 cells used were Cos7/E3, a subclone of Cos7 cells established by Y. Fukui (National Research Institute of Health, Taiwan, Republic of China). HeLa cells and Cos7 cells were maintained in DMEM (Sigma-Aldrich, St. Louis, MO) supplemented with 10% FBS. The cells were plated on 35-mm glass base dishes or 96-well glass base plates (Asahi Techno Glass, Tokyo, Japan), which were coated with collagen type I (Nitta Gelatin, Osaka, Japan). Plasmids encoding FRET biosensors were transfected into HeLa cells and Cos7 cells by 293fectin or Lipofectamine 2000, according to the manufacturer's instructions (Invitrogen, San Diego, CA), respectively. EGF was purchased from Sigma-Aldrich. dbcAMP, TPA, Calyculin A, Anisomycin, PD153035, and JNK inhibitor VIII were purchased from Calbiochem (La Jolla, CA). PD184352 was obtained from Toronto Research Chemicals (Ontario, Canada). BI-D1870 was purchased from Symansis (Shanghai, China). Rapamycin was obtained from LC Laboratories (Woburn, MA). PLX-4720 was purchased from Selleck Chemicals (Houston, TX). The expression vector of piggyBac transposase was provided by A. Bradley (Wellcome Trust Sanger Institute, Cambridge, UK; Yusa et al., 2009 (link)). Phos-tag was obtained from the Phos-tag Consortium (Hiroshima, Japan; www.phos-tag.com). Anti-green fluorescence protein (GFP) sera were prepared in our laboratory. LI-COR (Lincoln, NE) blocking buffer and the IRDye680- and IRDye800-conjugated anti–rabbit and anti–mouse immunoglobulin G secondary antibodies were obtained from LI-COR.
Komatsu N., Aoki K., Yamada M., Yukinaga H., Fujita Y., Kamioka Y, & Matsuda M. (2011). Development of an optimized backbone of FRET biosensors for kinases and GTPases. Molecular Biology of the Cell, 22(23), 4647-4656.
Publication 2011
1,3-bis(bis(pyridin-2-ylmethyl)amino)propan-2-ol Anisomycin Anti-Antibodies BI D1870 Biosensors Bucladesine Buffers calyculin A Cells Cloning Vectors Collagen Type I Fluorescence Resonance Energy Transfer Gelatins Green Fluorescent Proteins HeLa Cells Hyperostosis, Diffuse Idiopathic Skeletal Immunoglobulin G IRDye800 lipofectamine 2000 Manpower Mus PD 153035 PD 184352 Plasmids PLX 4720 Rabbits Serum Sirolimus Transposase
3
Ubiquitous Green Fluorescent Actin Visualization
Cited 35 times
Based on our success using a green fluorescent protein (GFP) fused to an actin binding protein, we constructed a second generation fusion protein. It consists of humanized (for codon bias) GFP containing the S65T mutation (CLONTECH Laboratories), which speeds protein folding and increases the quantum efficiency of the GFP, fused to the same fragment of moesin that includes the extended helical region and the actin binding sequences (Edwards et al. 1997). Our original construct (called hsGFPmoe) used a heat shock driven promoter because we feared that constitutive expression of the moesin fusion construct might have deleterious effects on fly development. Based on our observations that flies harboring the hsGFPmoe transgene could be heat-shocked daily and still survive as a viable stock, we used a promoter/enhancer construct from the ubiquitously expressed spaghetti squash gene, which encodes the single, nonmuscle myosin II regulatory light chain (Karess et al. 1991; Wheatley et al. 1995; Edwards and Kiehart 1996; Jordan and Karess 1997). This construct, called sGMCA, was used to establish stable transgenic fly lines through P element–based germ line transformation. The construct appears to be expressed ubiquitously and does not appear to be deleterious to any aspect of fly development or behavior, although the stocks are not as robust as our healthiest stocks (e.g., wild-type Oregon R or w1118). The line that we use most is called sGMCA-3.1 and has the transgene construct inserted on the third chromosome, but other insertions behave in an indistinguishable fashion. Fly stocks can be established in which the sGMCA-3.1 chromosome is homozygous, demonstrating that the transgenic construct is inserted in a nonessential part of the genome. The complete sequence of sGMCA in its P element vector is provided as Supplemental Figure 1 (sGMCA sequence and annotation), which is available at http://www. jcb.org/cgi/content/full/149/2/471/DC1.
Kiehart D.P., Galbraith C.G., Edwards K.A., Rickoll W.L, & Montague R.A. (2000). Multiple Forces Contribute to Cell Sheet Morphogenesis for Dorsal Closure in Drosophila. The Journal of Cell Biology, 149(2), 471-490.
Publication 2000
Actin-Binding Protein Actins Animals, Transgenic Chromosomes Cloning Vectors Codon Bias Genes, vif Genome Germ Line Green Fluorescent Proteins Heat-Shock Response Helix (Snails) Homozygote Insertion Mutation moesin Mutation Myosin Regulatory Light Chain Phosphorus Proteins Squashes Stable Fly Transgenes
4
Generation of Spike Pseudotyped Viral Particles
Cited 28 times
To produce seed particles (VSVΔG-luc/GFP + VSV-G), 293T cells were seeded in six-well plates and transfected 24 h later with 2 µg VSV-luc/GFP, 2 µg T7 polymerase, 0.5 µg VSV-N, 0.25 µg VSV-L, 1.25 µg VSV-P and 1 µg VSV-G. VSV seed particles were harvested 48 h post-transfection. Cell supernatants were collected, cleared from cell debris by centrifugation, aliquoted and stored at −80 °C.
CoV spike pseudotypes were produced as previously described31 (link). 293T cells were seeded onto six-well plates pre-coated with poly-l-lysine (Sigma–Aldrich) and transfected the next day with 1,200 ng of empty plasmid and 400 ng of plasmid encoding coronavirus spike or green fluorescent protein (GFP) as a no-spike control. After 24 h, transfected cells were infected with VSVΔG particles pseudotyped with VSV-G, as previously described37 (link). After 1 h of incubating at 37 °C, cells were washed three times and incubated in 2 ml DMEM supplemented with 2% FBS, penicillin/streptomycin and l-glutamine for 48 h. Supernatants were collected, centrifuged at 500g for 5 min, aliquoted and stored at −80 °C.
Letko M., Marzi A, & Munster V. (2020). Functional assessment of cell entry and receptor usage for SARS-CoV-2 and other lineage B betacoronaviruses. Nature Microbiology, 5(4), 562-569.
Publication 2020
Cells Centrifugation Coronavirus G-substrate Glutamine Green Fluorescent Proteins HEK293 Cells Lysine Penicillins Plasmids Poly A Streptomycin Transfection
5
Batch Effect Correction in RNA-seq Data
Cited 23 times
We applied the proposed ComBat-seq approach on an RNA-seq data from a perturbation experiment using primary breast tissue attempting to profile the activity levels of growth factor receptor network (GFRN) pathways in relation to breast cancer progression (13 (link),14 (link)). We took a subset of experiments, which consists of three batches. In each batch, the expression of a specific GFRN oncogene was induced by transfection to activate the downstream pathway signals (different oncogene/pathway in each batch). Controls were transfected with a vector that expresses a green fluorescent protein (GFP), and GFP controls were present in all batches. More specifically, batch 1 contains five replicates of cells overexpressing HER2, and 12 replicates for GFP controls (GEO accession GSE83083); batch 2 contains six replicates of each for EGFR and its corresponding controls (GEO accession GSE59765); batch 3 consists of nine replicates of each for wild-type KRAS and GFP controls (GEO accession GSE83083).
Note that this is a challenging study design for batch effect adjustment: the control samples are balanced across batches, while each of the 3 kinds of treated cells, with different levels of biological signals, is completely nested within a single batch. A favorable adjustment would pool control samples from the three batches, while keeping all treated cells separated from the controls and from each other.
We combined the three batches and performed batch correction. Among the batch correction methods considered, only RUV-seq, the original ComBat used on logged and normalized data and ComBat-seq output adjusted data. We apply these methods to address the batch effects in the pathway signature dataset. We compared ComBat-seq with the other methods, both qualitatively through principal component analysis (PCA) and quantitatively with explained variations by condition and batch.
The ‘one-step’ approach and SVA-seq are not considered in PCA because they do not generate adjusted data after batch correction. For RUV-seq, we do not know which genes are appropriate for negative control genes, unlike in the simulation studies. Therefore, we used the RUVs method, which is more robust to the choices of negative control genes than RUVg (3 (link)). We computed the least DE genes within each batch for the 3 activated pathways (FDR > 0.95), and took the overlapping genes across pathways as the negative controls.
Zhang Y., Parmigiani G, & Johnson W.E. (2020). ComBat-seq: batch effect adjustment for RNA-seq count data. NAR Genomics and Bioinformatics, 2(3), lqaa078.
Full text: Click here
Publication 2020
Biopharmaceuticals Breast Cells Cloning Vectors Disease Progression EGFR protein, human ERBB2 protein, human Gene Expression Regulation Genes Genes, Overlapping Green Fluorescent Proteins Growth Factor Receptors K-ras Genes Malignant Neoplasm of Breast Oncogenes RNA-Seq Tissues Transfection

Most recents protocols related to «Green Fluorescent Proteins»

1
Delivery of Labeled mRNA by 3E10 in K562 Cells
Not available on PMC !

Example 4

Materials and Methods

Labeled mRNA (by attachment to cyanine 5, Cy5) (2 ug) alone or labeled mRNA complexed with 3E10 (2.5, 5, and 10 uM), were mixed at room temperature for 5 minutes. The suspensions of 3E10 plus mRNA, or mRNA alone, were added to 200,000 K562 cells in serum free media. Additional serum free media was added to a final volume of 500 ul. Following incubation with cells at 37° C. for 24 hrs, the cells were centrifuged and washed three times with PBS prior to analysis by flow cytometry.

Results

The results are illustrated in flow cytometry dot plots (FIG. 4A-4H). % uptake was quantified (FIG. 4I).

The results show increased uptake of mRNA when mixed with 3E10. Note that delivery of mRNA by the D31N variant of 3E10 resulted in the highest levels of mRNA cell uptake.

Fluorescent microscopy showed functional GFP expression in U2OS cells after translation of the same Cy5 labeled mRNA, which encodes for a green fluorescent protein (GFP) reporter.

US11872286B2. Compositions and methods for delivery of nucleic acids to cells (2024-01-16). Yale University [US]. Inventors: Elias Quijano [US], Peter Glazer [US].
Full text: Click here
Patent 2024
Cells Culture Media, Serum-Free Flow Cytometry Green Fluorescent Proteins K562 Cells Microscopy Obstetric Delivery RNA, Messenger
2
Modified mRNA for Efficient and Safe Protein Expression
Not available on PMC !

Example 6

Modified nucleotides can increase the translational efficiency and reduce cellular toxicity caused by the immunogenic response to exogenous mRNA. Here, 4 different representative modified nucleotide compositions (FIG. 30) can be included in the cell-selective mRNA. Each of the modified nucleotides can be used as a complete substitute for the unmodified nucleotides to achieve the maximum effect. Modified and unmodified mRNA can be synthesized with a 5′ cap using an ARCA cap analog (TriLink) and PolyA tail using reagents to increase the stability of the mRNAs (TriLink).

To determine if modified nucleic acids affect target site recognition, modified and unmodified mRNA encoding green fluorescent protein (GFP) or luciferase (Luc) followed by 4 target sequences (TS) for miR-126, miR-143 or control scrambled sequences will be transcribed in vitro by T7 RNA polymerase (FIG. 5).

US11857598B2. Self-replicating cell selective gene delivery compositions, methods, and uses thereof (2024-01-02). University of South Florida [US]. Inventors: Hana Totary-Jain [US].
Full text: Click here
Patent 2024
Antigens bacteriophage T7 RNA polymerase Cells Genes, Duplicate Green Fluorescent Proteins Luciferases Nucleic Acids Nucleotides Obstetric Delivery Poly(A) Tail Protein Biosynthesis RNA, Messenger
3
Lentiviral Transduction of Jurkat Cells
Not available on PMC !

Example 2

CAR-T constructs in pLenti6.3/V5-DEST were purified using the PureLink HQ plasmid purification kit (Life Technology). CAR-T plasmids were lipofected into 293-FT cells with ViraPower packaging plasmids (Life Technologies) according to the manufacturer's protocol. After 48-72 hours, cell supernatant containing live Lentivirus was harvested. Optionally, the virus was concentrated using Lenti-X Concentrator (Clontech), according to the manufacturer's protocol.

Jurkat E6.1 cells were grown in RPMI (Sigma), 10% foetal bovine serum, 2 mM L-glutamine

Jurkat E6.1 cells were transduced for 48-72 hours with viral supernatant in a 50:50 mix of HEK cell supernatant:Jurkat medium: cells at a final concentration of 5×105/ml.

A non-CAR-T construct containing the open reading frame of the Green Fluorescent Protein (GFP) was included as a control. Note that this construct gives cytoplasmic expression.

US11866510B2. Chimeric antigen receptor with single domain antibody (2024-01-09). CRESCENDO BIOLOGICS LIMITED [GB]. Inventors: Brian McGuinness [GB], Colette Johnston [GB].
Full text: Click here
Patent 2024
Cells Cytoplasm Fetal Bovine Serum Glutamine Green Fluorescent Proteins Jurkat Cells Lentivirus Plasmids Virus
4
Molecular Cloning of Murine Immune Receptors
Not available on PMC !

Example 2

The full-length murine NKG2D cDNA was purchased from Open Biosystems (Huntsville, AL). Murine CD3ζ chain, Dap10 and Dap12 cDNAs were cloned by RT-PCR using RNAs from ConA- or IL-2 (1000 U/mL)-activated spleen cells as templates. Mouse NKG2D ligands Rae-1p and H60 were cloned from YAC-1 cells by RT-PCR. All PCR reactions were performed using high-fidelity enzyme Pfu or PFUULTRA™ (STRATAGENE@, La Jolla, CA). The oligonucleotides employed in these PCR reactions are listed in Table 9.

TABLE 9
SEQ
ID
No.PrimerSequenceNO:
15′ wtNKG2DGCGAATTCGCCACCATGGCATTGATTCGTGATCGA8
23′ wtNKG2DGGCGCTCGAGTTACACCGCCCTTTTCATGCAGAT9
35′ chNKG2DGGCGAATTCGCATTGATTCGTGATCGAAAGTCT10
45′ wtDAP10GCAAGTCGACGCCACCATGGACCCCCCAGGCTACC11
53′ wtDAP10GGCGAATTCTCAGCCTCTGCCAGGCATGTTGAT12
63′ chDAP10GGCAGAATTCGCCTCTGCCAGGCATGTTGATGTA13
75′ wtDAP12GTTAGAATTCGCCACCATGGGGGCTCTGGAGCCCT14
83′ wtDAP12GCAACTCGAGTCATCTGTAATATTGCCTCTGTG15
95′ ATG-CD3ζGGCGTCGACACCATGAGAGCAAAATTCAGCAGGAG16
103′ ATG-CD3ζGCTTGAATTCGCGAGGGGCCAGGGTCTGCATAT17
115′ CD3ζ-TAAGCAGAATTCAGAGCAAAATTCAGCAGGAGTGC18
123′ CD3ζ-TAAGCTTTCTCGAGTTAGCGAGGGGCCAGGGTCTGCAT19
135′ Rae-1GCATGTCGACGCCACCATGGCCAAGGCAGCAGTGA20
143′ Rae-1GCGGCTCGAGTCACATCGCAAATGCAAATGC21
155′ H60GTTAGAATTCGCCACCATGGCAAAGGGAGCCACC22
163′ H60GCGCTCGAGTCATTTTTTCTTCAGCATACACCAAG23

Restriction sites inserted for cloning purposes are underlined.

Chimeric NKG2D was created by fusing the murine CD3 chain cytoplasmic region coding sequence (CD3′-CYP) to the full-length gene of murine NKG2D. Briefly, the SalI-EcoRI fragment of CD3′-CYP (with the initiation codon ATG at the 5′ end, primer numbers 9 and 10) and the EcoRI-XhoI fragment of NKG2D (without ATG, primer numbers 2 and 3) were ligated into the SalI/XhoI-digested pFB-neo retroviral vector (STRATAGENE®, La Jolla, CA). Similarly, chimeric Dap10 was generated by fusing the SalI-EcoRI fragment of full-length Dap10 (primer numbers 4 and 6) to the EcoRI-XhoI fragment of CD3ζ-CYP (primer numbers 11 and 12). Wild-type NKG2D (primer numbers 2 and 3), Dap10 (primer numbers 4 and 5) and Dap12 (primer numbers 7 and 8) fragments were inserted between the EcoRI and XhoI sites in pFB-neo. In some cases, a modified vector pFB-IRES-GFP was used to allow co-expression of green fluorescent protein (GFP) with genes of interest. pFB-IRES-GFP was constructed by replacing the 3.9 kb AvrUScaI fragment of pFB-neo with the 3.6kb AvrII/ScaI fragment of a plasmid GFP-RV(Ouyang, et al. (1998) Immunity 9:745-755). Rae-1β (primer numbers 13 and 14) and H60 (primer numbers 15 and 16) cDNAs were cloned into pFB-neo. Constructs containing human NKD2D and human CD3ζ or murine Fc were prepared in the same manner using the appropriate cDNAs as templates.

US11858976B2. Nucleic acid constructs encoding chimeric NK receptor, cells containing, and therapeutic use thereof (2024-01-02). THE TRUSTEES OF DARTMOUTH COLLEGE [US]. Inventors: Tong Zhang [CN], Charles L Sentman [US].
Full text: Click here
Patent 2024
Cells Chimera Cloning Vectors Codon, Initiator Concanavalin A Cytoplasm Deoxyribonuclease EcoRI DNA, Complementary Enzymes Genes Green Fluorescent Proteins Homo sapiens Internal Ribosome Entry Sites Ligands Mus Oligonucleotide Primers Oligonucleotides Open Reading Frames Plasmids Response, Immune Retroviridae Reverse Transcriptase Polymerase Chain Reaction RNA Spleen
5
Electrochemical pH Modulation of GFP
Not available on PMC !

Example 5

Electrode material used: The electrode material was indium tin oxide. The fluorescent protein used is GFP immobilized on a glass substrate which includes an array of electrodes. The GFP is applied as spots, each spot covers an area that overlaps with one electrode and an area that is not overlapping with an electrode.

The pH change at the surface of ITO working electrode is generated via current-driven oxidation of a redox active molecule, 2-methyl-1,4-dihydroquinone, in diluted phosphate buffer (pH=7.4) containing 0.1M Na2SO4. After 10 seconds of induction, current (50 microamps) was applied for 30 second, which resulted in a drop of solution pH to 5.5, as was observed by a change in GFP fluorescence intensity. FIG. 10 is used as calibration curve to assess the pH values. After current was turned off, the pH recovered to neutral value within 50 seconds (as shown in FIGS. 11 and 12B).

US11867660B2. Electronic control of the pH of a solution close to an electrode surface (2024-01-09). Robert Bosch GmbH [DE]. Inventors: Christopher Johnson [US], Sam Kavusi [US], Nadezda Fomina [US], Habib Ahmad [US], Autumn Maruniak [US], Christoph Lang [US], Ashwin Raghunathan [US], Young Shik Shin [US], Armin Darvish [US], Efthymios Papageorgiou [US].
Full text: Click here
Patent 2024
Buffers dihydroquinone Exanthema Figs Fluorescence Green Fluorescent Proteins indium tin oxide Neoplasm Metastasis Oxidation-Reduction Phosphates Proteins

Top products related to «Green Fluorescent Proteins»

1
Lipofectamine 2000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
2
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
3
Polybrene by Merck Group
Sourced in United States, Germany, China, Sao Tome and Principe, United Kingdom, Macao, Canada, France, Japan, Switzerland, Italy, Australia, Netherlands, Morocco, Israel, Ireland, Belgium, Denmark, Norway
Polybrene is a cationic polymer used as a transfection reagent in cell biology research. It facilitates the introduction of genetic material into cells by enhancing the efficiency of DNA or RNA uptake.
4
Lipofectamine 3000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, Japan, United Kingdom, France, Canada, Italy, Australia, Switzerland, Denmark, Spain, Singapore, Belgium, Lithuania, Israel, Sweden, Austria, Moldova, Republic of, Greece, Azerbaijan, Finland
Lipofectamine 3000 is a transfection reagent used for the efficient delivery of nucleic acids, such as plasmid DNA, siRNA, and mRNA, into a variety of mammalian cell types. It facilitates the entry of these molecules into the cells, enabling their expression or silencing.
5
Dulbecco modified eagle medium (dmem) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.
6
Penicillin streptomycin by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia
Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.
7
Penicillin by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, France, Canada, Japan, Australia, Switzerland, Italy, Israel, Belgium, Austria, Spain, Brazil, Netherlands, Gabon, Denmark, Poland, Ireland, New Zealand, Sweden, Argentina, India, Macao, Uruguay, Portugal, Holy See (Vatican City State), Czechia, Singapore, Panama, Thailand, Moldova, Republic of, Finland, Morocco
Penicillin is a type of antibiotic used in laboratory settings. It is a broad-spectrum antimicrobial agent effective against a variety of bacteria. Penicillin functions by disrupting the bacterial cell wall, leading to cell death.
8
Streptomycin by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, France, Canada, Australia, Japan, Switzerland, Italy, Belgium, Israel, Austria, Spain, Netherlands, Poland, Brazil, Denmark, Argentina, Sweden, New Zealand, Ireland, India, Gabon, Macao, Portugal, Czechia, Singapore, Norway, Thailand, Uruguay, Moldova, Republic of, Finland, Panama
Streptomycin is a broad-spectrum antibiotic used in laboratory settings. It functions as a protein synthesis inhibitor, targeting the 30S subunit of bacterial ribosomes, which plays a crucial role in the translation of genetic information into proteins. Streptomycin is commonly used in microbiological research and applications that require selective inhibition of bacterial growth.
9
Puromycin by Merck Group
Sourced in United States, Germany, China, Sao Tome and Principe, United Kingdom, Macao, Canada, Japan, Italy, Switzerland, France, Israel, Australia, Spain, Belgium, Morocco, Sweden
Puromycin is a laboratory product manufactured by Merck Group. It functions as an antibiotic that inhibits protein synthesis in eukaryotic cells.
10
Lipofectamine 2000 reagent by Thermo Fisher Scientific
Sourced in United States, China, Germany, Canada, United Kingdom, Japan, France, Italy, Australia, Switzerland, Spain, Netherlands, Singapore, Cameroon, Colombia, Denmark, Lithuania
Lipofectamine 2000 reagent is a cationic lipid-based transfection reagent used for the delivery of nucleic acids, such as DNA and RNA, into eukaryotic cells. It facilitates the uptake of these molecules by the cells, enabling efficient gene expression or gene silencing studies.

More about "Green Fluorescent Proteins"

Fluorescent proteins, such as Green Fluorescent Proteins (GFPs), have become invaluable tools in biomedical research and microscopy.
These remarkable proteins, derived from the jellyfish Aequorea victoria, emit a bright green fluorescence when exposed to blue or ultraviolet light, allowing scientists to visualize cellular structures, track protein localization, and monitor gene expression.
GFPs can be genetically engineered and expressed in a wide variety of cell types, making them a versatile marker for live-cell imaging.
Their ability to fluoresce without the need for additional substrates or cofactors has made them a popular choice among researchers, as they can be easily incorporated into experimental systems.
To optimize your GFP experiments, you can leverage advanced AI-driven platforms like PubCompar.ai.
This innovative tool helps researchers locate the best protocols and products from literature, preprints, and patents, enhancing the reproducibility and accuracy of their work.
By utilizing PubCompar.ai, you can access a wealth of information on GFP-related techniques, including the use of transfection reagents like Lipofectamine 2000, Lipofectamine 3000, and Polybrene, as well as media components such as DMEM, FBS, and Penicillin/Streptomycin.
Whether you're studying cell biology, developmental biology, neuroscience, or engaging in protein engineering, GFPs and PubCompar.ai can be invaluable resources for your research.
Harness the power of these tools to take your GFP experiments to new heights and push the boundaries of scientific discovery.