Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > GRP94

GRP94

GRP94, or glucose-regulated protein 94, is a molecular chaperone and heat shock protein that plays a crucial role in protein folding and the unfolded protein response.
It is involved in the proper assembly and maturation of various client proteins, including cell surface receptors and signaling molecules.
GRP94 is upregulated in response to cellular stress, such as glucose deprivation, and helps maintain protein homeostasis within the endoplasmic reticulum.
Dysregulation of GRP94 has been implicated in a variety of disease states, including cancer, neurodegeneration, and autoimmune disorders.
Reserach on GRP94 can provide valuable insights into cellular stress pathways and potential therapeutic targets.

Most cited protocols related to «GRP94»

1
Sequential Detergent Extraction for Polysome Fractionation
Cited 11 times
This method takes advantage of the relatively high cholesterol content of the plasma membrane, as compared to other cellular membranes. Digitonin is a ß-sterol binding detergent that selectively solubilizes the plasma membrane, leaving the ER- and nuclear membranes intact. Hence, sequential treatment with digitonin followed by a more lytic detergent, such as an NP-40/DOC cocktail, yields cytosolic- and membrane-bound polysome fractions, respectively (schematically illustrated in Fig. 1A). The various steps of the sequential detergent extraction procedure have been validated by immunofluorescene microscopy, where it can be seen that disruption of the plasma membrane with digitonin results in the release of (depolymerized) tubulin, without effect on the ER, the actin cytoskeleton, or the intermediate filament network (Fig. 1 B). Following addition of the ER lysis buffer, the ER fraction is recovered in a soluble fraction and the nuclei, actin cytoskeleton, and intermediate filament network remain (Fig. 1B). Companion immunoblot analyses of marker protein distributions show that the cytosolic proteins GAPDH and tubulin are present in the cytosol fraction, as expected, and the ER-membrane proteins, TRAPα and ER-lumenal protein, GRP94 are present in the ER fraction (Fig. 2 A). The NP-40 insoluble material consists primarily of nuclear and cytoskeletal elements, as evidenced by the marker proteins histone H3 and actin, respectively (Fig. 2 A). Similarly, Northern blot analysis of the mRNA composition of the cytosol and membrane fractions show that the cytosol fraction is enriched for mRNAs encoding histone (H3F3A) and GAPDH, whereas the membrane fraction is enriched in mRNAs encoding ER resident proteins, such as GRP94 and calreticulin (Fig. 2 B).
The method described below is for cells grown in monolayer. However, the protocol can be easily adapted for non-adherent cells by performing permeabilization, wash and lysis in suspension and pelleting cells at 3000 × g for 5 minutes between the different steps. The volumes of reagents mentioned in the following protocol are scaled to extract polysomes from 10 million cells.
Jagannathan S., Nwosu C, & Nicchitta C.V. (2011). Analyzing Subcellular mRNA Localization via Cell Fractionation. Methods in molecular biology (Clifton, N.J.), 714, 301-321.
Publication 2011
Actins Buffers Calreticulin Cell Nucleus Cells Cytoskeleton Cytosol Detergents Digitonin GAPDH protein, human Gastrin-Secreting Cells GRP94 Histone H3 Histones Hypercholesterolemia Immunoblotting Intermediate Filaments Membrane Proteins Microfilaments Microscopy Nonidet P-40 Northern Blotting Nuclear Envelope Pets Plasma Membrane Polyribosomes Proteins RNA, Messenger Sterols Tissue, Membrane Tubulin Vision
2
Quantitative RT-PCR Analysis of UPR Genes
Cited 11 times
Total cellular RNA was isolated either by RNeasy (Qiagen, Valencia, California, United States) or Trizol reagent (Invitrogen). For Xbp1 RT-PCR, the Titan One-Tube RT-PCR kit (Roche) was used along with primers flanking the Xbp1 intron to amplify both spliced and unspliced Xbp1. Real-time RT-PCR was performed by first generating cDNAs using the iScript kit (Bio-Rad), which uses random primers. cDNA was then diluted (the extent varied based on the amount of starting RNA) and amplified by PCR in an iCycler (Bio-Rad) using iQ SYBR Green Supermix (Bio-Rad). For each primer set used, a dilution series of cDNA was first established to verify that amplification efficiency was near 100%, and to establish the linear range for the primer pair. Reaction products were separated by DNA electrophoresis to confirm that the amplified product was the correct size. For real-time reactions, a melt-curve analysis was performed at the end of the reaction to confirm the amplification of a single product with no primer dimers. Real-time reactions also included a control where no reverse transcriptase was included in the cDNA synthesis reaction, to exclude amplification of genomic DNA. Each primer pair was designed to span an intron. Primer pairs used were: 18S rRNA: cgcttccttacctggttgat and gagcgaccaaaggaaccata; Chop: ctgcctttcaccttggagac and cgtttcctggggatgagata; Gadd34: gagattcctctaaaagctcgg and cagggacctcgacggcagc; β-actin: gatctggcaccacaccttct and ggggtgttgaaggtctcaaa; BiP: catggttctcactaaaatgaaagg and gctggtacagtaacaactg; Grp94: aatagaaagaatgcttcgcc and tcttcaggctcttcttctgg; Atf4: atggccggctatggatgat and cgaagtcaaactctttcagatccatt; p58IPK: tcctggtggacctgcagtacg and ctgcgagtaatttcttcccc; and Uggt1: gctttggtgtgaaacgtg and cagtttgggctccttagtc. Although the absolute extent of up-regulation for any gene varied somewhat from experiment to experiment, the trends of their expression changes were consistent.
Rutkowski D.T., Arnold S.M., Miller C.N., Wu J., Li J., Gunnison K.M., Mori K., Sadighi Akha A.A., Raden D, & Kaufman R.J. (2006). Adaptation to ER Stress Is Mediated by Differential Stabilities of Pro-Survival and Pro-Apoptotic mRNAs and Proteins. PLoS Biology, 4(11), e374.
Full text: Click here
Publication 2006
Actins Anabolism ATF4 protein, human Cells DDIT3 protein, human DNA, Complementary Electrophoresis Genes Genome GRP94 Introns Oligonucleotide Primers Real-Time Polymerase Chain Reaction Reverse Transcriptase Polymerase Chain Reaction RNA, Ribosomal, 18S RNA-Directed DNA Polymerase SYBR Green I Technique, Dilution trizol X-box binding protein 1, human
3
Chondrocyte Isolation and Gene Expression Analysis
Cited 10 times
For qRT-PCR, the rib cages from 5-day-old mice (wild type (wt) and mutant (m/m)) were dissected and treated with collagenase (type 1A, 2 mg/ml) for 1 h at 37°C in Dulbecco’s modified Eagle’s medium (DMEM). The costal cartilage was dissected from individual ribs, and the perichondrium layer was removed. The cartilage was digested a second time with collagenase for 3 h to remove the collagen matrix and release the chondrocytes. The chondrocytes were passed through a cell strainer (70 μm) and washed with DMEM containing 10% FBS and following centrifugation washed again with PBS. The cell pellet was resuspended in 500 μl TriZol (Invitrogen), and total RNA was isolated according to the manufacturer’s instructions. First-strand cDNA was synthesised using random hexamer primers (Superscript III, Invitrogen), and qPCR was performed using the SYBR® green PCR protocol. Primer sequences were: BiP: 5′-ggcaccttcgatgtgtctcttc-3′ and rev: 5′-tccatgacccgctgatcaa-3′; Grp94: 5′-taagctgtatgtacgccgcgt-3′ and rev: 5′-ggagatcatcggaatccacaac-3′; Calnexin: 5′-tga ttt cct ctc cct ccc ctt-3′ and rev: 5′-cac tgg aac ctg ttg atg gtg a-3′; Calreticulin: 5′-gct acg tga agc tgt ttc cga-3′ and rev: 5′-aca tga acc ttc ttg gtg cca g-3’; Erp72: 5′-agt atg agc cca ggt tcc acg t-3′ and rev: 5′-aga agt ctt acg atg gcc cac c-3′. Each experiment included ‘no template’ controls, was run in duplicate and had an 18S RNA control. Each independent experiment was repeated three times, and the results were analysed by independent-samples t test.
For Western blot analysis, chondrocytes were isolated as above, but aliquots of 2 × 105 chondrocytes were prepared and resuspended in 5× sodium dodecyl sulphate (SDS) loading buffer containing DTT. These protein aliquots were separated by 4–12% SDS-polyacrylamide gel electrophoresis (PAGE; Invitrogen) then transferred to nitrocellulose membranes for Western blot analysis. Ponceau staining was used to confirm equal loading of total protein isolates.
Antibodies to key chaperones associated with the unfolded protein response were used at a dilution of either 1:500 (BiP, Grp94, Erp72 and PDI; all from Santa Cruz) or 1:100 (ATF-6 from Imgenex and Bcl-2 from Abcam).
Nundlall S., Rajpar M.H., Bell P.A., Clowes C., Zeeff L.A., Gardner B., Thornton D.J., Boot-Handford R.P, & Briggs M.D. (2010). An unfolded protein response is the initial cellular response to the expression of mutant matrilin-3 in a mouse model of multiple epiphyseal dysplasia. Cell Stress & Chaperones, 15(6), 835-849.
Publication 2010
Antibodies BCL2 protein, human Buffers Calnexin Calreticulin Cartilage Cells Centrifugation Chondrocyte Collagen Collagenase Costal Cartilage DNA, Complementary Eagle endoplasmic reticulum glycoprotein p72 GRP94 Molecular Chaperones Mus Nitrocellulose Oligonucleotide Primers Proteins Rib Cage Ribs RNA, Ribosomal, 18S SDS-PAGE Sulfate, Sodium Dodecyl SYBR Green I Technique, Dilution Tissue, Membrane trizol Unfolded Protein Response Western Blot
4
Immunoblot and Dot-Blot Analysis of Brain Tissues
Cited 9 times
Immunoblot and dot-blot analysis of mice and human brain tissues were performed as previously described (Lee et al., 2002 (link); Li et al., 2004 (link); Li et al., 2005 (link); Martin et al., 2006 (link); Wang et al., 2008 (link)). For dot-blot analysis, lysates were spotted directly on the nitrocellulose membrane and let it dry completely. Immunoreactivity was visualized using chemiluminescence detection (Pierce, Rockford, IL) after incubations with the appropriate horseradish peroxidase-conjugated secondary antibody, using a CCD based Biorad Molecular Imager ChemiDoc XRS+ System (Biorad, Hercules, CA) or X-ray films. The immunoreactive band intensities were determined by densitometry or the Quantity One software (Biorad, Hercules, CA).
Following antibodies were used: grp78, grp94, (Stressgen, Ann Arbor, MI); Syn-1, cytochrome C (BD Transduction Laboratories, Franklin Lakes, NJ); A11 (Kayed et al., 2003 (link)); pser129-αS (Fujiwara et al. 2002 (link)); syn303 (Duda et al., 2000 (link)); FILA-1 (Lindersson et al., 2004 (link)).
Colla E., Jensen P.H., Pletnikova O., Troncoso J.C., Glabe C, & Lee M.K. (2012). Accumulation of Toxic α-Synuclein Oligomer within Endoplasmic Reticulum Occurs in α-Synucleinopathy In Vivo. The Journal of Neuroscience, 32(10), 3301-3305.
Publication 2012
Antibodies Brain Chemiluminescence Cytochromes c Densitometry Dot Immunoblotting Glucose Regulated Protein 78 kDa GRP94 Homo sapiens Horseradish Peroxidase Immunoblotting Immunoglobulins Mus Nitrocellulose TCL1B protein, human Tissue, Membrane Tissues X-Ray Film
5
Molecular Dynamics of Hsp90 Conformations
Cited 8 times
MD simulations of the Hsp90 structures (each of 20 ns duration) were performed for a closed ATP-bound conformation of yeast Hsp90 (crystal structure) (PDB ID 2CG9) [54] (link); a “V-shaped” conformation of the mammalian Grp94 homologue from complexes with ADP (PDB ID 2O1V) and AMP-PNP (PDB ID 2O1U) (crystal structure) [56] (link); an open Apo form of the bacterial homologue HtpG (PDB ID 2IOQ) (crystal structure) [55] (link); a semi-closed, ADP-bound form of the bacterial homologue HtpG (PDB ID 2IOP) (crystal structure) [55] (link); and an extended Apo HtpG conformation (solution structure from SAXS studies) [61] (link). All crystallographic water molecules, bound inhibitors, and other heteroatoms were removed. The retrieved structures were examined for missing and disordered residues. The missing residues and unresolved structural segments were modeled using the program MODELLER which is an automated approach to comparative protein structure modeling by satisfaction of spatial restraints [153] (link), [154] (link). MD simulations were carried out using NAMD 2.6 [155] (link) with the CHARMM27 force field [156] (link), [157] and the explicit TIP3P water model as implemented in NAMD 2.6 [158] . The VMD program was used for the preparation and analysis of simulations [159] (link), [160] (link). The employed MD protocol was described in full details in our earlier studies [161] (link)–[163] (link). In brief, structures were solvated in a water box with the buffering distance of 10 Å. Assuming normal charge states of ionizable groups corresponding to pH 7, sodium (Na+) and chloride (Cl−) counter-ions were added to achieve charge neutrality in MD simulations at physiological concentration of 0.15 mol/L. All Na+ and Cl− ions were placed at least 8 Å away from any protein atoms and from each other. The system was subjected to initial minimization for 20,000 steps (40 ps) keeping protein backbone fixed which was followed by 20,000 steps (40 ps) of minimization without any constraints. Equilibration was done in steps by gradually increasing the system temperature in steps of 20 K starting from 10 K until 310 K and at each step 15000 steps (30 ps) equilibration was run keeping a restraint of 10 Kcal mol−1 Å−2 on protein alpha carbons (Cα). Thereafter the system was equilibrated for 150,000 steps (300 ps) at 310 K (NVT) and then for further 150,000 steps (300 ps) at 310 K using Langevin piston (NPT) to achieve uniform pressure. Finally the restrains were removed and the system was equilibrated for 500,000 steps (1 ns) to prepare the system for simulation. An NPT simulation was run on the equilibrated structure for 20 ns keeping the temp at 310 K and pressure at 1 bar using Langevin piston coupling algorithm. The integration time step of the simulations was set to 2.0 fs, the SHAKE algorithm was used to constrain the lengths of all chemical bonds involving hydrogen atoms at their equilibrium values and the water geometry was restrained rigid by using the SETTLE algorithm. Nonbonded van der Waals interactions were treated by using a switching function at 10 Å and reaching zero at a distance of 12 Å. The particle-mesh Ewald algorithm (PME) as implied in NAMD was used to handle long range electrostatic forces.
Dixit A, & Verkhivker G.M. (2012). Probing Molecular Mechanisms of the Hsp90 Chaperone: Biophysical Modeling Identifies Key Regulators of Functional Dynamics. PLoS ONE, 7(5), e37605.
Full text: Click here
Publication 2012
Adenylyl Imidodiphosphate Bacteria Carbon Chlorides Crystallography Electrostatics GRP94 HSP90 Heat-Shock Proteins Hydrogen inhibitors Ions Mammals Muscle Rigidity Pressure Proteins Satisfaction Sodium Tremor Vertebral Column Yeast, Dried

Most recents protocols related to «GRP94»

1
Quantitative Protein Analysis via Multimodal Blotting
Proteins of whole-cell lysates were analyzed using lectin blotting, Western blotting and Coomassie-stained gels. Proteins were separated on 10% SDS gels at 20 mA and transferred to PVDF membranes (Millipore, Billercia, MA, USA) at 250 mA for lectin blotting, as previously described [36 (link)]. Transferred membranes were incubated with biotin-conjugated E-PHA or GNL lectins (Vector Laboratories, Burlingame, CA, USA). Western blotting was performed using the Bio-Rad ChemiDoc MP Imaging System (Biorad, Hercules, CA, USA) which allowed for the visualization of proteins using fluorescent antibodies. Whole cell lysate samples were electrophoresed on Any kDTM gels (Biorad, Hercules, CA, USA). Separated proteins were transferred to PVDF membranes and were incubated in EveryBlot Blocking Buffer, primary and secondary antibodies, and then imaged using a ChemiDoc MP imaging system. Primary antibodies with rat and human reactivity include: BiP, PDI (PDIA1), calreticulin, Grp94, KIF5B and ERp57 (Cell Signaling Technology, Danvers, MA, USA) and rhodamine conjugated actin (Biorad, Hercules, CA, USA). Primary antibodies with only human reactivity include: Ero1-L-α and calnexin (Cell Signaling Technology, Danvers, MA, USA). The secondary antibody (Biorad, Hercules, CA, USA) used was anti-rabbit IgG starBright Blue 700. Immunobands were quantified using image lab software (Biorad, Hercules, CA, USA) by comparing the ratio of the protein of interest to β-actin, housekeeping protein. In short, multichannel images of Western blots were used to detect protein of interest (starBright Blue 700), along with the housekeeping protein (rhodamine-conjugated β-actin) in each lane. Moreover, multiplexed Western blotting permitted correction for loading and transfer of separated proteins to membranes for each sample since β-actin was measured in the same lane as the protein of interest. The ratio of the immunoband intensities of the protein of interest to β-actin are reported as a mean from at least 3 separate lanes. To verify that proteins of interest and β-actin migrated as reported by the literature which accompanied product, Western blots with protein markers can be viewed in supplementary section (Figure S1). Adjusted band intensity was determined by subtracting local background of immunobands from each immunoband. In all cases, background was kept constant for each Western blot.
Hall M.K., Shajahan A., Burch A.P., Hatchett C.J., Azadi P, & Schwalbe R.A. (2023). Limited N-Glycan Processing Impacts Chaperone Expression Patterns, Cell Growth and Cell Invasiveness in Neuroblastoma. Biology, 12(2), 293.
Full text: Click here
Publication 2023
Actins anti-IgG Antibodies Biotin Buffers Calnexin Calreticulin Cells Cloning Vectors ERO1L protein, human erythroagglutinating phytohemagglutinin Fluorescent Antibody Technique Gels GRP94 Homo sapiens Immunoglobulins KIF5B protein, human Lectin PDIA3 protein, human polyvinylidene fluoride Proteins Rabbits Rhodamine Tissue, Membrane Western Blot Western Blotting
2
Immunoprecipitation and Immunoblotting for Protein Analysis
The cells were lysed with radioimmunoprecipitation assay (RIPA) lysis buffer supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF) and 0.01 mM protease inhibitor cocktail (PIC) on ice for 15 min and centrifuged at 15,000× g for 10 min at 4 °C. The protein concentration was determined using the Bradford assay. For immunoprecipitation, cell lysates were incubated with rabbit anti-CHIP antibody overnight at 4 °C followed by 1 h incubation with protein A–agarose beads (Invitrogen) on a roller system at 4 °C. The beads were collected by centrifugation and then washed with washing buffer (50 mM Tris-HCl, pH 7.4, 0.1% Nonidet P-40, 150 mM NaCl, and 1 mM EDTA). Bound proteins were released using 2× sodium dodecyl sulfate (SDS) sample buffer. Proteins were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride membranes. The membranes were blocked with 5% skimmed milk and immunoblotted with primary antibodies overnight at 4 °C and then with corresponding secondary antibodies at room temperature (RT) for 1 h. The protein signals were visualized by using electrochemiluminescence detection reagents (Millipore, Billerica, MA, USA) according to the manufacturer’s instructions. The antibodies were purchased from the following vendors: TXNIP (MBL International, Woburn, MA, USA); KDEL (GRP94, GRP78) (Enzo Life Sciences, Lörrach, Germany); XBP-1s (BioLegend, San Diego, CA, USA); ATF6 (Novus Biologicals, Littleton, CO, USA); ATF4, GADD153 (CHOP), HA, and CHIP (Santa Cruz Biotechnology, Santa Cruz, CA, USA); Akt, p-Akt, ACC, FAS, PARP-1, and cleaved Caspase-3 (Cell Signaling, Danvers, MA, USA); NLRP3 (ThermoFisher, Waltham, MA, USA); PGC1α (abcam, Cambridge, UK); and α-tubulin and β-actin (Sigma Aldrich, St. Louis, MO, USA).
Han J.H., Nam D.H., Kim S.H., Hwang A.R., Park S.Y., Lim J.H, & Woo C.H. (2023). CHIP Haploinsufficiency Exacerbates Hepatic Steatosis via Enhanced TXNIP Expression and Endoplasmic Reticulum Stress Responses. Antioxidants, 12(2), 458.
Full text: Click here
Publication 2023
Actins activating transcription factor 6, human alpha-Tubulin Antibodies Antibodies, Anti-Idiotypic ATF4 protein, human Biological Assay Biological Factors Buffers Caspase 1 Caspase 3 Cells Centrifugation DDIT3 protein, human DNA Chips Edetic Acid Glucose Regulated Protein 78 kDa GRP94 Immunoprecipitation Milk, Cow's Nonidet P-40 Novus PARP1 protein, human Phenylmethylsulfonyl Fluoride polyvinylidene fluoride PPARGC1A protein, human Proteins Rabbits Radioimmunoprecipitation Assay SDS-PAGE Sepharose Sodium Chloride Staphylococcal Protein A Sulfate, Sodium Dodecyl thioredoxin-binding protein-2 Tissue, Membrane Tromethamine
3
Characterizing Extracellular Vesicle Proteins

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2023
Actins Antibodies Buffers Chemiluminescence GRP94 Homo sapiens Horseradish Peroxidase Milk, Cow's Nitrocellulose Placenta Proteins SDS-PAGE Tissue, Membrane Tissues Western Blot
4
Western Blot Analysis of EV Proteins
EVs were lysed in a 1:1 dilution with RIPA buffer (Thermo Fisher Scientific) before determining total protein concentration using a bicinchoninic acid protein assay (Thermo Fisher Scientific). Twenty micrograms of total protein was loaded into 4–20% Tris HCl polyacrylamide gels and resolved using the Criterion electrophoresis system (BioRad, Hercules, CA, USA). The resolved proteins were then transferred onto nitrocellulose membranes (GE Healthcare, Piscataway, NJ, USA) using the Criterion transfer system (BioRad). The membranes were blocked in a mixture of 5% non-fat milk and 1× TBS (TBS; BioRad) at room temperature for an hour on an automated rocker. The nitrocellulose membranes were washed twice with 1× TBS and incubated with primary antibodies (annexin A2 (8235; Cell Signaling), GRP94 (20292; Cell Signaling Technology), and HSP70 (ab228421; Abcam)) overnight on an automated rocker at 4 degrees Celsius. Next, the membranes were washed three times with 1× TBS and incubated with horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (BioRad) at a 1:3000 dilution prepared in blocking solution for an hour on an automated rocker. The nitrocellulose membranes were washed four times with 1× TBS, incubated with ECL reagent (BioRad) for seven minutes, and developed on an imager (BioRad).
Darwish S., Liu L.P., Robinson T.O., Tarugu S., Owings A.H., Glover S.C, & Alli A.A. (2023). COVID-19 Plasma Extracellular Vesicles Increase the Density of Lipid Rafts in Human Small Airway Epithelial Cells. International Journal of Molecular Sciences, 24(2), 1654.
Full text: Click here
Publication 2023
Annexin A2 Antibodies Antibodies, Anti-Idiotypic bicinchoninic acid Biological Assay Buffers Electrophoresis Goat GRP94 Heat-Shock Proteins 70 Horseradish Peroxidase Milk, Cow's Nitrocellulose polyacrylamide gels Proteins Rabbits Radioimmunoprecipitation Assay Technique, Dilution Tissue, Membrane Tromethamine
5
GRP94 and FKBP2 Interactome Analysis
INS-1E cells were transfected at 60% confluence using Lipofectamine™ 3000 (ThermoFisher Scientific, Denmark) with plasmids coding for GFP-tagged GRP94, PI, ER-localized GFP [23 (link),24 (link)] or myc-tagged FKBP2, according to the manufacturer’s protocol. Proteins were immunoprecipitated (IP) using the magnetic GFP- or myc-trap beads (Chromotek, Germany). IP samples were reduced and alkylated, digested with trypsin/LysC and the resulting peptides were analyzed on a Bruker Impact II ESI-QTOF (Bruker Daltonics, USA) mass spectrometer (supplementary procedures).
Hoefner C., Bryde T.H., Pihl C., Tiedemann S.N., Bresson S.E., Hotiana H.A., Khilji M.S., Santos T.D., Puglia M., Pisano P., Majewska M., Durzynska J., Klindt K., Klusek J., Perone M.J., Bucki R., Hägglund P.M., Gourdon P.E., Gotfryd K., Urbaniak E., Borowiak M., Wierer M., MacDonald P.E., Mandrup-Poulsen T, & Marzec M.T. (2023). FK506-Binding Protein 2 Participates in Proinsulin Folding. Biomolecules, 13(1), 152.
Full text: Click here
Publication 2023
Cells GRP94 Lipofectamine Peptides Plasmids Proteins Trypsin

Top products related to «GRP94»

1
Grp94 by Cell Signaling Technology
Sourced in United States, United Kingdom
GRP94 is a molecular chaperone protein that plays a key role in the folding and maturation of client proteins within the endoplasmic reticulum (ER). It is a member of the heat shock protein 90 (Hsp90) family and is involved in the proper folding and trafficking of various cellular proteins.
2
Grp94 by Abcam
Sourced in United States, United Kingdom
GRP94 is a heat shock protein that functions as a molecular chaperone. It is involved in the folding and assembly of proteins within the endoplasmic reticulum (ER).
3
Anti grp94 by Cell Signaling Technology
Sourced in United States
Anti-GRP94 is a primary antibody product from Cell Signaling Technology. It recognizes the GRP94 protein, which is a member of the heat shock protein 90 (Hsp90) family. GRP94 is an endoplasmic reticulum (ER) resident chaperone protein that plays a role in the folding and assembly of secreted and cell surface proteins.
4
Pvdf membrane by Merck Group
Sourced in United States, Germany, China, United Kingdom, Morocco, Ireland, France, Italy, Japan, Canada, Spain, Switzerland, New Zealand, India, Hong Kong, Sao Tome and Principe, Sweden, Netherlands, Australia, Belgium, Austria
PVDF membranes are a type of laboratory equipment used for a variety of applications. They are made from polyvinylidene fluoride (PVDF), a durable and chemically resistant material. PVDF membranes are known for their high mechanical strength, thermal stability, and resistance to a wide range of chemicals. They are commonly used in various filtration, separation, and analysis processes in scientific and research settings.
5
β actin by Cell Signaling Technology
Sourced in United States, United Kingdom, China, Germany, Japan, Canada, Morocco, Sweden, Netherlands, Switzerland, Italy, Belgium, Australia, France, India, Ireland
β-actin is a cytoskeletal protein that is ubiquitously expressed in eukaryotic cells. It is an important component of the microfilament system and is involved in various cellular processes such as cell motility, structure, and integrity.
6
β actin by Merck Group
Sourced in United States, United Kingdom, Germany, China, Canada, Japan, Macao, Italy, Sao Tome and Principe, Israel, Spain, Denmark, France, Finland, Australia, Morocco, Ireland, Czechia, Sweden, Uruguay, Switzerland, Netherlands, Senegal
β-actin is a protein that is found in all eukaryotic cells and is involved in the structure and function of the cytoskeleton. It is a key component of the actin filaments that make up the cytoskeleton and plays a critical role in cell motility, cell division, and other cellular processes.
7
Grp94 by Santa Cruz Biotechnology
Sourced in United States
GRP94 is a heat shock protein that functions as a molecular chaperone in the endoplasmic reticulum. It is involved in the folding and assembly of proteins within the cell.
8
Anti grp94 by Abcam
Sourced in United States, United Kingdom
Anti-GRP94 is a primary antibody that recognizes the GRP94 protein, also known as heat shock protein 90 kDa beta member 1 (HSP90B1). GRP94 is a molecular chaperone involved in the folding and maturation of proteins in the endoplasmic reticulum. This antibody can be used for the detection of GRP94 in various applications, such as Western blotting, immunoprecipitation, and immunohistochemistry.
9
Cleaved caspase 3 by Cell Signaling Technology
Sourced in United States, United Kingdom, China, Germany, Canada, Japan, Morocco, Denmark, Switzerland, France, Netherlands, Macao
Cleaved caspase-3 is an antibody that detects the activated form of caspase-3 protein. Caspase-3 is a key enzyme involved in the execution phase of apoptosis, or programmed cell death. The cleaved caspase-3 antibody specifically recognizes the active, cleaved form of the enzyme and can be used to monitor and quantify apoptosis in experimental systems.
10
P akt by Cell Signaling Technology
Sourced in United States, United Kingdom, China, Germany, Canada, Japan, Netherlands, France, Sao Tome and Principe, Hong Kong, Italy, Australia
P-AKT is a phosphorylated form of the AKT protein, a key signaling molecule involved in various cellular processes. The product is used for the detection and quantification of phosphorylated AKT in biological samples.

More about "GRP94"

Glucose-regulated Protein 94 (GRP94), also known as Heat Shock Protein 90 Beta (HSP90B1), is a crucial molecular chaperone that plays a pivotal role in protein folding and the unfolded protein response within the endoplasmic reticulum (ER).
This versatile protein is responsible for the proper assembly and maturation of various client proteins, including cell surface receptors and signaling molecules.
GRP94 is highly upregulated in response to cellular stress, such as glucose deprivation, and helps maintain protein homeostasis within the ER.
This adaptive mechanism ensures that misfolded or unfolded proteins are properly processed, preventing the accumulation of potentially harmful aggregates.
Dysregulation of GRP94 has been implicated in a variety of disease states, including cancer, neurodegeneration, and autoimmune disorders.
Researchers studying GRP94 can gain valuable insights into cellular stress pathways and identify potential therapeutic targets.
Optimizing GRP94 research can be achieved by leveraging AI-driven comparisons, such as those provided by PubCompare.ai.
This powerful tool can help researchers locate relevant information, identify the best protocols and products from literature, pre-prints, and patents, and ensure reproducibility of their experiments.
In addition to GRP94, related terms and concepts that may be of interest include Anti-GRP94 antibodies, which can be used to detect and quantify GRP94 levels, and PVDF membranes, which are commonly used in Western blotting techniques to analyze protein expression, including that of GRP94.
Additionally, β-actin and Cleaved caspase-3 are commonly used as loading controls and apoptosis markers, respectively, in studies involving GRP94.
Furthermore, the phosphorylation status of AKT (P-AKT) can provide insights into the signaling pathways modulated by GRP94 and its impact on cellular processes.