> Chemicals & Drugs > Amino Acid > Herceptin

Herceptin

Herceptin (trastuzumab) is a monoclonal antibody used in the treatment of certain types of breast cancer and gastric cancer.
It targets the HER2 protein, which is overexpressed in some cancer cells, and can help slow or stop the growth of these tumors.
Herceptin is often used in combination with chemotherapy or other cancer treatments.
Researchers can use PubCompare.ai to optimize their Hercepting research by locating relevant protocols from literature, preprints, and patents, and leveraging AI-driven comparisons to identify the best protocols and products.
This can enhance reproducibility and accuracy, streamlining the research process.

Most cited protocols related to «Herceptin»

Drug Testing on Gastric Organoids

Cited 8 times

Human gastric cancer and normal gastric organoids were cultured as described earlier and were passaged twice a week with a split ratio of 1:2/1:3.20 (link) Treatment with chemotherapeutics was performed 24 hours after seeding using 5-FU, oxaliplatin, irinotecan, epirubicin and docetaxel. Selected organoids were treated with trastuzumab (Herceptin, Roche), palbociclib (No S1116, Selleckchem) and imatinib (No ST1571, Selleckchem). Further information is given in the online supplementary methods.

Seidlitz T., Merker S.R., Rothe A., Zakrzewski F., von Neubeck C., Grützmann K., Sommer U., Schweitzer C., Schölch S., Uhlemann H., Gaebler A.M., Werner K., Krause M., Baretton G.B., Welsch T., Koo B.K., Aust D.E., Klink B., Weitz J, & Stange D.E. (2018). Human gastric cancer modelling using organoids. Gut, 68(2), 207-217.

Publication 2018

A-A-1 antibiotic Docetaxel Epirubicin Gastric Cancer Herceptin Homo sapiens Imatinib Irinotecan Organoids Oxaliplatin palbociclib Pharmacotherapy ST 1571 Stomach Trastuzumab

Bispecific Antibody Production and Purification

Cited 8 times

The hu3F8-BsAb format was designed as a huOKT3 scFv fusion to the C-terminus of the light chain of a human IgG1 (21 (link)). Nucleotide sequences encoding V_H and V_L domains from our hu3F8, and the OKT3 scFv were synthesized by GenScript with appropriate flanking restriction enzyme sites, and were subcloned into a mammalian expression vector. Two control BsAbs were built on the same platform, Herceptin-huOKT3 and hu3F8-C825 (22 (link)). Linearized plasmid DNA was used to transfect CHO-S cells (Invitrogen) for stable production of BsAb, similar to that described in our previous report (25 (link)). Hu3F8-BsAb titer was determined by ELISA using antigen GD2 and CD3⁽⁺⁾ Jurket cell line, and stable clones with highest expression were selected.
The BsAb producer line was cultured in OptiCHO medium and the mature supernatant harvested. A protein A affinity column (GE Healthcare) was used to purify hu3F8-BsAb as previously described (7 (link)), and BsAb was dialyzed into 25 mM sodium citrate, 0.15 M NaCl, pH 8.2 and frozen in aliquots at −80°C. The purity of hu3F8-BsAb was evaluated by both SDS-PAGE (7 (link)), and size-exclusion high-performance liquid chromatography (SE-HPLC).

Xu H., Cheng M., Guo H., Chen Y., Huse M, & Cheung N.K. (2014). Retargeting T cells to GD2 pentasaccharide on human tumors using bispecific humanized antibody. Cancer immunology research, 3(3), 266-277.

Publication 2014

Antigens Base Sequence Cell Lines CHO Cells Clone Cells Cloning Vectors Culture Media DNA Restriction Enzymes Enzyme-Linked Immunosorbent Assay Freezing Gel Chromatography Herceptin High-Performance Liquid Chromatographies Homo sapiens HU3F8 IgG1 Light Mammals Muromonab-CD3 Plasmids SDS-PAGE Sodium Chloride Sodium Citrate Staphylococcal Protein A

Engineered CAR T-cell Constructs

Cited 8 times

The ErbB2-specific scFv 4D5 (25 (link)) sequence derives from the humanized mAb that was used to produce Herceptin. The sequence for the anti-VEGFR2-specific scFv 2C6 (26 (link)) was derived from a human Ab. Both CARs were designed and synthesized by PCR using a web-based DNA codon optimization algorithm (27 (link)). Supplemental Fig. 1 shows the sequences of the 4D5 and 2C6 scFvs (including the linker sequence) and the primers used to synthesis these genes.⁴ The synthesized DNA fragments were sequence confirmed and subcloned in frame into MSGV-1-based vector (28 (link)) containing CD28 and CD3ζ signaling moieties (12 (link)) to generate MSGV-4D5–28Z or MSGV-2C6–28Z. Variant signaling domains were constructed by mega-primer overlap PCR of specific signaling domains and assembled in the order described in figure legends (details available upon request). An MSGV-1-based vector encoding TCRα and TCRβ specific for NY-ESO-1 (MSGV-1G4-AIB) was described previously (29 (link)). FMC63–28Z is a CAR vector in which scFv against human CD19 derived from mAb FMC63 as described (30 (link)) was constructed and subcloned into MSGV-1-based retroviral vector containing CD28-CD3ζ cassette. A trinitrophenyl-specific CAR, SP6–28Z CAR (22 (link)), and a CAR containing the extracellular domain of LNGFR were used as controls.

Zhao Y., Wang Q.J., Yang S., Kochenderfer J.N., Zheng Z., Zhong X., Sadelain M., Eshhar Z., Rosenberg S.A, & Morgan R.A. (2009). A Herceptin-Based Chimeric Antigen Receptor with Modified Signaling Domains Leads to Enhanced Survival of Transduced T Lymphocytes and Antitumor Activity. Journal of immunology (Baltimore, Md. : 1950), 183(9), 5563-5574.

Publication 2009

Anabolism Antigen T Cell Receptor, beta Chain Cloning Vectors Codon ERBB2 protein, human Genes Herceptin Homo sapiens Oligonucleotide Primers Reading Frames Retroviridae Vascular Endothelial Growth Factor Receptor-2

Fluorescent Antibody Conjugation Protocol

Cited 6 times

Trastuzumab (Herceptin,
Roche), bevacizumab (Avastin, Roche), and ado-trastuzumab emtansine
(T-DM1, Kadcyla, Roche) were obtained from the University of Michigan
pharmacy. Alexa Fluor 680 NHS Ester (AF680, ThermoFisher Scientific)
and IRDye800CW (800CW, LI-COR) were conjugated to each antibody following
the manufacturers’ instructions as previously described.^{18 (link),27 (link)} Briefly, dyes were reacted at an antibody concentration of 2 mg/mL
in PBS with 10% sodium bicarbonate (v/v) for 2 h at 25 °C and
then purified using Biogel P-6, Fine (Bio-Rad) in
Spin-X centrifuge filter tubes (Corning).^{27 (link)} Dye to antibody molar ratios of 3.0 and 0.5 were used to obtain
the 1.2 and 0.3 degrees of labeling, respectively. The degree of labeling
was determined by using a NanoDrop 2000c spectrophotometer (ThermoFisher
Scientific) to measure fluorophore absorption and the protein absorbance
at 280 nm, corrected for the fluorophore. The degree of labeling is
defined as the average dye to protein concentration ratio. Sample
absorption spectra are included in the Supporting Information (Figure S1). After purification, conjugates were
run on SDS-PAGE and scanned on an Odyssey CLx to ensure all free dye
was removed (Figure S2). Binding affinities
were performed as previously described^{3 (link)} using HCC1954 cells. Briefly, titrations of unlabeled antibody and
antibody–dye conjugates were incubated with 50,000 HCC1954
cells on ice for 3 h and washed. After the primary incubation, cells
were further incubated with antihuman IgG Fc-AlexaFluor488 at 40 nM
for 30 min on ice, washed, and subsequently run on an Attune Focusing
Cytometer (Applied Biosystems). K_d was
estimated using PRISM and is reported as K_d ± standard error.

Cilliers C., Nessler I., Christodolu N, & Thurber G.M. (2017). Tracking Antibody Distribution with Near-Infrared Fluorescent Dyes: Impact of Dye Structure and Degree of Labeling on Plasma Clearance. Molecular Pharmaceutics, 14(5), 1623-1633.

Publication 2017

Ado-Trastuzumab Emtansine Avastin Bevacizumab Bicarbonate, Sodium Cells Esters Herceptin Immunoglobulins Kadcyla Molar prisma Proteins SDS-PAGE Titrimetry Trastuzumab

Construction and Characterization of Genetic Tools for Recombinant Protein Production

Cited 6 times

All of the plasmids created in the present study are listed in Supplementary Table 10. pMW118 was purchased from Nippon Gene (Japan). To create pBeta, the lacI^q-tac promoter6 (link), bet from DE3, an rrnB terminator from pBAD TOPO (Invitrogen), and a kan marker were inserted, in this order, between bla and the multiple cloning site of pMW118. To derive pRF0q3 from pBeta, the bla gene was replaced by a variant of the chloramphenicol acetyltransferase gene (cat) with UAG in place of all of the 13 Gln codons17 (link), an amber suppressor tRNA^GlnsupE317 (link), and tetA. To derive pMINIqY from pBeta, an artificial operon composed of minor tRNA genes, tetA, and lysY from pLemo (New England Biolabs) was cloned. The tRNA operon consisted of the tyrT promoter, tRNA^lle2-tRNA^Arg3-tRNA^Pro2-tRNA^Arg4_UCG, metT-leuW, tRNA^Arg4-tRNA^Arg5, and the rrnC terminator. The bla gene was removed and the kan gene was inactivated by mutation. The temperature-sensitive pMW118 derivative harbored bla, in addition to tetA and kan. pAp15 was constructed from pAp10517 (link) by removing TAG at the end of repZ and inserting an rrnC terminator upstream of the kan gene. The metT-leuW-glnU-glnW-metU-glnV-glnX operon was cloned in pAp15. supE44 and supE3 were cloned in place of glnX, to create pAp15-supE44 and pAp15-supE3, respectively. The hemA-prfA-hemK operon was cloned into pAp15 to create pAp15-RF1. A SucB variant with a FLAG tag and TAG at the N- and C-termini, respectively, was cloned in pET21b(+) (Novagen), together with the base sequence CAGTTCAAGTTTCACCTGCACTGCAGACCG between the TAG and the start of the T7 tag sequence of the vector, to create the gene encoding the FLAG-SucB-T7 variant. The gene encoding the hirudin variant 1 (HV1) was commercially synthesized, together with the N-terminal 6× His tag and SUMO tag24 (link) and designated as SUMO-HV1(63Y). The tyrosine codon at position 63 was mutated to UAG to create SUMO-HV1(63Am). The SUMO-HV1 sequences were each cloned downstream of the T7 promoter of pET21b(+). The artificial operon designated as SfYN3, expressing a UAG-decoding tRNA^Tyr variant (Nap3)39 (link) and a tyrosyl-tRNA synthetase variant specific to O-sulfo-l-tyrosine [SfYRS(D286R)] from Methanocaldococcus jannaschii6 (link)23 (link) was cloned into the pET21b(+) carrying the HV1 gene, to create pET-SUMO-HV1(63Y) and pET-SUMO-HV1(63Am). Then, a pelB signal was inserted at the N-termini of the SUMO-HV1, to create pET-pelB-SUMO-HV1(63Y) and pET-pelB-SUMO-HV1(63Am). VH-CH1 and VL-CL, forming the Herceptin Fab fragment, were each cloned with a pelB signal in pET26b(+) (Novagen). The Ala codon at position 121 in VHCH1 was changed to UAG to create the pelB-VHCH1(A121X) gene29 (link). The pelB-VLCL, together with either the pelB-VHCH1 or the pelB-VHCH1(A121X) was cloned downstream of the T7 promoter in pET26b(+). An artificial operon designated as AzFA1, expressing a UAG-decoding tRNA^Tyr variant (pAzPhe1)39 (link) and a tyrosyl-tRNA synthetase variant specific to 4-azido-l-phenylalanine [AzFRS(D286R)] from M. jannaschii6 (link)26 (link), was cloned into the pET26b(+) carrying the genes encoding the Fab fragment, to create pET-Fab and pET-Fab(A121X). The 183rd and 201st codons of the heavy chain were changed to TAG to create pET-Fab(3 × Am).

Mukai T., Hoshi H., Ohtake K., Takahashi M., Yamaguchi A., Hayashi A., Yokoyama S, & Sakamoto K. (2015). Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Scientific Reports, 5, 9699.

Full text: Click here

Publication 2015

Amber Base Sequence Chloramphenicol O-Acetyltransferase Cloning Vectors Codon Genes Hemophilia A Herceptin Immunoglobulins, Fab lepirudin Ligase Methanocaldococcus Mutation Operon Phenylalanine-Specific tRNA Plasmids Topotecan Transfer RNA Trientine Tyrosine Tyrosine-Specific tRNA

Most recents protocols related to «Herceptin»

Herceptin Conjugate Formation Protocol

Not available on PMC !

Example 184

To a mixture of 2.0 mL of 10 mg/ml Herceptin in pH 6.0˜8.0, were added of 0.70˜2.0 mL PBS buffer of 100 mM NaH₂PO₄, pH 6.5˜8.5 buffers, TCEP (14-35 μL, 20 mM in water) and the compounds 128, 132, 437, 481, 495, 528, 629, 633, 641, 645, 649, 654, 659, 663, 673, 709, 712, 166a, 719, 720 and 723 (14-28 μL, 20 mM in DMA independently, followed by addition of 4-(azidomethyl)benzoic acid (14-50 μL, 20 mM in pH 7.5, PBS buffer). The mixture was incubated at RT for 4˜18 h, then DHAA (135 μL, 50 mM) was added in. After continuous incubation at RT overnight, the mixture was purified on G-25 column eluted with 100 mM NaH₂PO₄, 50 mM NaCl pH 6.0˜7.5 buffer to afford 12.2˜18.6 mg of the conjugate compounds C-128, C-132, C-437, C-481, C-495, C-528, C-629, C-633, C-641, C-644, C-645, C-649, C-654, C-659, C-663, C-673, C-709, C-712, C-166a, C-719, C-720 and C-723, (80%-93% yield) accordingly in 13.4˜15.8 ml of the NaH₂PO₄buffer. The drug/antibody ratio (DAR) was 3.4˜3.9 for the conjugates, wherein DAR was determined via UPLC-QTOF mass spectrum. It was 94-99% monomer analyzed by SEC HPLC (Tosoh Bioscience, Tskgel G3000SW, 7.8 mm ID×30 cm, 0.5 ml/min, 100 min) and a single band measured by SDS-PAGE gel.

US11873281B2. Conjugates of cell binding molecules with cytotoxic agents (2024-01-16). HANGZHOU DAC BIOTECH CO., LTD. [CN], None [US], None [CN], None [CN]. Inventors: R. Yongxin Zhao [US], Yue Zhang [CN], Yourang Ma [CN].

Full text: Click here

Patent 2024

Benzoic Acid Buffers compound C 6 Herceptin High-Performance Liquid Chromatographies Immunoglobulins Mass Spectrometry Pharmaceutical Preparations SDS-PAGE Sodium Chloride tris(2-carboxyethyl)phosphine

Breast Cancer Immunotherapy Evaluation

Breast cancer cells (BT474 cell line, representative of HER2 + breast cancer subtype) were co-cultured in 3D biomimetic collagen gels, within microfluidic devices, with immune cells (PBMCs, peripheral blood mononuclear cells from healthy donors), without or with the addition of targeted immunotherapy, the trastuzumab (brand name Herceptin). For details, see the original biological publication^{12 (link)}. In this use case, we demonstrated how deep features’ discrimination capability of the effect of targeted immunotherapy in breast tumors is influenced by image alterations and compared results with those achieved using standard features selection approaches using diverse deep learning architectures.

Mencattini A., D’Orazio M., Casti P., Comes M.C., Di Giuseppe D., Antonelli G., Filippi J., Corsi F., Ghibelli L., Veith I., Di Natale C., Parrini M.C, & Martinelli E. (2023). Deep-Manager: a versatile tool for optimal feature selection in live-cell imaging analysis. Communications Biology, 6, 241.

Full text: Click here

Publication 2023

Biopharmaceuticals Breast Neoplasm Cell Lines Cells Collagen Discrimination, Psychology Donors erbb2 Gene Gels Herceptin Immunotherapy Malignant Neoplasm of Breast Microchip Analytical Devices PBMC Peripheral Blood Mononuclear Cells Trastuzumab

Monitoring Breast Cancer Cell Apoptosis

An inverted Leica DMi8 equipped with a Retiga R6 camera and Lumencor SOLA SE 365 light engine, using a 5X objective, has been used to acquire Time-lapse images. The filter cubes used were TXRed (excitation filter 560/40 nm, emission filter 630/75 nm, dichroic mirror 585 nm) and GFP (excitation filter 470/40 nm, emission filter 525/50 nm, dichroic mirror 495 nm). A live fluorescent dye (CellTrace, red) was used to selectively pre-stain the cancer cells before cultures on-chip. To monitor apoptotic death, a live fluorescent reporter for caspase activity (CellEvent Caspase-3/7, green) was added to the on-chip culture medium. The red channel was then used to locate cells^{10 (link)} while the transposition on the green channel of the cancer cell position allowed to monitor green emission signal and, therefore, death events. Breast cancer cells (BT474 cell line, representative of HER2 + breast cancer subtype) were co-cultured in 3D biomimetic collagen gels, within microfluidic devices, with immune cells (PBMCs, peripheral blood mononuclear cells from healthy donors), with or without the addition of targeted immunotherapy, the trastuzumab (brand name Herceptin). With the aim to demonstrate the advantage of using DM tool in common practice, we extracted handcrafted features related to green emission and compared the case of standard practice with the use of DM tool.

Full text: Click here

Publication 2023

Apoptosis Caspase Caspase-7 Cell Lines Cells Collagen Cuboid Bone Culture Media DNA Chips Donors erbb2 Gene Fluorescent Dyes Gels Herceptin Immunotherapy Light Malignant Neoplasm of Breast Malignant Neoplasms Microchip Analytical Devices PBMC Peripheral Blood Mononuclear Cells Sarcoma, Myeloid Stains Trastuzumab

Proteomic Profiling of Breast Cancer

Breast tumor tissue and normal control breast tissue was excised from 23 breast cancer patients during surgery. Samples were then prepared and sequenced according to standard protocol^{56 (link)}. The women enrolled had the following demographics: 13 were post-menopausal, 4 were Estrogen Receptor (ER) negative, 16 were Human Epidermal Growth Factor Receptor (HER2) negative, 5 were Progesterone Receptor (PR) negative, 16 had invasive ductal carcinoma, and 2 had internal mammary chain involvement. Five women received treatment prior to sample collection. One woman was administered Taxotere, Carboplatin, Herceptin, Perjeta (TCHP). Three women were administered Adriamycin, cyclophosphamide, Taxol (AC-T). One woman was administered Anastrozole. Global proteomics data from primary breast tumors and matched normal tissues were generated through mass-spectrometry (MS) (PMID: 33212010)^{36 (link)} and pre-processed as previously described (PMID: 34552204). Data pertaining to mutated and overexpressed genes in human breast cancer was also sourced from the Catalogue of Somatic Mutations In Cancer (COSMIC)^{16 (link)}. This was divided into two sets, one containing only the most commonly mutated genes in breast cancer and the other containing only unmutated, overexpressed genes in breast cancer. For weighting purposes, the number of times a gene was mutated compared to the total number of times that gene was expressed served as the weight for the first set and the number of times the gene was overexpressed was used as the weight for the second set.

Zatorski N., Sun Y., Elmas A., Dallago C., Karl T., Stein D., Rost B., Huang K.L., Walsh M, & Schlessinger A. (2023). Structural Analysis of Genomic and Proteomic Signatures Reveal Dynamic Expression of Intrinsically Disordered Regions in Breast Cancer and Tissue. bioRxiv.

Full text: Click here

Publication Preprint 2023

Adriamycin Anastrozole Breast Breast Neoplasm Carboplatin Cosmic composite resin Cyclophosphamide Diploid Cell Epidermal Growth Factor Receptor ERBB2 protein, human Estrogen Receptors Gene, Cancer Genes Herceptin Invasive Ductal Carcinoma, Breast Malignant Neoplasm of Breast Malignant Neoplasms Mammary Carcinoma, Human Mass Spectrometry Mutation Operative Surgical Procedures Patients Perjeta Postmenopause Receptors, Progesterone Specimen Collection Specimen Handling Taxol Taxotere Tissues Woman

Glycan Remodeling and Enzymatic Digestion

Eculizumab (Soliris, Alexion), trastuzumab
(Herceptin, Roche), and pembrolizumab (Keytruda, Merck) were obtained
from their manufacturers. Glycan remodeling was performed by treatment
of trastuzumab with TransGLYCIT (Genovis, Lund, Sweden) according
to the producer specifications with and without the presence of a
fucosidase. For middle-level analysis, enzymatic digestion was performed
by incubation of one unit of the IdeS enzyme (FabRICATOR, Genovis,
Lund, Sweden) per microgram of mAb at 37 °C for 60 min. Prior
to further analysis, the samples were buffer exchanged to 50 mM ammonium
acetate using 10 kDa Vivaspin 500 filters (Sartorius, Göttingen,
Germany) with an end concentration of 2 mg/mL.

van Schaick G., Domínguez-Vega E., Castel J., Wuhrer M., Hernandez-Alba O, & Cianférani S. (2023). Online Collision-Induced Unfolding of Therapeutic Monoclonal Antibody Glyco-Variants through Direct Hyphenation of Cation Exchange Chromatography with Native Ion Mobility–Mass Spectrometry. Analytical Chemistry, 95(8), 3932-3939.

Full text: Click here

Publication 2023

Alexion Buffers Digestion eculizumab Enzymes Herceptin Keytruda pembrolizumab Polysaccharides Soliris Trastuzumab

Top products related to «Herceptin»

Herceptin by Roche

Sourced in Switzerland, Germany, China, Canada, France, United States, United Kingdom

Herceptin is a laboratory product manufactured by Roche. It is a monoclonal antibody used for research and analytical purposes in laboratory settings.

Herceptin by Genentech

Sourced in United States, Cameroon

Herceptin is a laboratory instrument used for cell culture and protein expression. It is a monoclonal antibody that targets the HER2 receptor protein. The core function of Herceptin is to bind to and block the HER2 receptor, which is involved in the growth and division of cancer cells.

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

Trastuzumab herceptin by Roche

Sourced in Switzerland, Poland

Trastuzumab (Herceptin) is a monoclonal antibody developed by Roche for use in laboratory settings. It binds to the HER2 protein expressed on the surface of certain types of cancer cells.

Tskgel g3000sw by Tosoh

Sourced in Japan

Tskgel G3000SW is a gel permeation chromatography (GPC) column designed for the size-exclusion chromatography (SEC) analysis of macromolecules. The column is packed with a silica-based stationary phase and is suitable for the separation of polymers, proteins, and other large molecules based on their size and molecular weight.

Trastuzumab by Roche

Sourced in Switzerland, Germany, United States, China, United Kingdom

Trastuzumab is a monoclonal antibody used in laboratory research. It functions by specifically targeting the HER2/neu protein, which is expressed on the surface of certain types of cancer cells.

Trastuzumab by Genentech

Sourced in United States, Cameroon

Trastuzumab is a monoclonal antibody that targets the human epidermal growth factor receptor 2 (HER2) protein. It is used in the detection and quantification of HER2 expression in various cell and tissue samples.

Mwco 40k by Thermo Fisher Scientific

MWCO: 40K is a membrane filtration device used for molecular weight cut-off separation. It is designed to retain molecules above 40,000 Daltons while allowing smaller molecules to pass through.

Skbr3 by American Type Culture Collection

Sourced in United States, Germany, United Kingdom, China, Sweden, France, Italy, Japan

SKBR3 is a cell line derived from a breast adenocarcinoma. It is a commonly used model for breast cancer research.

Bt474 by American Type Culture Collection

Sourced in United States, Germany, United Kingdom, Japan, Sweden

The BT474 is a cell line derived from a human breast carcinoma. It is a well-characterized model for studying breast cancer biology and is commonly used in research and drug development.

What is Herceptin and how does it work?

What are the different variations or types of Herceptin?

Herceptin comes in several formulations, including intravenous (IV) and subcutaneous (SC) versions. The IV form is administered by infusion, while the SC form is injected under the skin. Both versions are used to treat HER2-positive breast and gastric cancers, but the specific dosage and administration may vary depending on the patient's needs and the type of cancer being treated.

How can PubCompare.ai help with Herceptin research?

PubCompare.ai allows researchers to screen protocol literature more efficiently and leverage AI to pinpoint critical insights. The platform can help identify the most effective protocols related to Herceptin for your specific research goals. PubCompare's AI-driven analysis can highlight key differences in protocol effectiveness, enabling you to choose the best option for reproducibility and accuracy, thus streamlining your Herceptin research process.

What are some common usage challenges with Herceptin?

One of the main challenges with Herceptin is the potential for heart-related side effects, such as a decrease in heart function or heart failure. Patients receiving Herceptin will need to be monitored closely for these complications. Addtionally, some patients may develop resistance to Herceptin over time, which can limit its effectiveness. Careful patient selection and combination with other therapies are important to address these issues.

What are the specific applications of Herceptin?

Herceptin is primarily used to treat HER2-positive breast cancer and gastric cancer. It can be used as a standalone treatment or in combination with chemotherapy, depending on the stage and characteristics of the cancer. Herceptin has been shown to improve survival outcomes and reduce the risk of cancer recurrence in patients with HER2-positive breast and gastric cancers. Reserchers can leverge PubCompare.ai to optimize their Hercepting research by locating relevant protocols and leveraging AI-driven comparisons to identify the best protocols and products.

More about "Herceptin"

Herceptin (trastuzumab) is a monoclonal antibody therapy used to treat certain types of breast cancer and gastric cancer.
It targets the HER2 protein, which is overexpressed in some cancer cells, and can help slow or stop the growth of these tumors.
Trastuzumab (the generic name for Herceptin) is often used in combination with chemotherapy or other cancer treatments to enhance efficacy.
Researchers can optimize their Herceptin research by leveraging PubCompare.ai, a leading AI platform.
This tool allows researchers to locate relevant protocols from literature, preprints, and patents, and perform AI-driven comparisons to identify the best protocols and products.
This can enhance the reproducibility and accuracy of Herceptin research, streamlining the overall process.
When conducting Herceptin research, researchers may also utilize related materials such as FBS (fetal bovine serum), which is commonly used in cell culture media, and SKBR3 and BT474 cell lines, which are commonly used HER2-positive breast cancer cell models.
Additionally, techniques like size exclusion chromatography using Tskgel G3000SW columns and dialysis with MWCO: 40K membranes may be employed to purify and characterize Herceptin and related biomolecules.
By incorporating these insights and tools, researchers can enhance the efficiency, reproducibility, and impact of their Herceptin-related studies, leading to advancements in the treatment of HER2-positive cancers.