Hexosaminidase A

The HEXA study is a large-scale genomic community-based study conducted in Korea from 2004–2013. For baseline recruitment, eligible participants were asked to volunteer through on-site invitation, mailed letters, telephone calls, media campaigns, or community leader-mediated conferences. A total of 169,722 subjects aged between 40–69 years old were recruited in 38 general hospitals and health examination centers in eight regions in Korea. The HEXA study design has been described in detail in previous studies [15 (link),16 (link)].
Updated from the previously published HEXA studies, the current study uses the HEXA-G (Health Examinees-Gem) participant sample which was given additional eligibility criteria on the participating sites (i.e., health examination centers and training hospitals). Of the original 38 sites, HEXA-G applied exclusion criteria of the following: (1) 8 sites (n = 9370) that only participated in the pilot study years 2004–2006; (2) 8 sites (n = 12,205) that did not meet the HEXA biospecimen quality control criteria (i.e., different testing protocols); (3) 5 sites (n = 8799) that have participated in the study for less than 2 years. In the new HEXA-G data, a total of 139,348 participants remained. Among the HEXA-G subjects, a total of 7274 were excluded: missing information on any MetS components at baseline survey (n = 4723); energy intake <800 or ≥4000 kcal/day in men and <500 or ≥3500 kcal/day in women (n = 4127); and missing BMI information (n = 78). Ultimately, 130,420 subjects including 43,682 men and 86,738 women remained in the final analysis (Figure 1). All study participants were given informed consent prior to entering the study. All participants voluntarily signed an informed consent form. As HEXA data are publicly open for use, the Institutional Review Board of the Seoul National University Hospital, Seoul, Korea approved it for statistical analysis (IRB No. E-1503-103-657).

The full-length trimeric and stabilized version of recombinant S glycoprotein protein of SARS-CoV-2 was produced by transient transfection of a mammalian expression plasmid (pCAGGS) from BEI Resources (NR-52394; www.beiresources.org). The vector for the S gene, Wuhan-Hu-1 (GenBank: MN908947), was designed for the expression of a soluble S glycoprotein (residues 1 to 1213) with a polybasic cleavage site deletion (RRAR to A; residues 682 to 685) and stabilizing mutations (K986P and V987P, wild type numbering) with a C-terminal thrombin cleavage site, T4 foldon trimerization domain, and hexa-histidine tag (26 (link)). According to the manufacturer’s recommendations, the Expi293F cells (Gibco, USA) were grown in Expi293 Expression Medium (Gibco, USA) via shaking in suspension using a humidified incubator at 37°C and 8% CO₂. For the production of SARS-CoV-2 spike protein, Expi293F cells were transiently transfected using ExpiFectamine 293 transfection kit (Gibco, USA). Briefly, 1 µg/mL of the plasmid was diluted into 12 mL of Opti MEM (Gibco, USA) and 640 µL of ExpiFectamine was added in 11.2 mL Opti MEM separately, followed by mixing for 30 min at room temperature. The plasmid mix was then added onto Expi293F cells in Expi293 Expression Medium at 3 × 10⁶ cells/mL. On day 5 after transfection, the trimeric, prefusion-stabilized spike protein was harvested from the supernatant by centrifugation. The spike protein was purified on a HiTrap histidine chelating resin column (GE Healthcare) using the AKTA FPLC system (Cytiva, USA). The eluted protein was desalted with a desalting membrane (D-0655, Sigma-Aldrich) into 50 mM PBS (pH 7.4), and protein purity was confirmed by SDS-PAGE on 4-12% Bis-Tris-gel and stained with Coomassie Plus Protein Assay Reagents (Thermo Scientific). The final concentration was determined using a BCA protein estimation kit (Pierce). The endotoxin level was measured by the Limulus Amebocyte Lysate (LAL) test (Charles River Laboratories).

Mt-dprE1 (Rv3790) was cloned into pMV261 as previously described [21 (link)]. Mt-dprE2 (Rv3791) was amplified and cloned using the following primers, ctagctagggatccaatggttcttgatgccgtagg and ctagctagaagctttcagatgggcagcttgcggaag, where the underlined sites introduced compatible restriction sites, BamHI and HindIII, at the ends. pCDF-duet was produced using codon-optimized genes, for expression in E. coli. Mt-dprE1 was cloned into the first multiple cloning site, using the primers catgcatgggatccgatgctgtctgttggtgctac and catgcatgaagctttcacagcagttccagacgac, which introduced BamHI and HindIII into the ends of the amplified gene. Mt-dprE2 was cloned into the second cloning site, using the primers, catgcatgcatatggtcctggatgctgtgggc and catgcatgctcgagtcaaatcggcagtttacgg, which introduced a stop codon at the end of the coding sequence of the gene and the restriction sites, NdeI and XhoI. In this configuration, Mt-DprE1 is expressed with an N-terminal hexa-his tag, while Mt-DprE2 is untagged. The N-terminal truncation derivatives of Mt-DprE2 were cloned into the second site of the pCDF-duet-Mt-dprE1 vector, using the reverse primer as previously, and catgcatgcatatgggcaacccgcaaacggtcc for Mt-DprE2 beginning on the seventh amino acid, and catgcatgcatatgagcgaaatcggtctggcaatc for Mt-DprE2 beginning on the nineteenth amino acid.