HGAP

Genomic DNA for E. coli EC958 was prepared using the Qiagen DNeasy Blood and Tissue kit, as per manufacturer's instructions. The genome of E. coli EC958 was sequenced by generating a total of 601,224 pre-filtered reads with an average length of 1,600 bp, from six SMRT cells on a PacBio RS I sequencing instrument, using an 8–12 kilobase (kb) insert library, generating approximately 200-fold coverage (GATC Biotech AG, Germany).
De novo genome assemblies were produced using PacBio's SMRT Portal (v2.0.0) and the hierarchical genome assembly process (HGAP) [23] (link), with default settings and a seed read cut-off length of 5,000 bp to ensure accurate assembly across E. coli rRNA operons. Assemblies were performed multiple times using different combinations of between one and six SMRT cells of read data. The best assembly results were obtained with six SMRT cells which yielded approximately 547 Mb of sequence from 190,145 post-filtered reads (Table 1). The average read length was found to be 2,875 bp with an average single pass accuracy of 86.5%. During the preassembly stage 190,145 long reads were converted into 23,772 high quality, preassembled reads with an average length of 4,573 bp. Assembly of these reads returned seven contigs, three were greater than 500 kb. Furthermore, the largest contig (∼3.8 Mb) was estimated to contain 74.5% of the chromosome of EC958. For all other assemblies total contig numbers exceeded 10 (Table 1). However, for assemblies using two or three SMRT cells, assembly metrics could be improved >2-fold by reducing the seed read length (Table 1).
To determine their correct order and orientation, contigs from our six SMRT cell assembly were aligned to the complete genome of E. coli SE15 using Mauve v. 2.3.1 [24] (link). Contig ordering was confirmed by PCR. Overlapping but un-joined contigs, a characterised artefact of the HGAP assembly process [23] (link), were manually trimmed based on sequence similarity and joined. All joins were manually inspected using ACT [25] (link) and Contiguity (http://mjsull.github.io/Contiguity/).
A single contig representing the EC958 large plasmid pEC958 was identified and isolated by BLASTn comparison against the previous draft assembly of EC958 (NZ_CAFL00000000.1) [7] (link). Overlapping sequences on the 5′ and 3′ ends of the plasmid contig were then manually trimmed based on sequence similarity. Although the EC958 small plasmid (pEC958B) was too small to be assembled as part of the main assembly, 25 unassembled PacBio reads, with an average length of 2,031 bp, were found to align to the small 4,080 bp plasmid contig that had previously been assembled from 454 GS-FLX reads (emb|CAFL01000138).
To determine if reads containing unremoved adapter sequence have had an impact on the assembly of EC958 we first screened the filtered subreads for adapter sequence using BBMap version 31.40 (http://sourceforge.net/projects/bbmap/). A high level of adapter contamination would likely pose some risk of misassembly. Additionally, to eliminate the possibility that aberrant reads have resulted in the inclusion of assembly artefacts in the EC958 genome assembly, contig-ends were screened for hairpin artefacts using MUMmer version 3.23 [26] (link).

A total of 390 sera were collected from two different veterinary clinic laboratories located in Apulia region, Southern Italy and tested upon request of the veterinarian practitioners after anamnesis, medical history and clinical examination. One-hundred seventy-four sera (collection A) had been collected for diagnosis of infectious diseases (FIV, FeLV, feline coronavirus (FCoV), toxoplasmosis, hemoplasmosis, bacterial and fungal infections). A total of 147/174 (84.5%) sera were submitted with a suspect/request of diagnosis for FIV/FeLV, with 42 sera being positive for retrovirus. Fisher’s exact test was performed to the collection A to evaluate the correlation between DCH positive cats and retrovirus positive cats. The significance level of the test was set at 0.05. Of the other 27 sera (15.5%), 14 were sent for a suspect/request of diagnosis for coronavirus (with 7/14 being positive), 5 for toxoplasmosis (with 2/5 being positive), 2 for giardia (with 1/2 being positive). Five sera were collected from animals with suspected bacterial/fungal infections and 1 serum (negative) was from a cat with suspected hemoplasmosis. A total of 216 sera (collection B) submitted to the laboratory for pre-surgical evaluation (n = 85) or for suspected metabolic (n = 127) or neoplastic (n = 4) disease was used for comparison to generate a baseline. Information on the sera analyzed in the study is included in Fig. 1. The study was approved by the Ethics Committee of the Department of Veterinary Medicine, University of Bari (authorization 23/2018). All experiments were performed in accordance with relevant guidelines and regulations.
Total DNA was extracted from collected sera by using QIAamp cador Pathogen Mini Kit (QIAGEN, Hilden, Germany), according to the manufacturer’s instructions. We performed sample screening using a PCR with consensus pan-hepadnavirus primers^{2 (link)} and a PCR with primers specific for DCH^{3 (link)}. Also, we screened sera using a quantitative PCR (qPCR) designed based on the sequence of the Australian reference strain AUS/2016/Sydney (GenBank accession nr. MH307930) (Table 2). For qPCR, we calculated DCH DNA copy numbers on the basis of standard curves generated by 10-fold dilutions of a plasmid standard TOPO XL PCR containing a 1.4 kb long fragment of the polymerase region of the Australian reference strain AUS/2016/Sydney (IQ Supermix; Bio-Rad Laboratories SRL, Segrate, Italy). We added 10 μL of sample DNA or plasmid standard to the 15-μL reaction master mix (IQ Supermix; Bio-Rad Laboratories SRL, Segrate, Italy) containing 0.6 μmol/L of each primer and 0.1 μmol/L of probe. Thermal cycling consisted of activation of iTaq DNA polymerase at 95 °C for 3 min and 42 cycles of denaturation at 95 °C for 10 s and annealing-extension at 60 °C for 30 s. We evaluated the specificity of the assay using a panel of feline DNA viruses (parvovirus, herpesvirus and poxvirus). The qPCR assay was able to detect as few as 10¹ DNA copies per mL of standard DNA and 3.3 × 10⁰ DNA copies per mL of DNA template extracted from clinical samples. DCH quantification displayed acceptable levels of repeatability over a range of target DNA concentrations, when calculating the intra- and inter-assay coefficients of variation within and between runs, respectively^{15 (link),16 (link)}.Table 2

Primer/probes used in this study.

Assay	Primer	Sequence 5′ – 3′	Amplicon size	Tm (°C)	Reference
PCR with consensus pan-hepadnavirus primers	HBV-pol-F1	TAGACTSGTGGTGGACTTCTC	593	45	Wang et al.2 (link)
	HBV-pol-R1	CATATAASTRAAAGCCAYACAG
	HBV-pol-F2	TGCCATCTTCTTGTTGGTTC	258	45
	HBV-pol-R2	AGTRAAYTGAGCCAGGAGAAAC
PCR with specific primers for DCH	Hgap-F	GTGCTCTGATAACCGTATGCTC	230	55	Aghazadeh et al.3 (link)
	Hgap-R	CTAGAATGGCTACATGGGGTTAG
Quantitative PCR (qPCR)	FHBV- for	CGTCATCATGGGTTTAGGAA	105	50	This study
	FHBV- rev	TCCATATAAGCAAACACCATACAAT
	FHBV- prob	[FAM]TCCTCCTAACCATTGAAGCCAGACTACT [BHQ]

We carried out inferential statistical analyses using the Chi-Squared test with Yates’ Correction, the evaluation of the odds ratio (OR) and 95% confidence interval (CI95%) with the online software MedCalc easy-to-use Statistical software (https://www.medcalc.org/calc/odds_ratio.php). The significance level of the test was set at 0.05.
Full genome sequences of hepadnaviruses were retrieved from the GenBank database and aligned using Geneious version 9.1.8 (Biomatters LTD, Auckland, New Zealand) and the MAFFT algorithm^{17 (link)}. A set of genome sequences used in a previous study^{2 (link)} was integrated with additional genome sequences of hepadnaviruses of recent identification in mammalian, avian, amphibian species and in fish. The final dataset included 53 hepadnavirus genomes. Phylogenetic analysis was performed using JModel test (http://evomics.org/resources/software/molecular-evolution-software/modeltest/) to evaluate the correct best-fit model of evolution for the entire dataset. Bayesian analysis^{18 (link),19 (link)} was therefore applied using four MCMC chains well-sampled and converging over one million generations (with the first 2000 trees discarded as “burn-in”) and supplying statistical support with subsampling over 1000 replicates. The identified program settings for all partitions, under the Akaike information criteria, included six-character states (general time-reversible model), a proportion of invariable sites and a gamma distribution of rate variation across sites (GTR + I + G). We also tried to perform phylogenetic analyses using other evolutionary models (Maximum likelihood, Neighbor joining) to compare the topology of phylogenetic trees. We could observe similar topologies with slight difference in bootstrap values at the nodes of the tree. Accordingly, we did prefer to retain the Bayesian tree. We deposited the nucleotide genome sequence of strain ITA/2018/165-83 (MK117078) in GenBank.

Before initiating the genome sequencing process, the quantity and purity of the genomic DNA were determined using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). This step was performed to ensure the quality of the genomic DNA for obtaining a complete genome sequence. Genome sequencing was conducted using the PacBio RS II single-molecule real-time (SMRT) sequencing technology from Pacific Biosciences (Menlo Park, CA, USA). SMRTbell library inserts of 20 kb were prepared and sequenced using SMRT cells. Raw sequencing data were generated and subjected to de novo assembly utilizing the hierarchical genome assembly process (HGAP) protocol [19 (link)] and RS HGAP4 Assembly in SMRT analysis software (ver. 2.3; Pacific Biosciences, SMRT Link 4.0.0).

The S. collinus Inha504 genome was sequenced at Macrogen (South Korea) using the Illumina HiSeq (Illumina, USA) platforms and the PacBio RSII (Pacific Biosciences, USA). Library preparation for Illumina HiSeq sequencing was performed using the TruSeq DNA sample preparation kit for Illumina (NE, USA), with a library insert size of 350 bp; Library preparation for PacBio RS SMRT sequencing was performed using the PacBio DNA Template Prep Kit 1.0 (Pacific Biosciences, USA) and the library insert size was 20 kb. A high-quality sequence was obtained by correcting the assembled contig error using Pilon (v1.21) software. The de novo assembly of the sequenced fragments was performed using HGAP (v3.0) performs. The validation check of the analyzed fragments was performed using BLAST (v2.7.1 +) software and BUSCO (v3.0) software. The annotation was performed using Prokka (v1.12b) software.