His6 tag

The three-promoter vector pTriEx2 (Novagen) was used as the basis for construction of the pOPIN series of expression vectors (Table 1). The In-Fusion™-ready vectors described here include fusion tags for N-His₆ plus a 3C cleavage site (5 (link)), N-His₆-Glutathione-S-Transferase (GST) plus a 3C cleavage site, N-His₆-Maltose Binding Protein (MBP) plus a 3C cleavage site, a C-terminal Lys-His₆ or a secretion leader sequence in combination with C-terminal LysHis₆. All of the N-terminal fusion tags are removable with the use of 3C protease and the histidine residues of the C-terminal tags are removable by Carboxypeptidase A to leave only the C-terminal lysine (6 ).
Table 1.

Summary of In-Fusion™ site sequences and characteristics of the pOPIN vectors presented in this article

Vector	Fusion tag	Parent vector/ antibiotic resistance	Promoters/baculoviral recombination sites	Forward primer extension	Reverse primer extension
pOPINE	C-terminal … KHHHHHH	pTriEx2/ampicillin	T7lacO, CMV enhancer and β-actin promoter, p10 promoter/ lef-2 and 1629 baculo elements.	AGGAGATATACCATG†	GTGATGGTGATGTTT†
pOPINF*	N-terminal MAHHHHHHSSGLEVL FQGP …	pTriEx2/ampicillin	T7lacO, CMV enhancer and ββ-actin promoter, p10 promoter/ lef-2 and 1629 baculo elements.	AAGTTCTGTTTCAGGGCCCG‡	ATGGTCTAGAAAGCTTTA‡
pOPING	N-terminal MGILPSPGMPALLSLV SLLSVLLMGCVAET G … cleavable secretion leader and C-terminal … KHHHHHH	pTriEx2/ampicillin	(T7lacO-not used), CMV enhancer and β-actin promoter, p10 promoter/lef-2 and 1629 baculo elements.	GCGTAGCTGAAACCGGC	GTGATGGTGATGTTT
pOPINJ*	N-terminal MAHHHHHHSSG-GST- LEVLFQÞGP …	pTriEx2/ampicillin	T7lacO, CMV enhancer and β-actin promoter, p10 promoter/lef-2 and 1629 baculo elements.	AAGTTCTGTTTCAGGGCCCG‡	ATGGTCTAGAAAGCTTTA‡
pOPINM*	N-terminal MAHHHHHHSSG-MBP- LEVLFQGP …	pTriEx2 ampicillin	T7lacO, CMV enhancer and β-actin promoter, p10 promoter/lef-2 and 1629 baculo elements.	AAGTTCTGTTTCAGGGCCCG‡	ATGGTCTAGAAAGCTTTA‡

-represents the point of cleavage by 3C protease or signal peptidase (as appropriate). Vectors marked ^‡ use the same primer extensions, enabling the same PCR product to be cloned into all marked vectors. Underlined sequences represent methionine initiation or stop codons (as appropriate) and may be excluded from the gene-specific primers.

To enable blue/white screening of recombinant clones (blue colonies indicate the presence of non-linearized/non-recombinant parental vector) the lacZ insert from intact pDNR-Dual (Clontech–Takara Bio Europe) was amplified using KOD Hi-Fi polymerase according to the manufacturer's instructions (Novagen) and the following primer pairs: Efwd: 5′-GAGATATACCATGGCACACCATCACCACCATCACAGCAGCGGTACCGTCGACCCGACTG GAAAGCG-3′ versus Erev: 5′-ACTTAGTGATGGTGATGGTGATGTTTAAACTGGTCTAGAAAGCTTGGCGCC-3′ Ffwd: 5′-GAGATATACCATGGCACACCATCACCACCATCACAGCAGCGGTCTGGAAGTTCTGTTTCA GGGTACCGTCGACCCGACTGGAAAGCG-3′ versus Frev: 5′-ACTTAGTGATGGTGATGGTGATGTTTAAACTGGTCTAGAAAGCTTGGCGCC-3′.
PCR products were purified by agarose gel electrophoresis and gel extraction (Geneclean–Bio101, Morgan Irvine, CA, US). Products E and F were extended 3′ by amplification versus MscIrev primer: 5′-ccacaccagccaccaccttctga-3′ with pTriEx2 as template.
The extended products E and F were purified and digested with NcoI before ligation into NcoI/MscI cut pTriEx2. Ligation products were transformed into TAM1 cells (Activ Motif, Rixensart, Belgium) and screened for β-galactosidase activity on LB Agar plates supplemented with 50 µg/ml carbenicillin/0.2% w/v X-Gal and 1 mM IPTG. Colonies expressing β-galactosidase activity were picked, grown overnight in 1.5 ml LB supplemented with the appropriate antibiotic and the resulting plasmids extracted by standard methods.
pOPINE was created by ligation of the NcoI-digested extended product E into NcoI/MscI-cut pTriEx2. pOPINF* was created by ligation of the NcoI-digested extended product F into NcoI/MscI-cut pTriEx2. pOPINF was then created by the deletion of the sequence encoding the C-terminal Lys-His₆ tag from pOPINF* by the ligation of a phosphorylated primer duplex into PmeI/MscI-cut pOPINF*: TriEx-CH6fwd: 5′-GTGATTAACCTCAGGTGCAGGCTGCCTATCAGAAGGTGGTGGCTGGTGTGG-3′ TriEx-CH6rev: 5′-CCACACCAGCCACCACCTTCTGATAGGCAGCCTGCACCTGAGGTTAATCAC-3′.
pOPINF was derived in order to increase the efficiency of cloning of N-His₆-3C pOPINF* constructs by deletion of the sequence encoding the C-terminal Lys-His₆ tag as, in a small number of In-Fusion™ reactions with pOPINF* a ‘fusion’ of the sequences encoding both N- and C-terminal His₆ tags was observed (data not shown).
pOPING was generated by amplification of the µ-phosphatase secretion leader sequence from pHLsec (7 (link)) using sigpepfwd: 5′-CAAGCTTGCCACCATGGGGATC-3′ and sigpeprev: 5′-CGGGGTACCGGTTTCAGCTACGCAAC-3′ primers. The resulting 113 bp PCR product was gel purified, digested with NcoI and KpnI enzymes and ligated into NcoI and KpnI-cut, and purified, pOPINE (this digest removes the N-His₆ site insert from pOPINE). This vector encodes the MGILPSPGMPALLSLVSLLSVLLMGCVAETG secretion leader sequence (where indicates the cleavage site for the eukaryotic signal peptidase enzyme).
pOPINJ was generated by amplification of the N-His GST sequence from pDESTH6N15 (derived from the Gateway™ GST vector, pDEST15, Berrow unpublished data) using the following primers: pOPIN-GST-fwd: 5′ GAATTCCATGGCACATCACCATCACCATCACATGTCCCCT 3′ pOPIN-GST-rev: 5′ CGACGGTACCCTGAAACAGAACTTCCAGACCGCTGCTCAGATCCGATTTTGGAGGATG 3′ The resulting ∼700 bp PCR product was gel purified, digested with NcoI and KpnI, re-purified and ligated into NcoI and KpnI-cut pOPINE to produce pOPINJ. This vector encodes an N-terminal His₆-GST-3C cleavable tag: MAHHHHHHSSG-GST-SSGLEVLFQGP … (where indicates the cleavage sites for 3C protease).
Similarly pOPINM was generated by amplification of the MBP sequence from pMAL2c (NEB, Hitchin, Hertfordshire, UK) using the following primer pairs MBPinffwd: 5′ ACCATCACAGCAGCGGCATGAAAATCGAAGAAGGTAAACTGG 3′ and MBP SSG 3C rev: 5′ GTCGACGGTACCCTGAAACAGAACTTCCAGACCGCTGCTAGTCTGCGCGTCTTTCAGGGC 3′ The resulting ∼1200 bp PCR product was gel purified and then extended 3′ by PCR using pOPINE as template and LACZ + 3′INF REV: 5′ CTGGTCTAGAAAGCTTGGCGCCATTCGCCATTCAG 3′ as the reverse primer.
The resulting ∼1500 bp PCR product was then gel purified and In-Fused into NcoI and HindIII-cut pOPINE (normal NcoI-KpnI cloning of this fragment was not thought possible due to the presence of an internal NcoI site, although recent checking of the pOPINM sequencing data reveals that the NcoI site has been previously removed c.f. the sequence available at NEB).
This vector encodes an N-terminal His₆-MBP-3C cleavable tag: MAHHHHHHSSG-MBP-SSGLEVLFQGP … (where indicates the cleavage sites for 3C protease).
For full details of the fusion tags contributed by these vectors see Table 1, for a summary of the construction of these vectors see Figure 1.
Figure 1.

Vector derivations and maps. Derivation of the pOPIN vectors from pTriEx2. PCR fragments were prepared as described in the Materials and methods section and either ligated into the pTriEx2 vector or inserted by In-Fusion™. In cases where the pOPIN vector is not directly derivatized from pTriEx2, the intermediate vector is also shown. Features of the pTriEx2 vector retained in the pOPIN vector suite are: T7/lacO promoter/operator and terminator for inducible expression in E. coli harbouring the λ (DE3) prophage, CMV Enhancer/Chicken β-actin promoter and rabbit β-globin polyA site for efficient expression in mammalian hosts, p10 baculoviral promoter and 5′ UTR/ORF603 and ORF 1629 for efficient expression from/recombination into baculovirus respectively. The high-copy pUC origin of replication and β-lactamase (Ampicillin resistance marker) gene allow high-copy production of the vector in E. coli.

The pTriEx2 vector contains the hybrid CMV and Chicken β-actin promoter/enhancer combination (CAG) promoter that has been reported to give higher expression levels when compared to those vectors (e.g. pTriEx4) using CMV-derived promoter and enhancer (8 (link)). In addition this vector contains a Kozak consensus sequence (9 (link)) for efficient initiation of translation in eukaryotic hosts. The presence of the p10 baculoviral promoter and the flanking lef2 (ORF 603) and ORF1629 baculoviral recombination sites allow the construction of recombinant baculoviruses and, finally, a T7 polymerase promoter with lacO operator offers high level inducible expression in E.coli harbouring the λ (DE3) prophage (10 (link)).
The integrity of all the vectors was verified by sequencing (MWG Biotech, London, UK) before large-scale plasmid preparations were performed. Prior to their use in In-Fusion™ reactions, pOPINF, pOPINJ and pOPINM vectors were prepared by digestion with KpnI and HindIII, pOPINE by digestion with NcoI and PmeI and pOPING by digestion with KpnI and PmeI. All restriction digests were followed by agarose gel electrophoresis, gel extraction and purification before elution in 10 mM Tris pH 8.0 buffer. Linearized vectors were stored at −20°C in 10 µg aliquots (equivalent to one 96-well plate of In-Fusion™ reactions).
For full details of the fusion tags contributed by the pOPIN vectors see Table 1, for a summary of the construction of these vectors see Figure 1. and the Genbank Accession Numbers for these vectors are as follows … EF372394 (pOPING), EF372395, (pOPINJ), EF372396 (pOPINM), EF372397 (pOPINE), EF372398 (pOPINF).

PCR verified expression constructs were transformed into either B834 (DE3) or Rosetta(DE3)LysS E. coli (Novagen) in 96-tube format as described for OmniMaxII transformations with 1% w/v Glucose replacing the X-Gal and IPTG reagents in the LB agar. All plates and subsequent media used for the culture of the Rosetta(DE3) LysS cells are identical to those described for B834(DE3) cells but also supplemented with 35 µg/ml chloramphenicol to maintain the pRareLysS plasmid. Plates were incubated for 18 h at 37°C before individual colonies were used to inoculate, 500 µl GS96 (Bio101, QBioGene, Cambridge, UK) supplemented with 0.05% v/v glycerol, 1% w/v glucose and 50 µg/ml carbenicillin in 96-well deep-well plates. The plates were sealed with gas-permeable adhesive seals and shaken at 225 r.p.m. at 37°C for 18 h. For IPTG induction of expression, 50 µl of each overnight culture was then used to inoculate (in four 24-well deep-well plates) 2.5 ml of GS96 supplemented with 50 µg/ml carbenicillin. The diluted cultures were grown at 37°C with shaking at 225 r.p.m., for 3 h before reducing the temperature to 20°C, addition of ITPG to a final concentration of 0.5 mM and shaking for a further 18 h at 20°C. For auto-induction of expression, 50 µl of each overnight culture was used to inoculate (in four 24-well deep-well plates) 2.5 ml of Overnight Express™ Instant TB media (Novagen) supplemented with 50 µg/ml carbenicillin. The diluted cultures were grown at 37°C with shaking at 225 r.p.m., for 3 h before reducing the temperature to 25°C and shaking for a further 24 h at 25°C.
A 1.5 ml aliquot of culture from each well was then transferred to a 2 ml 96-well deep-well plate using a Theonyx robot (Aviso Gmbh, Gera, Germany) and harvested by centrifugation at 6000 g for 10 min at 4°C before decanting of the waste media. Pelleted cells were frozen at −80°C for at least 30 min prior to screening for soluble His₆-tag protein expression using either the Theonyx or BR8000 robotic platforms with standard Qiagen Ni-NTA magnetic bead protocols (as per manufacturer's instructions). Proteins purified by elution from the Ni-NTA beads were analysed on SDS-PAGE gels (Criterion™ 10–20% gradient gels—Biorad, Hemel Hempstead, UK or InVitrogen NuPAGE™ Novex 10% Bis-Tris Midi gels with MES buffer system) and visualized with SafeStain™ (InVitrogen). Scale-up and purification of proteins from E. coli were carried out as described earlier (11 (link)).