HNRNPK protein, human

Chromatin immunoprecipitation of H4K12ac was performed as described previously [10 (link)] using anti-acetyl-histone H4 (Lys12) (07-595; EMD Millipore) and negative control IgG (ab37415; abcam) with 10 min crosslinking with 1% formaldehyde. The following primers were used for ChIP-qPCR analyses: GREB1 TSS Forward - 5′-GCCAAATGGAAGAAGGACAG-3′, Reverse - 5′-ACCACCTACCTCCAGTCACC-3′; CXCL12 TSS Forward – 5′-GCAGTGCGCTCCGGCCTTT-3′, Reverse - 5′-CCTCACTGCAGACCGGGCCA-3′; XBP1 TSS Forward – 5′-ATCCCCAGCTCTGGTCATCT-3′, Reverse- 5′-GCCCAGGGCTCTTTTCTGTA-3′; RPLP0 TSS Forward – 5′-CTTCGCGACCCTACTTAAAGG-3′, Reverse – CAATCAGAAACCGCGGATAG-3′; GAPDH TSS Forward – 5′-CGGCTACTAGCGGTTTTACG-3′, Reverse – 5′-AAGAAGATGCGGCTGACTGT-3′; hnRNPK adjacent to TSS Forward- 5′- TCCACGAGGTCCCTAGTTCC-3′, reverse – 5′- GCCATTTCCCTGAGCGTGTA-3′.
ChIP-seq libraries were made using the NEBNext Ultra DNA library preparation kit according to the manufacturer's instructions [10 (link)]. The size range of the libraries was verified to be 250-600 bp using Bioanalyzer 2100. 75 bp single-ended tags were sequenced with single indexing using Illumina NextSeq 500 (XCelris Genomics, Ahmedabad, India). Previously published data for BRD4, H2Bub1 and ERα ChIP-seq as well as RNA-seq are available from the NCBI Gene Expression Omnibus (GEO) (GSE55921, GSE55922) [10 (link)]. Raw data for FOXA1, H3K4me3, H3K27me3 [42 ], H3K27ac [41 (link)], RNAPII [40 (link)], and GRO-seq [24 (link)] were downloaded from the European Nucleotide Archive. Normalization of RNA-sequencing read counts for each gene was performed using DESeq [62 ].

Ten million cells and 5 µg of antibody were used for each antibody pulldown experiment for ChIP^{32 (link),34 (link)}. ChIP was performed using the following antibodies: HNRNPK (Bethyl Laboratories: A300-674A), RNA Pol II (Active motif: 39097), RNA Pol II CTD Phospho S2 (Active Motif: 91115), Rabbit IgG (Millipore: 12–370) and mouse IgG (Abcam: ab18413). Cells for the RNA Pol II ChIP-QPCR or ChIP-Seq were fixed at a final concentration of 1% formaldehyde (ThermoFisher 28908). Cells for the HNRNPK ChIP-QPCR or ChIP-Seq were fixed in both formaldehyde (1% final concentration) and disuccinimidyl glutarate (DSG, Thermo Fisher 20593, 2 mM final concentration). QPCR results are represented as a percentage of input DNA. QPCR primers for ChIP are as follows: CCNA2 FOR: AGTTGCCCAACATCACTGCT, CCNA2 REV: CGGCGGCTACGACTATTCT; FGFBP1 FOR: TCCCAGACACCTGACCTCTC, FGFBP1 REV: TGGAGCTGGATTTTGGAAAG; HMG20B FOR: CCCTGAGTCACCCCCTACC, HMG20B REV: GGGCCATGTAGAAGTCCAGA; MYC FOR: CAAAAATGAGGGGCTGTGTT, MYC REV: GGCAAGGATTTGCTTTTCAG; PTHLH FOR: ACCTGCAACAGAAGGGAATG, PTHLH REV: ACTTGGGAGATGCCCTTGAT; ITGB4 FOR: CCTTCTGTGCCTGGTCTCTC, ITGB4 REV: CCCACACTGTGACTGCCATA; CCND2 FOR: CCGAAAACCCCCTATTTAGC, CCND2 REV: CCCTCTCCCTCCTGCTTTC; EGFR FOR: AGGGAAGCTGAGGAAGGAAC, EGFR REV: CCGGCTTCAGTTTGAGACCT; CYR61 FOR: ACCAGCTTGTTGGCGTCTT, CYR61 REV: GGTCAAGTGGAGAAGGGTGA; MYC position 1 FOR: GGAGATCCGGAGCGAATAG, MYC position 1 REV: GCTGCTATGGGCAAAGTTTC; MYC position 2 FOR: GTCCCAAGCACTCCTAAGCA, MYC position 2 REV: CAGTGAATCTTGGGCATGTG; CYR61 position 1 FOR: ACCAGCTTGTTGGCGTCTT, CYR61 position 1 REV: GGTCAAGTGGAGAAGGGTGA; CYR61 position 2 FOR: AAGGTGTGAGGCTTTTGTGG, CYR61 position 2 REV: TTGTTGGACTCCAGTGTTGG; EGFR position 1 FOR: AGGGAAGCTGAGGAAGGAAC, EGFR position 1 REV: CCGGCTTCAGTTTGAGACCT; EGFR position 2 FOR: GGGAAAGGGTGTAGCCCATA, EGFR position 2 REV: TTCCTGTTGGGTTTTCAGGT.
For ChIP-Seq, the ChIP DNA library was prepared using the TruSeq DNA sample prep kit (Illumina). Sequencing was done on HiSeq 4000 System (Illumina) using single 1 × 75 reads at the Institute for Genomic Medicine Core, UCSD. HNRNPK ChIP-seq was performed in triplicates. The RNA Pol II ChIP-Seq was performed in CTLi and HNRNPKi cells in duplicates. The ChIP-seq reads were processed by the Kundaje ChIP-seq pipeline (https://github.com/kundajelab/chipseq_pipeline) on our local workstation. The reads were first trimmed based on quality score before alignment to reference hg19; Upon alignment and deduplication, the peak-calling was then carried out by MACS2^{38 (link),39 (link)} with a cutoff q-value of 0.05. The heatmaps for the ChIP-Seq data were generated using seqMINER^{57 (link)}. Gene tracks were visualized using UCSC genome browser along with annotation tracks. Differential peaks between samples were obtained by diffReps 1.55.4^{42 (link)} using negative binomial test with a scanning window size of 1000 bp, step size of 100 bp, and a cutoff p-value of 0.0001.

Protein extracts were prepared using high-salt lysis buffer (Hepes 50 mM, pH 7.5, NaCl 500 mM, DTT 1 mM, EDTA 1 mM, 0.1% NP-40) supplemented with 1% protease inhibitor cocktail (Sigma-Aldrich). Then, 10–20 μg cell and tissues lysates were separated on 10% NuPAGE gels (Invitrogen), transferred onto a nitrocellulose membrane (Invitrogen) and incubated with the following antibodies: anti-p65BTK (BN49); anti-BTK (sc-1696) anti-hnRNPK (sc-25373) from Santa Cruz Biotechnologies; anti-ERK (#9101), anti-phospho-ERK (Thr202/Tyr204) (#4370), anti-eIF4G2 (#5169) from Cell Signaling; anti-actin (A1978), anti-vinculin (V9264), anti-phospho-hnRNPK (SAB4504229) from Sigma-Aldrich; and anti-RAS (#05-516) from Millipore. Each single blot was reprobed with anti-actin or anti-vinculin as loading control. Images were acquired using G:BOX XT4 Chemiluminescence and Fluorescence Imaging System (Syngene, Cambridge, UK) and processed with Adobe Photoshop.

The siRNA oligos targeting SRSF1, SRSF2, SRSF3, SRSF5, SRSF6, SRSF7, SRSF9, SRSF10, hnRNPM, hnRNPK, and hnRNPH1 were synthesized by Gene Pharma Company, the negative control si-NC was included. These siRNAs were transfected into cells with X-tremeGENE siRNA Transfection Reagent (ROCHE). The sequences were listed in Table S3.
The shRNAs specifically targeting SRSF2 (sh-SRSF2), SLMAP-Long isoform (sh-SLMAP-L), SLMAP-Short isoform (sh-SLMAP-S), CETN3-Long isoform (sh-CETN3-L), CETN3-Short isoform (sh-CETN3-S), and negative control (sh-Luci) were independently expressed in the knockdown lentiviruses vector PLKO.1-puro. The designed shRNAs were synthesized by Sangon Biotech. The shRNA sequences were listed in Table S4.
The wildtype SRSF2 (SRSF2-WT), SRSF2 domain deletion mutants (SRSF2-△RRM and SRSF2-△RS), the wildtype SRSF1 (SRSF1-WT), and wildtype hnRNPM (hnRNPM-WT) were constructed into pcDNA3.0 vector containing HA tag. Plasmids expressing SRSF2, SLMAP-L, SLMAP-S, CETN3-L, and CETN3-S transcript were constructed into PCDH-puro vector independently and synthesized by Sangon Biotech.

Gene mutation analysis was performed using DNA extracted from bone marrow aspirate specimens in a small subset of patients. Amplicon-based next generation sequencing (NGS) targeting the entire coding regions of a panel of 81 genes was performed using a MiSeq platform (Illumina, San Diego, CA, USA) to detect somatic mutations and insertions and/or deletions as previously described [11 (link)]. The 81-gene panel included: ANKRD26, ASXL1, ASXL2, BCOR, BCORL1, BRAF, BRINP3, CALR, CBLB, CBLC, CBL, CRLF2, CREBBP, CEBPA, CSF3R, CUX1, DDX41, DNMT3A, EED, ELANE, ETNK1, ETV6, EZH2, FBXW7, FLT3, GATA1, GATA2, GFI1, GNAS, HNRNPK, HRAS, IDH1, IDH2, IKZF1, IL2RG, IL7R, KRAS, JAK2, JAK3, KDM6A, KIT, KMT2A, MAP2K1, MPL, NF1, NOTCH1, NPM1, NRAS, PAX5, PHF6, PIGA, PML, PRPF40B, PTEN, PTPN11, RAD21, RARA, RUNX1, SETBP1, SF1, SF3A1, SF3B1, SH2B3, SMC1A, SMC3, SRSF2, STAG1, STAG2, STAT3, STAT5A, STAT5B, SUZ12, TERC, TERT, TET2, TP53, U2AF1, U2AF2, WT1, and ZRSR2. All coding exons for each gene were covered with an analytical sensitivity of 5% mutant reads in a background of wild-type reads. Established bioinformatics pipelines were used to identify somatic variants.

The differentiated osteoblasts and osteoclasts were lysed in a radioimmune assay precipitation buffer (Thermo Fisher Scientific), and western blotting was performed as described previously (Cho et al., 2021 (link)). Rabbit anti-Prdx1 (Invitrogen), rabbit anti-Prdx2 (Ab Frontier), rabbit anti-Prdx3 (Ab Frontier), rabbit anti-Prdx4 (Abcam), mouse anti-Prdx5 (Invitrogen), rabbit anti-Prdx6 (Invitrogen), mouse anti-AR (Santa Cruz), rabbit anti-hnRNPK (CST), rabbit anti-Lamin β (Ab Frontier), and mouse anti-β-Actin (Sigma-Aldrich) antibodies were used to detect proteins.
Nuclear proteins were isolated from osteoblasts at day 7 under BMP2 stimulation using NE-PER Nuclear and cytoplasmic extraction reagents (Thermo Fisher Scientific) according to the manufacturer’s instruction.
Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific), and cDNA was synthesized as previously described (Cho et al., 2021 (link)). Quantitative PCR was performed using a SYBR Green-based system (Thermo Fisher Scientific), and data were calculated using the 2^-ΔΔCT method. Three separate experiments were performed. The primers used are listed in Table 4.