The largest database of trusted experimental protocols

IgG1

IgG1 is a subclass of immunoglobulin G (IgG), one of the five major classes of antibodies found in humans.
IgG1 plays a crucial role in the humoral immune response, capable of neutralizing toxins, activating the complement system, and facilitating the clearance of pathogens.
Researchers can leverage the power of IgG1 research using PubCompare.ai, an AI-driven platform that helps optimize protocols for unparraleled reproducibility and accuracy.
PubCompare.ai enables users to quickly locate the best IgG1 protocols from literature, pre-prints, and patents, while utilizing AI-driven comparisons to identify the most effective products and procedures.
This cutting-edage technology streamlines IgG1 research, empowering scientists to make breakthroughs in this critical area of immunology.

Most cited protocols related to «IgG1»

Plasmids encoding the signal sequence of CD5 and a fusion of the S1 domain of the SARS-CoV S protein (residues 12–672), or the first 316 residues of that domain (12–327), with the Fc region of human IgG1 (S1–Ig and S1(327)–Ig, respectively) were transfected into 293T cells, and immunoglobulin fusion proteins were purified on protein A Sepharose beads. A total of 5 × 105 293T cells transfected with ACE2-expressing or control plasmids, or the same number of untransfected Vero E6 cells, were incubated with 15 µg ml-1 of S1–Ig or S1(327)–Ig in a volume of 100 µl. In some cases, 15 µg ml-1 of soluble forms of ACE1 or ACE2 (R&D Systems) was also included. Cells were washed in PBS with 0.5% BSA and 0.1% NaN3, incubated with FITC-labelled goat anti-human IgG Fc (Sigma), and analysed by flow cytometry.
Publication 2003
ACE2 protein, human anti-IgG Cells Flow Cytometry Fluorescein-5-isothiocyanate Goat HEK293 Cells Homo sapiens IgG1 Plasmids Proteins Signal Peptides Sodium Azide spike glycoprotein, SARS-CoV Staphylococcal protein A-sepharose
Total RNA was prepared from NLDC-145 19 and GLII7 (gift of R.J. Hodes, National Institutes of Health, Bethesda, MD) hybridomas (both rat IgG2a) using Trizol (GIBCO BRL). Full-length Ig cDNAs were produced with 5′-RACE PCR kit (GIBCO BRL) using primers specific for 3′-ends of rat IgG2a and Ig kappa. The V regions were cloned in frame with mouse Ig kappa constant regions and IgG1 constant regions carrying mutations that interfere with FcR binding 20. DNA coding for hen egg lysozyme (HEL) peptide 46–61 with spacing residues on both sides was added to the C terminus of the heavy chain using synthetic oligonucleotides. Gene specific primers for cloning of rat IgG2a and Ig kappa: 3′-ATAGTTTAGCGGCCGCGATATCTCACTAACACTCATTCCTGTTGAAGCT; 3′-ATAGTTTAGCGGCCGCTCACTAGCTAGCTTTACCAGGAGAGTGGGAGAG-ACTCTTCT; HEL peptide fragment construction: 5′-CTAGCGACATGGCCAAGAAGGAGACAGTCTGGAGGCTCGAG-GAGTTCGGTAGGTTCACAAACAGGAAC; 5′-acagacgtagcacagactatggtattctccagattaacagcaggtattatgacggtaggacatgataggc; 3′-gctgtaccggttcttcctctgtcagacctccgagctcctcaa-gccatccaagtgtttgtccttgtgtctg; 3′-CCATCGTGTCTGATACCATAAGAGGTCTAATTGTCGTCCATAATACTGCCATCCTGTACTATCCGCCGG.
Hybrid antibodies were transiently expressed in 293 cells after transfection using calcium-phosphate. Cells were grown in serum-free DMEM supplemented with Nutridoma SP (Boehringer). Antibodies were purified on Protein G columns (Amersham Pharmacia Biotech). The concentrations of purified antibodies were determined by ELISA using goat anti–mouse IgG1 (Jackson Immunotech).
Publication 2001
Antibodies Calcium Phosphates Cells DNA, Complementary Enzyme-Linked Immunosorbent Assay G-substrate Genes Goat hen egg lysozyme hen egg lysozyme peptide (46-61) Hybridomas Hybrids IgG1 IgG2A Immunoglobulin Constant Regions Mice, House Mutation Oligonucleotide Primers Oligonucleotides Peptide Fragments Reading Frames Serum Transfection trizol
Immunofluorescence detection of CPAF in chlamydia-infected cells was carried out as described previously 67. In brief, HeLa cell monolayer was infected with Chlamydia trachomatis L2 for 30 h. The monolayer, after it was fixed with paraformaldehyde (Sigma-Aldrich) and permeabilized with Saponin (Sigma-Aldrich), was costained with Hoechst 32258 (blue), anti-MOMP antibody MC22 (probed with an FITC-conjugated, mouse IgG3-specific secondary antibody), and anti-CPAFn antibody 54b (probed with a Cy3-conjugated, mouse IgG1-specific secondary antibody). Images were acquired individually for each stain in gray using a Cooker digital camera connected to an AX70 Olympus microscope, and the single-color images were merged in frame into the triple-color image using the software Image Pro.
Publication 2001
Antibodies, Anti-Idiotypic Cells Chlamydia Chlamydia trachomatis Chlorpropamide-Alcohol Flushing Fingers Fluorescein-5-isothiocyanate Fluorescent Antibody Technique HeLa Cells hoechst 32258 IgG1 IgG3 Immunoglobulins Microscopy Mus paraform Reading Frames Saponin Stains
Microtitre plates (Immulon 4HBX, Thermo) were coated with recombinant MSP-119.GST (to which antibodies are predominantly of the IgG1 subclass [36 (link)]) or MSP-2.GST (to which antibodies are predominantly IgG3 [36 (link)]) and blocked with 1% (w/v) skimmed milk powder. Samples were assayed as described previously[36 (link),37 (link)] except that coating antigens, test samples and secondary antibody conjugate were each added in a total volume of 50 μl per well. Ten microliters of the antibody-containing eluate of each spot were added to individual wells of the coated and blocked microtitre plate together with 40 μl blocking buffer to give a final concentration of 1:1,000 with respect to the corresponding plasma sample. Each plate included a five-fold dilution series (1:50 to 1:156,250 final dilutions) of a standard African hyperimmune plasma pool. Bound antibodies were detected with either rabbit anti-human-IgG -HRP (Dako, Ely, UK), or sheep-anti-human IgG1 or IgG3-HRPconjugates (The Binding Site, Birmigham, UK) secondary antibodies and developed with o-phenylenediamine-H2O2.
A titration curve was fitted to the ODs obtained for the standard plasma dilutions by least squares minimisation using a three variable sigmoid model and the solver add-in in Excel (Microsoft), assuming an arbitrary value of 1000 Units/ml of antibody against each antigen in the standard pool. OD values for the spot extracts were converted to units/ml using this fitted curve.
Recoveries for blood spots were estimated as follows (full details in Additional file 1): serum or plasma ODs were converted to concentrations as above, the concentrations were multiplied by a recovery factor and then converted back to 'corrected' ODs – the ODs which would have been obtained if the serum or plasma had been more dilute. The value of the recovery factor was then optimized by weighted least squares minimisation comparing the actual ODs for the blood spots and the corrected OD values for serum or plasma, using the solver add-in in Excel™.
Full text: Click here
Publication 2008
1,2-diaminobenzene anti-IgG Antibodies Antigens Binding Sites BLOOD Buffers Exanthema factor A Homo sapiens IgG1 IgG3 Immunoglobulins Milk, Cow's Negroid Races Peroxide, Hydrogen Plasma Powder Rabbits Serum Sheep Sigmoid Colon Technique, Dilution Titrimetry
The mAb CR3014 was isolated from a semisynthetic single-chain variable antibody fragment (scFv) phage display library, expressed as human IgG1 molecules and purified as described previously [
22 (link),
27 (link)]. An immune scFv phage display library was constructed from lymphocytes of a convalescent SARS patient from Singapore essentially as described [
28 (link)]. From this library, CR3022 scFv was selected for binding to UV-inactivated SARS-CoV, essentially as described [
22 (link)]. SARS-CoV (Frankfurt 1 strain [FM1]) was prepared as described and UV-irradiated for 15 min (UVB radiation, 280–350 nm; λ
max, 306 nm) at 4 °C. CR3022 scFv was converted into a human IgG1 format and expressed and purified as described. Anti-rabies mAb CRJA served as negative control.
Full text: Click here
Publication 2006
cDNA Library CR3022 Homo sapiens Hydrophobia IgG1 Immunoglobulins Lymphocyte Patients Phage Display Techniques Radiation Severe Acute Respiratory Syndrome Severe acute respiratory syndrome-related coronavirus Single-Chain Antibodies Strains

Most recents protocols related to «IgG1»

Example 1

a. Materials and Methods

i. Vector Construction

1. Virus-Like Particle

As most broadly neutralizing HPV antibodies are derived from the highly conserved N-terminal region of L2, amino acids 14-122 of HPV16 L2 were used to create HBc VLPs. L2 with flanking linker regions was inserted into the tip of the a-helical spike of an HBc gene copy which was fused to another copy of HBc lacking the L2 insert. This arrangement allows the formation of HBc dimers that contain only a single copy of L2, increasing VLP stability (Peyret et al. 2015). This heterodimer is referred to as HBche-L2. A dicot plant-optimized HPV16 L2 coding sequence was designed based upon the sequence of GenBank Accession No. CAC51368.1 and synthesized in vitro using synthetic oligonucleotides by the method described (Stemmer et al., 1995). The plant-optimized L2 nucleotide sequence encoding residues 1-473 is posted at GenBank Accession No. KC330735. PCR end-tailoring was used to insert Xbal and SpeI sites flanking the L2 aa 14-122 using primers L2-14-Xba-F (SEQ ID NO. 1: CGTCTAGAGTCCGCAACCCAACTTTACAAG) and L2-122-Spe-R (SEQ ID NO. 2: G GGACTAGTTGGGGCACCAGCATC). The SpeI site was fused to a sequence encoding a 6His tag, and the resulting fusion was cloned into a geminiviral replicon vector (Diamos, 2016) to produce pBYe3R2K2Mc-L2(14-122)6H.

The HBche heterodimer VLP system was adapted from Peyret et al (2015). Using the plant optimized HBc gene (Huang et al., 2009), inventors constructed a DNA sequence encoding a dimer comprising HBc aa 1-149, a linker (G2S)5G (SEQ ID NO. 39), HBc aa 1-77, a linker GT(G4S)2 (SEQ ID NO. 40), HPV-16 L2 aa 14-122, a linker (GGS)2GSSGGSGG (SEQ ID NO. 41), and HBc aa 78-176. The dimer sequence was generated using multiple PCR steps including overlap extensions and insertion of BamHI and SpeI restriction sites flanking the L2 aa 14-122, using primers L2-14-Bam-F (SEQ ID NO. 3: CAGGATCCGCAACC CAACTTTACAAGAC) and L2-122-Spe-R (SEQ ID NO. 2). The HBche-L2 coding sequence was inserted into a geminiviral replicon binary vector pBYR2eK2M (FIG. 3), which includes the following elements: CaMV 35S promoter with duplicated enhancer (Huang et al., 2009), 5′ UTR of N. benthamiana psaK2 gene (Diamos et al., 2016), intron-containing 3′ UTR and terminator of tobacco extensin (Rosenthal et al, 2018), CaMV 35S 3′ terminator (Rosenthal et al, 2018), and Rb7 matrix attachment region (Diamos et al., 2016).

2. Recombinant Immune Complex

The recombinant immune complex (RIC) vector was adapted from Kim et al., (2015). The HPV-16 L2 (aa 14-122) segment was inserted into the BamHI and SpeI sites of the gene encoding humanized mAb 6D8 heavy chain, resulting in 6D8 epitope-tagged L2. The heavy chain fusion was inserted into an expression cassette linked to a 6D8 kappa chain expression cassette, all inserted into a geminiviral replicon binary vector (FIG. 3, RIC vector). Both cassettes contain CaMV 35S promoter with duplicated enhancer (Huang et al., 2009), 5′ UTR of N. benthamiana psaK2 gene (Diamos et al., 2016), intron-containing 3′ UTR and terminator of tobacco extensin (Rosenthal et al, 2018), and Rb7 matrix attachment region (Diamos et al., 2016).

ii. Agroinfiltration of Nicotiana benthamiana Leaves

Binary vectors were separately introduced into Agrobacterium tumefaciens EHA105 by electroporation. The resulting strains were verified by restriction digestion or PCR, grown overnight at 30° C., and used to infiltrate leaves of 5- to 6-week-old N. benthamiana maintained at 23-25° C. Briefly, the bacteria were pelleted by centrifugation for 5 minutes at 5,000 g and then resuspended in infiltration buffer (10 mM 2-(N-morpholino)ethanesulfonic acid (MES), pH 5.5 and 10 mM MgSO4) to OD600=0.2, unless otherwise described. The resulting bacterial suspensions were injected by using a syringe without needle into leaves through a small puncture (Huang et al. 2004). Plant tissue was harvested after 5 DPI, or as stated for each experiment. Leaves producing GFP were photographed under UV illumination generated by a B-100AP lamp (UVP, Upland, CA).

iii. Protein Extraction

Total protein extract was obtained by homogenizing agroinfiltrated leaf samples with 1:5 (w:v) ice cold extraction buffer (25 mM sodium phosphate, pH 7.4, 100 mM NaCl, 1 mM EDTA, 0.1% Triton X-100, 10 mg/mL sodium ascorbate, 0.3 mg/mL PMSF) using a Bullet Blender machine (Next Advance, Averill Park, NY) following the manufacturer's instruction. To enhance solubility, homogenized tissue was rotated at room temperature or 4° C. for 30 minutes. The crude plant extract was clarified by centrifugation at 13,000 g for 10 minutes at 4° C. Necrotic leaf tissue has reduced water weight, which can lead to inaccurate measurements based on leaf mass. Therefore, extracts were normalized based on total protein content by Bradford protein assay kit (Bio-Rad) with bovine serum albumin as standard.

iv. SDS-PAGE and Western Blot

Clarified plant protein extract was mixed with sample buffer (50 mM Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, 0.02% bromophenol blue) and separated on 4-15% polyacrylamide gels (Bio-Rad). For reducing conditions, 0.5M DTT was added, and the samples were boiled for 10 minutes prior to loading. Polyacrylamide gels were either transferred to a PVDF membrane or stained with Coomassie stain (Bio-Rad) following the manufacturer's instructions. For L2 detection, the protein transferred membranes were blocked with 5% dry milk in PBST (PBS with 0.05% tween-20) overnight at 4° C. and probed with polyclonal rabbit anti-L2 diluted 1:5000 in 1% PBSTM, followed by goat anti-rabbit horseradish peroxidase conjugate (Sigma). Bound antibody was detected with ECL reagent (Amersham).

v. Immunization of Mice and Sample Collection

All animals were handled in accordance to the Animal Welfare Act and Arizona State University IACUC. Female BALB/C mice, 6-8 weeks old, were immunized subcutaneously with purified plant-expressed L2 (14-122), HBche-L2 VLP, L2 RIC, or PBS mixed 1:1 with Imject® Alum (Thermo Scientific, Rockford, IL). In all treatment groups, the total weight of antigen was set to deliver an equivalent 5 μg of L2. Doses were given on days 0, 21, and 42. Serum collection was done as described (Santi et al. 2008) by submandibular bleed on days 0, 21, 42, and 63.

vi. Antibody Measurements

Mouse antibody titers were measured by ELISA. Bacterially-expressed L2 (amino acids 11-128) was bound to 96-well high-binding polystyrene plates (Corning), and the plates were blocked with 5% nonfat dry milk in PBST. After washing the wells with PBST (PBS with 0.05% Tween 20), the diluted mouse sera were added and incubated. Mouse antibodies were detected by incubation with polyclonal goat anti-mouse IgG-horseradish peroxidase conjugate (Sigma). The plate was developed with TMB substrate (Pierce) and the absorbance was read at 450 nm. Endpoint titers were taken as the reciprocal of the lowest dilution which produced an OD450 reading twice the background. IgG1 and IgG2a antibodies were measured with goat-anti mouse IgG1 or IgG2a horseradish peroxidase conjugate.

vii. Electron Microscopy

Purified samples of HBche or HBche-L2 were initially incubated on 75/300 mesh grids coated with formvar. Following incubation, samples were briefly washed twice with deionized water then negatively stained with 2% aqueous uranyl acetate. Transmission electron microscopy was performed with a Phillips CM-12 microscope, and images were acquired with a Gatan model 791 CCD camera.

viii. Statistical Analysis

The significance of vaccine treatments and virus neutralization was measured by non-parametric Mann-Whitney test using GraphPad prism software. Two stars (**) indicates p values <0.05. Three stars (***) indicates p values <0.001.

b. Design and Expression of HBc VLPs and RIC Displaying HPV16 L2

BeYDV plant expression vectors (FIG. 3) expressing either the target VLP HBche-L2, or L2 and HBche alone as controls, were agroinfiltrated into the leaves of N. benthamiana and analyzed for VLP production. After 4-5 days post infiltration (DPI), leaves displayed only minor signs of tissue necrosis, indicating that the VLP was well-tolerated by the plants (FIG. 4A). Leaf extracts analyzed by reducing SDS-PAGE showed an abundant band near the predicted size of 51 kDa for HBche-L2, just above the large subunit of rubisco (RbcL). HBche was detected around the predicted size of 38 kDa (FIG. 4B). Western blot probed with anti-L2 polyclonal serum detected a band for HBche-L2 at ˜51 kDa (FIG. 4B). These results indicate that this plant system is capable of producing high levels of L2-containing HBc VLP.

To express L2-containing MC, amino acids 14-122 of HPV16 L2 were fused with linker to the C-terminus of the 6D8 antibody heavy chain and tagged with the 6D8 epitope (Kim et al. 2015). A BeYDV vector (FIG. 3) expressing both the L2-fused 6D8 heavy chain and the light chain was agroinfiltrated into leaves of N. benthamiana and analyzed for RIC production. To create more homogenous human-type glycosylation, which has been shown to improve antibody Fc receptor binding in vivo, transgenic plants silenced for xylosyltransferase and fucosyltransferase were employed (Castilho and Steinkellner 2012). By western blot, high molecular weight bands >150 kDa suggestive of RIC formation were observed (FIG. 4C). Expression of soluble L2 RIC was lower than HBche-L2 due to relatively poor solubility of the RIC (FIG. 4C).

After rigorous genetic optimization, the N. benthamiana system is capable of producing very high levels of recombinant protein, up to 30-50% of the total soluble plant protein, in 4-5 days (Diamos et al. 2016). Using this system, we produced and purified milligram quantities of fully assembled and potently immunogenic HBc VLPs displaying HPV L2 through a simple one-step purification process (FIGS. 4A-4C and 6).

c. Purification and Characterization of HBche-L2 and L2 RIC

To assess the assembly of HBc-L2 VLP, clarified plant extracts containing either HBche-L2 or HBche were analyzed by sucrose gradient sedimentation. HBche-L2 sedimented largely with HBche, which is known to form VLP, though a small increase in density was observed with HBche-L2, perhaps due to the incorporation of L2 into the virus particle (FIG. 5A). To demonstrate particle formation, sucrose fractions were examined by electron microscopy. Both HBche and HBche-L2 formed ˜30 nm particles, although the appearance of HBche-L2 VLP suggested slightly larger, fuller particles (FIGS. 5C and 5D). As most plant proteins do not sediment with VLP, pooling peak sucrose fractions resulted in >95% pure HBche-L2 (FIG. 5B), yielding sufficient antigen (>3 mg) for vaccination from a single plant leaf.

L2 RIC was purified from plant tissue by protein G affinity chromatography. By SDS-PAGE, an appropriately sized band was visible >150 kDa that was highly pure (FIG. 5B). Western blot confirmed the presence of L2 in this band, indicating proper RIC formation (FIG. 5B). L2 RIC bound to human complement C1q receptor with substantially higher affinity compared to free human IgG standard, suggesting proper immune complex formation (FIG. 5E).

d. Mouse Immunization with HBche-L2 and L2 RIC

Groups of Balb/c mice (n=8) were immunized, using alum as adjuvant, with three doses each of 5 μg L2 delivered as either L2 alone, HBche-L2 VLP, L2 RIC, or a combination of half VLP and half RIC. VLP and RIC, alone or combined, greatly enhanced antibody titers compared to L2 alone by more than an order of magnitude at all time points tested (FIG. 6). After one or two doses, the combined VLP/RIC treatment group outperformed both the VLP or RIC groups, reaching mean endpoint titers of >200,000, which represent a 700-fold increase over immunization with L2 alone (FIG. 6). After the third dose, both the VLP and combined VLP/RIC groups reached endpoint titers >1,300,000, a 2-fold increase over the RIC alone group. To determine the antibody subtypes produced by each treatment group, sera were assayed for L2-binding IgG1 and IgG2a. All four groups produced predominately IgG1 (FIG. 7, note dilutions). However, RIC and especially VLP-containing groups had an elevated ratio of IgG2a:IgG1 (>3-fold) compared to L2 alone (FIG. 7).

In vitro neutralization of HPV16 pseudovirions showed that the VLP and RIC groups greatly enhanced neutralization compared to L2 alone (FIG. 5, p<0.001). Additionally, VLP and RIC combined further enhanced neutralization activity ($5-fold, p<0.05) compared to either antigen alone, supporting the strong synergistic effect of delivering L2 by both platforms simultaneously.

In this study, by displaying amino acids 11-128 on the surface of plant-produced HBc VLPs, L2 antibody titers as high as those seen with L1 vaccines were generated (FIG. 6). Mice immunized with L2 alone had highly variable antibody titers, with titers spanning two orders of magnitude. By contrast, the other groups had much more homogenous antibody responses, especially the VLP-containing groups, which had no animals below an endpoint titer of 1:1,000,000 (FIG. 6). These results underscore the potential of HBc VLP and RIC to provide consistently potent immune responses against L2. Moreover, significant synergy of VLP and RIC systems was observed when the systems were delivered together, after one or two doses (FIG. 6). Since equivalent amounts of L2 were delivered with each dose, the enhanced antibody titer did not result from higher L2 doses. Rather, these data suggest that higher L2-specific antibody production may be due to augmented stimulation of L2-specific B cells by T-helper cells that were primed by RIC-induced antigen presenting cells. Although treatment with VLP and RIC alone reached similar endpoint titers as the combined VLP/RIC group after 3 doses, virus neutralization was substantially higher (>5-fold) in the combined group (FIG. 8). Together, these data indicate unique synergy exists when VLP and RIC are delivered together. Inventors have observed similarly significant synergistic enhancement of immunogenicity for a variety of other antigens.

Mice immunized with L2 alone had highly variable antibody titers, with titers spanning two orders of magnitude. By contrast, the VLP and VLP/RIC groups had much more homogenous antibody responses, with no animals below an endpoint titer of 1:1,000,000 (FIG. 6). These results underscore the potential of HBc VLP and RIC to provide consistently potent immune responses against L2.

Fc gamma receptors are present on immune cells and strongly impact antibody effector functions such as antibody-dependent cell-mediated cytotoxicity and complement-dependent cytotoxicity (Jefferis 2009). In mice, these interactions are controlled in part by IgG subtypes. IgG1 is associated with a Th2 response and has limited effector functions. By contrast, IgG2a is associated with a Th1 response and more strongly binds complement components (Neuberger and Raj ewsky 1981) and Fc receptors (Radaev 2002), enhancing effector functions and opsonophagocytosis by macrophages (Takai et al. 1994). Immunization with L2 alone was found to produce low levels of IgG2a, however immunization with RIC and VLP produced significant increases in IgG2a titers. VLP-containing groups in particular showed a 3-fold increase in the ratio of IgG2a to IgG1 antibodies (FIG. 7). Importantly, production of IgG2a is associated with successful clearance of a plethora of viral pathogens (Coutelier et al. 1988; Gerhard et al. 1997; Wilson et al. 2000; Markine-Goriaynoff and Coutelier 2002).

The glycosylation state of the Fc receptor also plays an important role in antibody function. Advances in glycoengineering have led to the development of transgenic plants with silenced fucosyl- and xylosyl-transferase genes capable of producing recombinant proteins with authentic human N-glycosylation (Strasser et al. 2008). Antibodies produced in this manner have more homogenous glycoforms, resulting in improved interaction with Fc gamma and complement receptors compared to the otherwise identical antibodies produced in mammalian cell culture systems (Zeitlin et al. 2011; Hiatt et al. 2014; Strasser et al. 2014; Marusic et al. 2017). As the known mechanisms by which RIC vaccines increase immunogenicity of an antigen depend in part on Fc and complement receptor binding, HPV L2 RIC were produced in transgenic plants with silenced fucosyl- and xylosyl-transferase. Consistent with these data, we found that L2 RIC strongly enhanced the immunogenicity of L2 (FIG. 6). However, yield suffered from insolubility of the RIC (FIG. 4C). We found that the 11-128 segment of L2 expresses very poorly on its own in plants and may be a contributing factor to poor L2 RIC yield. Importantly, we have produced very high yields of RIC with different antigen fusions. Thus, in some aspects, antibody fusion with a shorter segment of L2 could substantially improve the yield of L2 RIC.

e. Neutralization of HPV Pseudovirions

Neutralization of papilloma pseudoviruses (HPV 16, 18, and 58) with sera from mice immunized IP with HBc-L2 VLP and L2(11-128) showed neutralization of HPV 16 at titers of 400-1600 and 200-800, respectively (Table 1). More mice IP-immunized with HBc-L2 VLP had antisera that cross-neutralized HPV 18 and HPV 58 pseudoviruses, compared with mice immunized with L2(11-128). Anti-HBc-L2 VLP sera neutralized HPV 18 at titers of 400 and HPV 58 at titers ranging from 400-800 (Table 1), while anti-L2(11-128) sera neutralized HPV 18 at a titer of 200 and HPV 58 at a titer of 400 (Table 1). None of the sera from intranasal-immunized mice demonstrated neutralizing activity, consistent with lower anti-L2 titers for intranasal than for intraperitoneal immunized mice.

TABLE 1
L2-specific serum IgG and pseudovirus neutralization
titers from IP immunized mice
Neutralization of Pseudoviruses
ImmunogenSerum IgGHPV 16HPV 18HPV 58
HBc-L2>50,000 400
~70,0001600400400
>80,0001600400800
L2 (11-128)~8000 200
~12,000 400
~50,000 800200400

Full text: Click here
Patent 2024
3' Untranslated Regions 5' Untranslated Regions AA 149 Agrobacterium tumefaciens aluminum potassium sulfate aluminum sulfate Amino Acids Animals Animals, Transgenic Antibodies Antibody Formation Antigen-Presenting Cells Antigens B-Lymphocytes Bacteria Bromphenol Blue Buffers Cell Culture Techniques Cells Centrifugation Chromatography, Affinity Cloning Vectors Cold Temperature Combined Modality Therapy complement 1q receptor Complement Receptor Complex, Immune Complex Extracts Cytotoxicities, Antibody-Dependent Cell Cytotoxin Digestion DNA, A-Form DNA Sequence Edetic Acid Electron Microscopy Electroporation Enzyme-Linked Immunosorbent Assay Epitopes ethane sulfonate Fc Receptor Females Formvar Fucosyltransferase G-substrate Gamma Rays Genes Genes, vif Glycerin Goat Helix (Snails) Helper-Inducer T-Lymphocyte Homo sapiens Homozygote Horseradish Peroxidase Human papillomavirus 16 Human papillomavirus 18 Human Papilloma Virus Vaccine IGG-horseradish peroxidase IgG1 IgG2A Immune Sera Immunoglobulin Heavy Chains Immunoglobulins Immunologic Factors Institutional Animal Care and Use Committees Introns Inventors L2 protein, Human papillomavirus type 16 Light Macrophage Mammals Matrix Attachment Regions Mice, Inbred BALB C Microscopy Milk, Cow's Morpholinos Mus Necrosis Needles Nicotiana Oligonucleotide Primers Oligonucleotides Open Reading Frames Opsonophagocytosis Papilloma Pathogenicity Plant Development Plant Extracts Plant Leaves Plant Proteins Plants Plants, Transgenic polyacrylamide gels Polystyrenes polyvinylidene fluoride prisma Protein Glycosylation Proteins Punctures Rabbits Receptors, IgG Recombinant Proteins Replicon Reproduction Response, Immune Ribulose-Bisphosphate Carboxylase Large Subunit Satellite Viruses SDS-PAGE Serum Serum Albumin, Bovine Sodium Ascorbate Sodium Chloride sodium phosphate Specimen Collection Stars, Celestial Strains Sucrose Sulfate, Magnesium Syringes System, Immune Technique, Dilution Tissue, Membrane Tissues Transferase Transmission Electron Microscopy Triton X-100 Tromethamine Tween 20 Ultraviolet Rays uranyl acetate Vaccination Vaccines Vaccines, Recombinant Virion Viroids Virus Vision Western Blotting xylosyltransferase
Not available on PMC !

Example 4

To obtain recombinant chimeric anti-FOLR1 mAbs, the expression vectors containing the mouse variable regions (VH and VL) fused to the constant regions of human IgG1 heavy chain and kappa light chain, respectively, were transiently transfected into 293E cells. The recombinant antibodies produced in the suspension of the transfected cells were purified using Protein A affinity chromatography.

Full text: Click here
Patent 2024
Antibodies Cell Culture Techniques Cells Chimera Chromatography, Affinity Cloning Vectors Culture Media FOLR1 protein, human Homo sapiens IgG1 Immunoglobulin kappa-Chains Monoclonal Antibodies Mus Staphylococcal Protein A

Example 3

The potency of 88D2C6 and 137D1H10, along with 370D2C10 (all fused to human IgG1 constant regions, with ADCC-activating mutations in Fc), in mediating ADCC was measured with CCR8-overexpressing CHO K1 and U2OS cells. All three antibodies exhibited high ADCC activities (FIG. 2).

All three antibodies exhibited potent ADCC activities. Among them, however, 88D2C6 had considerably higher potency (EC50: 0.01743 nM with CHO cells and 0.1108 for U2OS cells).

Full text: Click here
Patent 2024
Antibodies CCR8 protein, human Cells CHO Cells Cytotoxicities, Antibody-Dependent Cell Gain of Function Mutation Homo sapiens IgG1
Not available on PMC !

EXAMPLE 8

In order to determine whether Nanobodies could inhibit the interaction of native CD80 and CD86 with CD28-Ig or CTLA4-Ig, Raji cells were incubated with serial dilutions of purified protein from confirmed clones or an irrelevant Nanobody. Next, either HuCD28-HuIgG1 or HuCTLA4-HuIgG1 was added to the cells/Nanobody suspension without washing the cells in between. After a wash step, cell-bound CD28- or CTLA4-HuIg was revealed using a phycoerythrin-conjugated F(ab′)2 derived from affinity purified goat-anti-human IgG1 antiserum (bovine serum protein crossabsorbed). Percentage inhibition was determined based on MFI values of controls having received an irrelevant specificity Nanobody (high control) or no CD28- or CTLA4-Ig fusion protein at all (low control).

Example FACS profiles of representative inhibitory and non-inhibitory Nanobodies are shown in FIG. 7.

Results from both ELISA and FACS based assays are summarized in Table C-6.

Full text: Click here
Patent 2024
Biological Assay Bos taurus Cardiac Arrest Cells Clone Cells CTLA-4-Ig CTLA4 protein, human Enzyme-Linked Immunosorbent Assay Goat Homo sapiens IgG1 Immune Sera Phycoerythrin Proteins Psychological Inhibition Serum Proteins Technique, Dilution VHH Immunoglobulin Fragments

Example 3

Serum was obtained from mice immunized with the composite influenza peptides Pep 63 and Pep 64 both in conjugated and unconjugated forms. These serum sample were tested for IgG1, IgG2a and IgG2b activity against Pep 3, Pep 6, Pep 10, and Pep 11 (Pep 11—the composite 3, 6 and 10 peptides).

With regard to Pep 3, Pep 6, Pep 10, and Pep 64, both conjugated and unconjugated, as compared to Pep 63 showed an overall greater IgG1 response (FIGS. 2, 3 and 4). With regard to Pep 11, Pep 64, both conjugated and unconjugated, as compared to Pep 63 also showed a greater IgG1 response (FIG. 5).

With regard to Pep 3, Pep 6, and Pep 10, there was a minimal IgG2a response to either Pep 63 or Pep 64, whether in conjugated or unconjugated form (FIGS. 6-8). With regard to Pep 11, Pep 64, conjugated and unconjugated showed only a weak IgG2a response; conjugated greater than unconjugated (FIG. 9).

With regard to Pep 3, Pep 6, Pep 10 there was a greater IgG2b response to Pep 64, conjugated, as compared to Pep 63 which mostly appeared after booster was administered (FIGS. 10-12). With regard to Pep 11, Pep 64, conjugated, showed a very large IgG2b response that was enhanced after the booster was administered (FIG. 13).

Pep 64 (both conjugated and unconjugated) with the T-cell epitope at the N-terminal end induced increased serum antibody responses to the individual peptides across IgG1 and IgG2b isotypes, but not IgG2a. What this data clearly shows is that the location of the T cell epitope on an antigen can have a significant effect of how the antigen is seen and responded to by the host immune system. These data also indicate that T cell epitope placement can have a profound effect on both the Th-1 and Th-2 responses.

Full text: Click here
Patent 2024
Antibody Formation Antigens cyclo-acetyl-(cysteinyl-histidyl-phenylalanyl-glutaminyl-phenylalanyl-cysteinyl)amide Debility Epitopes, T-Lymphocyte IgG1 IgG2A IgG2B Immunoglobulin Isotypes Mus Peptides Secondary Immunization Serum System, Immune Virus Vaccine, Influenza Vision

Top products related to «IgG1»

Sourced in United States, Germany, United Kingdom, China, Canada, Japan, Italy, France, Belgium, Switzerland, Singapore, Uruguay, Australia, Spain, Poland, India, Austria, Denmark, Netherlands, Jersey, Finland, Sweden
The FACSCalibur is a flow cytometry system designed for multi-parameter analysis of cells and other particles. It features a blue (488 nm) and a red (635 nm) laser for excitation of fluorescent dyes. The instrument is capable of detecting forward scatter, side scatter, and up to four fluorescent parameters simultaneously.
Sourced in United States, Germany, United Kingdom, Belgium, China, Australia, France, Japan, Italy, Spain, Switzerland, Canada, Uruguay, Netherlands, Czechia, Jersey, Brazil, Denmark, Singapore, Austria, India, Panama
The FACSCanto II is a flow cytometer instrument designed for multi-parameter analysis of single cells. It features a solid-state diode laser and up to four fluorescence detectors for simultaneous measurement of multiple cellular parameters.
Sourced in United States, Germany, United Kingdom, China, Italy, Japan, France, Sao Tome and Principe, Canada, Macao, Spain, Switzerland, Australia, India, Israel, Belgium, Poland, Sweden, Denmark, Ireland, Hungary, Netherlands, Czechia, Brazil, Austria, Singapore, Portugal, Panama, Chile, Senegal, Morocco, Slovenia, New Zealand, Finland, Thailand, Uruguay, Argentina, Saudi Arabia, Romania, Greece, Mexico
Bovine serum albumin (BSA) is a common laboratory reagent derived from bovine blood plasma. It is a protein that serves as a stabilizer and blocking agent in various biochemical and immunological applications. BSA is widely used to maintain the activity and solubility of enzymes, proteins, and other biomolecules in experimental settings.
Sourced in United States, Germany, United Kingdom, China, Canada, Japan, Belgium, France, Spain, Italy, Australia, Finland, Poland, Switzerland, Cameroon, Uruguay, Denmark, Jersey, Moldova, Republic of, Singapore, India, Brazil
The FACSCalibur flow cytometer is a compact and versatile instrument designed for multiparameter analysis of cells and particles. It employs laser-based technology to rapidly measure and analyze the physical and fluorescent characteristics of cells or other particles as they flow in a fluid stream. The FACSCalibur can detect and quantify a wide range of cellular properties, making it a valuable tool for various applications in biology, immunology, and clinical research.
Sourced in United States, Germany, United Kingdom, Italy, Canada, China, Japan, Belgium, France, Spain, Switzerland, Poland, Uruguay, Denmark, Singapore
CellQuest software is a data acquisition and analysis software designed for flow cytometry applications. It provides tools for acquiring, processing, and analyzing flow cytometry data.
Sourced in United States, Germany, United Kingdom, France, Canada, Belgium, Australia, Italy, Spain, Switzerland, China, Netherlands, Finland, Japan, Jersey, Lao People's Democratic Republic
FACSDiva software is a user-friendly flow cytometry analysis and data management platform. It provides intuitive tools for data acquisition, analysis, and reporting. The software enables researchers to efficiently process and interpret flow cytometry data.
Sourced in United States, United Kingdom, Germany, France, Canada, Australia, Belgium, China, Uruguay, Japan, Sweden, Switzerland, Cameroon
The LSRFortessa is a flow cytometer designed for multiparameter analysis of cells and other particles. It features a compact design and offers a range of configurations to meet various research needs. The LSRFortessa provides high-resolution data acquisition and analysis capabilities.
Sourced in United States, Germany, United Kingdom, Belgium, Japan, France, China, Australia, Italy, Spain, Canada, Switzerland, Sweden, Brazil, India, Mexico, Austria
The FACSCanto II is a flow cytometer manufactured by BD. It is a versatile instrument designed for multicolor flow cytometric analysis. The FACSCanto II can detect and analyze various properties of cells or particles suspended in a fluid as they flow through the system.
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
Sourced in United States, Germany, United Kingdom, Japan, China, Canada, Italy, Australia, France, Switzerland, Spain, Belgium, Denmark, Panama, Poland, Singapore, Austria, Morocco, Netherlands, Sweden, Argentina, India, Finland, Pakistan, Cameroon, New Zealand
DAPI is a fluorescent dye used in microscopy and flow cytometry to stain cell nuclei. It binds strongly to the minor groove of double-stranded DNA, emitting blue fluorescence when excited by ultraviolet light.

More about "IgG1"

Immunoglobulin G1 (IgG1) is a crucial subclass of the IgG antibody, which is one of the five major classes of antibodies found in humans.
IgG1 plays a pivotal role in the humoral immune response, with the ability to neutralize toxins, activate the complement system, and facilitate the clearance of pathogens.
Researchers can leverage the power of IgG1 research using cutting-edge tools like PubCompare.ai, an AI-driven platform that helps optimize protocols for unparalleled reproducibility and accuracy.
PubCompare.ai enables users to quickly locate the best IgG1 protocols from literature, pre-prints, and patents, while utilizing AI-driven comparisons to identify the most effective products and procedures.
This technology streamlines IgG1 research, empowering scientists to make breakthroughs in this critical area of immunology.
In addition to PubCompare.ai, researchers can also utilize other powerful tools and techniques to study IgG1, such as flow cytometry instruments like the FACSCalibur, FACSCanto II, and LSRFortessa, as well as software like CellQuest and FACSDiva.
These tools can be used to analyze and quantify IgG1 expression and function, providing valuable insights into the immune system.
Furthermore, techniques like Bovine serum albumin (BSA) blocking and DAPI staining can be employed to enhance the specificity and accuracy of IgG1 research.
By incorporating these advanced methodologies and technologies, scientists can unlock the full potential of IgG1 research and drive progress in the field of immunology.