Lactalbumin

High titer virus stocks of paramyxoviruses used for validation of broad reactivity of the assay are listed in table 1. Clinical specimens from humans to test for sensitivity of fragment analysis were obtained from the clinical diagnostic unit of the virology department, and were anonymized. Wild birds were trapped by expert ornithologists. Cloacal and/or oropharyngeal swab specimens were collected with sterile cotton swabs. All samples were stored in transport medium consisting of Hanks balanced salt solution containing 0.5% lactalbumin, 10% glycerol, 200 U/mL penicillin, 200 µg/mL streptomycin, 100 U/mL polymyxin B sulfate, 250 µg/mL gentamicin, and 50 U/mL nystatin (ICN, Zoetermeer, The Netherlands). All bird samples were stored at −80°C or at −20°C if rapid transport or storage at −80°C was not possible. Frozen samples were stored at −80°C in the laboratory upon arrival and were thawed no more than two times prior to analysis.

We placed each captured duck in a box with a clean (unused) paper bottom. Using sterile cotton swabs, we then sampled each bird either by swirling the swab in its cloaca (20% of individual birds) or by swabbing its fresh droppings on the paper bottom. Cotton swabs were immediately put in vials containing virus transport media (Hanks balanced salt solution containing 0.5% lactalbumin, 10% glycerol, 200 U/mL penicillin, 200 μg/mL streptomycin, 100 U/mL polymyxin B sulfate, 250 μg/mL gentamicin, and 50 U/mL nystatin (ICN, Zoetermeer, the Netherlands)) and frozen to –70°C within 30 min.

Real-time reverse transcription-polymerase chain reaction (rRT-PCR) was used to quantify mammary gene expression as described by Theil et al. [21 (link)]. Briefly, total RNA was extracted from the frozen mammary biopsy after the tissue was homogenized with 350 μL RNeasy lysis buffer. The homogenate was diluted with 70% ethanol (1:1) before RNA was purified using a RNeasy mini kit (Qiagen, Albertslund, Denmark), and m-RNA was reverse-transcribed according to the manufacturer’s guide (Invitrogen, Taastrup, Denmark) using oligo-dT to synthesize cDNA. One microliter cDNA was amplified using gene-specific probes and primers with the TaqMan Universal PCR Master Mix (Applied Biosystems, Stockholm, Sweden) instrument. The signal was quantitatively detected using an ABI PRISM 7900 detection system (Applied Biosystems) to measure the labeled FAM (carboxyfluorescein) fluorophore on the 5′ end. Primer Express Version 2.0 software (Applied Biosystems) was used for primers and probe designs for all genes. Primer and probe sequences are shown in Table 2. Gene expression of β-actin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), fatty acid synthase (FAS), delta-6 desaturase (D6D), and α-lactalbumin (α-LA) were quantified, and both β-actin and GAPDH were found to be stable housekeeping genes. The difference in cycle threshold (Ct) value between the target gene and reference genes (i.e., ΔCt-values) was used for the statistical analysis, and the relative mRNA quantity was calculated by using the formula: Relative quantity = 2^−ΔΔCt.Table 2

Primer and probe sequences of target and housekeeping genes

Genes	Accession numbers	Primer/probe	Sequence (5′ to 3′)
β-actin	AY550069	Forward	ACCCAGATCATGTTCGAGACC
		Reverse	TCACCGGAGTCCATCACGAT
		Probe	CTGTATGCCTCTGGCCGCACCA
GAPDH	AF017079	Forward	GTCGGAGTGAACGGATTTGG
		Reverse	CAATGTCCACTTTGCCAGAGTTAA
		Probe	CGCCTGGTCACCAGGGCTGCT
FAS	AY954688	Forward	CGTGGGCTACAGCATGATAGG
		Reverse	GAGGAGCAGGCCGTGTCTAT
		Probe	CATCACCA
D6D	AY512561	Forward	GACGGCCTTCATCCTTGCT
		Reverse	ACAGAGAGATGGCCGTAATCGT
		Probe	CCTCTCAGGCCCAGGCTGGGTG
α-LA	M80520	Forward	ACAATGGCAGCACAGAATATGG
		Reverse	TCAGTAAGGTCATCATCCAGGAATT
		Probe	CTCTTCCAGATCAATAAT

GAPDH Glyceraldehyde-3-phosphate dehydrogenase, FAS Fatty acid synthase, D6D Delta-6 desaturase, α-LA α-lactalbumin

Fresh mutton hindleg meat and tail fat were obtained from a local commercial processor (Hohhot, China), and sausages were made with modifications to the method previously described^{47 (link)}. The sausage's ingredients were as follows: mutton hindleg meat (70%), mutton tail fat (30%), salt (2.5%), glucose (0.5%), sugar (1%), NaNO₂ (0.01%), ascorbic acid (0.05%), pepper powder (0.2%), ginger powder (0.2%), spice powder (0.1%), corn starch (1%), and lactalbumin powder (0.5%). The ingredients were thoroughly mixed and filled into pig casings. The sausage diameter was approximately 3 cm, and length was approximately 20 cm. Control was fermented sausage without starter culture and the treatment was fermented sausage inoculated with L.fermentum 332 (the concentration of the starter culture was 4%, 10⁶ CFU/g). For 24 h, fermentation was carried out at 30 °C and 95% relative humidity (day 1). This was known as the fermentation period. For four days, the sausages were placed in a 15 °C and 75–85% relative humidity environment (day 5). This stage was regarded as the drying period. Then, the sausages were transferred to an environment of 10 °C and 65% relative humidity for 6 days (day 11). This stage was regarded as the maturation period. After preparation, the samples were packed and stored at − 20 °C until further analyses. The sausages in both groups were sampled at various fermentation times (day 1, 5, and 11) to determine AI-2 activity, LAB viable count, physicochemical characteristics, and volatile flavor components.

The “Lobato Paraense” snail facility at the René Rachou Institute—FIOCRUZ provided cercariae of S. mansoni (LE strain). The parasite cycle is maintained throughout passages between hamsters (Mesocricetus auratus) and snails (Biomphalaria glabrata).
As previously described, cercariae were mechanically transformed into schistosomula (Milligan and Jolly, 2011 (link)). Schistosomula were cultured in GMEM supplemented with 0.2 μM triiodothyronine; 0.1% glucose; 0.1% lactalbumin; 20 mM HEPES; 0.5% MEM vitamin solution; 5% Schneider’s Insect Medium; and 0.5 μM hypoxanthine, 1 μM hydrocortisone, 1% penicillin/streptomycin, and 2% heat-inactivated FBS.
Hamsters (M. auratus) were infected with cercariae and subjected to perfusion (Pellegrino and Siqueira, 1956 (link)) after 45 days for obtaining adult worms. Males and females were washed, separated manually, and cultured in Roswell Park Memorial Institute 1640 (RPMI 1640) medium supplemented with 2% penicillin/streptomycin and 10% heat-inactivated FBS.