Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Amino Acid > Ligase

Ligase

Ligase is an enzyme that catalyzes the joining of two molecules by forming a new chemical bond.
This class of enzymes plays a crucial role in various biological processes, such as DNA repair, protein synthesis, and energy metabolism.
Ligase enzymes are essential for maintaining the integrity of genetic material and facilitating the assembly of complex biomolecular structures.
Researchers can utilize PubCompare.ai, an AI-driven platform, to enhance their Ligase research by locating the best protocols from literature, pre-prints, and patents using intelligent comparisons.
This tool can improve the reproducibility and accuracy of Ligase studies, allowing researchers to experiance the power of AI-driven research and optimize their experimental approaches.

Most cited protocols related to «Ligase»

1
Genotyping-by-Sequencing Protocol with Barcoded Adapters
Cited 164 times
A basic schematic of the protocol used for performing GBS is shown in Figure 2. Oligonucleotides comprising the top and bottom strands of each barcode adapter and a common adapter were diluted (separately) in TE (50 µM each) and annealed in a thermocycler (95°C, 2 min; ramp down to 25°C by 0.1°C/s; 25°C, 30 min; 4°C hold). Barcode and common adapters were then quantified using an intercalating dye (PicoGreen®; Invitrogen, Carlsbad, CA), diluted in water to 0.6 ng/µL (∼02 pmol/µL), mixed together in a 1∶1 ratio, and 6 µL (∼0.06 pmol each adapter) of the mix was aliquoted into a 96-well PCR plate and dried down. DNA samples (100 ng in a volume of 10 µL) were added to individual adapter-containing wells and plates were, again, dried.
Samples (DNA plus adapters) were digested for 2 h at 75°C with ApeKI (New England Biolabs, Ipswitch, MA) in 20 µL volumes containing 1× NEB Buffer 3 and 3.6 U ApeKI. Adapters were then ligated to sticky ends by adding 30 µL of a solution containing 1.66× ligase buffer with ATP and T4 ligase (640 cohesive end units) (New England Biolabs) to each well. Samples were incubated at 22°C for 1 h and heated to 65°C for 30 min to inactivate the T4 ligase. Sets of 48 or 96 digested DNA samples, each with a different barcode adapter, were combined (5 µL each) and purified using a commercial kit (QIAquick PCR Purification Kit; Qiagen, Valencia, CA) according to the manufacturer's instructions. DNA samples were eluted in a final volume of 50 µL. Restriction fragments from each library were then amplified in 50 µL volumes containing 2 µL pooled DNA fragments, 1× Taq Master Mix (New England Biolabs), and 25 pmol, each, of the following primers: (A) 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and (B) 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT. These primers contained complementary sequences for amplifying restriction fragments with ligated adapters, binding PCR products to oligonucleotides that coat the Illumina sequencing flow cell and priming subsequent DNA sequencing reactions [26] (link) (Figure 1).
Temperature cycling consisted of 72°C for 5 min, 98°C for 30 s followed by 18 cycles of 98°C for 30 s, 65°C for 30 s, 72°C for 30 s with a final Taq extension step at 72°C for 5 min. These amplified sample pools constitute a sequencing “library.” Libraries were purified as above (except that the final elution volume is 30 µL) and 1 µL was loaded onto an Experion® automated electrophoresis station (BioRad, Hercules, CA) for evaluation of fragment sizes. Libraries were considered suitable for sequencing if adapter dimers (∼128 bp in length) were minimal or absent and the majority of other DNA fragments were between 170–350 bp. If adapter dimers were present in excess of 0.5% (based on the Experion® output), libraries were constructed again using a few DNA samples and decreasing adapter amounts. Guidelines for adapting the protocol to different species including details for performing adapter titrations and are provided in Supporting Information (Text S1, Figure S1 and Figure S2).
Once the appropriate quantity of adapters was empirically determined for a particular enzyme/species combination, no further adapter titration was necessary. Single-end sequencing (86 bp reads) of one 48- or 96-plex library per flowcell channel, was performed on a Genome Analyzer II (Illumina, Inc., San Diego, CA). See Bentley et al. [26] (link) for details of the sequencing process and chemistry.
Elshire R.J., Glaubitz J.C., Sun Q., Poland J.A., Kawamoto K., Buckler E.S, & Mitchell S.E. (2011). A Robust, Simple Genotyping-by-Sequencing (GBS) Approach for High Diversity Species. PLoS ONE, 6(5), e19379.
Full text: Click here
Publication 2011
Buffers Cells DNA Library Electrophoresis Enzymes Genome Ligase Oligonucleotide Primers Oligonucleotides PicoGreen Titrimetry
2
Efficient Multi-part DNA Assembly using Type IIS Enzymes
Cited 146 times
Restriction-ligations were set up by pipetting in one tube approximately 40 fmol (∼100 ng of DNA for a 4 kb plasmid) of each DNA component (PCR product or plasmid), 10 U of the required restriction enzyme (BsaI or BpiI) and 10 U T4 DNA ligase (using high concentration ligase, 20 U/µl) in Promega ligation buffer in a final reaction volume of 20 µl. The reaction was incubated in a thermocycler for 5 hours at 37°C, 5 min at 50°C and 10 min at 80°C. The reaction mix was then added to 100 µl chemically competent DH10b cells, incubated for 15–30 min on ice and transformed by heat shock. 800 µl of liquid LB was then added to the transformation, and the cells were let to recover 45 min at 37°C. Different aliquots of the transformation were plated on LB plates containing the appropriate antibiotic. The number of colonies was counted for one or two selected plates (containing countable number of colonies), or from a section of the plates when very high number of colonies were obtained even for the lowest volume plated. The number of colonies was then extrapolated for the entire transformation.
For level 2-2 cloning, two type IIS enzymes were required, BpiI and BsaI. The same protocol was used as described above except that 10 U and 2.5 U were used for the enzymes BpiI and BsaI, respectively. To optimize efficiency of the restriction-ligation for the final construct containing 11 transcription units (cL2-13*), a variation of this protocol was used as follows. The reaction mix was set up containing 20 U ligase, 5 U BpiI and 5 U BsaI, in a total reaction volume of 20 µl. The mix was incubated in a thermocycler with the following parameters: incubation for 2 minutes at 37°C, 5 minutes at 16°C, both steps repeated 45 times, followed by incubation for 5 minutes at 50°C and 10 minutes at 80°C. The reaction mix was transformed in E. coli chemically competent cells as described above.
Weber E., Engler C., Gruetzner R., Werner S, & Marillonnet S. (2011). A Modular Cloning System for Standardized Assembly of Multigene Constructs. PLoS ONE, 6(2), e16765.
Full text: Click here
Publication 2011
Antibiotics Buffers Cells DNA Restriction Enzymes Enzymes Escherichia coli Heat-Shock Response Ligase Ligation Plasmids Promega T4 DNA Ligase Transcription, Genetic
3
AviTag Insertion via Inverse PCR Mutagenesis
Cited 58 times
A variety of standard molecular biology methods can be used to add the AviTag (seeNote 2) to an appropriate site in a target protein (seeNote 4). For certain experiments it may also be valuable to clone a negative control peptide that is not biotinylated by BirA (seeNote 5). We suggest using a modified inverse PCR mutagenesis (43 (link)) (seeFig. 4) or Site-directed Ligase-Independent Mutagenesis (SLIM) reaction (44 (link)), which enables the insertion of the substrate peptide without requiring any restriction sites nearby. Below is an example inverse PCR mutagenesis protocol.

Forward and reverse primers for peptide insertion should be designed to each have 18-25 bp matching the parental sequence and have a calculated annealing temperature (to the parent sequence) of at least 55 °C (seeFig. 4).

Assemble the following reaction mixture in a PCR tube: 29.5 μL MilliQ water, 1.5 μL DMSO, 5 μL KOD polymerase buffer, 5 μL 25 mM MgSO4, 1 μL 15 μM forward primer, 1 μL 15 μM reverse primer, 1 μL 100 ng/μL template plasmid DNA, 5 μL 2 mM dNTP mix and finally 1 μL KOD hot start polymerase.

After transferring the tube to a PCR machine, perform an initial denaturing step of 3 minutes at 95 °C, followed by 12 cycles of: 95 °C for 30 seconds, 55 °C for 30 seconds and 68 °C for 30 seconds/kb of target plasmid DNA.

Add 1 μL of 20 U/μL DpnI enzyme to the PCR mix and incubate at 37 °C for 1 hour.

Run an aliquot of the reaction on a 0.7% agarose gel to confirm the success and fidelity of the PCR (a clean band should be observed corresponding to the size of the linearized target plasmid DNA).

To 2 μL of the PCR product, add 14 μL MilliQ water, followed by 2 μL of 10× T4 DNA ligase buffer, 1 μL T4 polynucleotide kinase and 1 μL of T4 DNA ligase.

Incubate the sample for 1 hour at room temperature and transform an appropriate strain of competent E. coli (e.g. DH5α, XL1-Blue, JM109) with 5 μL of the ligation reaction. Cells with competency of at least 107 cfu/μg should be sufficient.

After validating the construct by sequencing, the AviTag-fused protein can be overexpressed in the appropriate cell system (commonly E. coli, baculovirus or HEK 293T cells).

Fairhead M, & Howarth M. (2015). Site-specific biotinylation of purified proteins using BirA. Methods in molecular biology (Clifton, N.J.), 1266, 171-184.
Publication 2015
Baculoviridae Buffers Cells Clone Cells Enzymes Escherichia coli HEK293 Cells Inverse PCR Ligase Ligation Mutagenesis Mutagenesis, Site-Directed Neoplasm Metastasis Oligonucleotide Primers Parent Peptides Plasmids Polynucleotide 5'-Hydroxyl-Kinase Proteins Protein Targeting, Cellular Sepharose Strains Sulfate, Magnesium Sulfoxide, Dimethyl T4 DNA Ligase
4
PfuX7: Engineered Thermostable Polymerase
Cited 57 times
Sso7d was fused to the C-terminus of PfuV93Q by amplifying part of the sequence upstream from the fusion site with the primers Pfu-upstream-F and Pfu-R, and part of the sequence downstream from the fusion site with the primers Pfu-F and Pfu-downstream-F (Table 1 and Figure 3A). Next, PCR products were mixed with varied concentrations of three pairs of complementary oligonucleotides (Sso7d-1F + Sso7d-1R, Sso7d-2F + Sso7d-2R and Sso7d-3F + Sso7d-3R, Table 1) and treated with the USER enzyme (New England Biolabs, NEB). Fragments were ligated using the Quick ligase kit (NEB), gel purified the product using the Qiagen gel purification kit and finally used as template in a standard Phusion PCR with the primers Pfu-upstream-F and Pfu-downstream-R. The resulting PCR products and the pET-Pfu vector was treated with the SacI- and BlpI-Fastdigest restriction enzymes (Fermentas) and subsequently fragments of the expected size were gel purified as described above. Finally, the Pfu-Sso7d fragment was ligated into the pET-Pfu-(V93Q) vector with the Quick ligase kit and transformed into a standard E. coli cloning strain. The sequence of the Pfu-Sso7d fusion (termed PfuX7) was confirmed by standard DNA sequencing.
, & Nørholm M.H. (2010). A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering. BMC Biotechnology, 10, 21.
Full text: Click here
Publication 2010
Cloning Vectors DNA Restriction Enzymes Enzymes Escherichia coli Ligase Oligonucleotide Primers Oligonucleotides Strains
5
Genome-wide CRISPR Deletion Screens for Cell Sensitivity
Cited 55 times
Pooled, genome-wide CRISPR deletion screens were performed in three cell lines: K562 stably expressing SFFV-Cas9-BFP, Ramos cells lentivirally infected with SFFV-Cas9-BFP, and U937 cells lentivirally infected with EF1a-Cas9-Blast34 (link). The library was synthesized, cloned and lentivirally infected into cells as previously described20 (link). Briefly, the parent vector for the libraries was derived from a pSico lentiviral vector which expresses GFP and a puromycin-resistance cassette separated by a T2A sequence45 (link)58 (link); we replaced GFP with mCherry to make the final parent vector, pMCB320. Sublibraries were PCR-amplified from pooled-oligo chips (CustomArray, Agilent), digested with BstXI and BlpI restriction enzymes, and ligated into BstXI/BlpI-cut pMCB320 using T4 ligase. Libraries and vectors will be made available via Addgene. Three days after infection, cells were placed under puromycin selection (0.7 μg ml−1, Sigma) for an additional 3 days after infection, then split at time 0. Throughout the screen, the pooled libraries were maintained at 1,000 cells per guide or a total of ∼250 million cells in large spinner flasks. K562 and U937 were grown for ∼2 weeks, and Ramos cells were growth for ∼3 weeks due to their slower division time. Genomic DNA was extracted following Qiagen's Blood Maxi Kit, and the guide composition was sequenced and compared to the plasmid library using casTLE20 (link) version 1.0 available at https://bitbucket.org/dmorgens/castle. Briefly, casTLE compares each set of gene-targeting guides to the negative controls, selecting the most likely maximum effect size which explains the distribution of targeting guides. It then determines the significance of this maximum effect by permuting the results20 (link). Both safe-targeting and non-targeting controls were used for this analysis. For the ricin sensitivity screen, cells were treated with ricin toxin (Vector Labs) at 0.25 ng ml−1 for 24 h, ricin was removed and then cells were allowed to recover to normal doubling rate. This treatment occurred four times over 2 weeks.
Morgens D.W., Wainberg M., Boyle E.A., Ursu O., Araya C.L., Tsui C.K., Haney M.S., Hess G.T., Han K., Jeng E.E., Li A., Snyder M.P., Greenleaf W.J., Kundaje A, & Bassik M.C. (2017). Genome-scale measurement of off-target activity using Cas9 toxicity in high-throughput screens. Nature Communications, 8, 15178.
Full text: Click here
Publication 2017
BLOOD Cell Lines Cells Cloning Vectors Clustered Regularly Interspaced Short Palindromic Repeats Deletion Mutation DNA Chips DNA Library DNA Restriction Enzymes Genome Hypersensitivity Infection Ligase Oligonucleotides Parent Plasmids Puromycin Ricin Spleen Focus-Forming Virus U937 Cells

Most recents protocols related to «Ligase»

1
Engineering Attenuated Pseudomonas Strain for Alginate
Not available on PMC !

Example 1

To generate an attenuated strain of P. aeruginosa for production of alginate, the following virulence factor genes were sequentially deleted from the chromosome of the wild-type strain PAO1: toxA, plcH, phzM, wapR, and aroA. toxA encodes the secreted toxin Exotoxin A, which inhibits protein synthesis in the host by deactivating elongation factor 2 (EF-2). plcH encodes the secreted toxin hemolytic phospholipase C, which acts as a surfactant and damages host cell membranes. phzM encodes phenazine-specific methyltransferase, an enzyme required for the production of the redox active, pro-inflammatory, blue-green secreted pigment, pyocyanin. wapR encodes a rhamnosyltransferase involved in synthesizing O-antigen, a component of lipopolysaccharide (LPS) of the outer membrane of the organism. aroA encodes 3-phosphoshikimate 1-carboxyvinyltransferase, which is required intracellularly for aromatic amino acid synthesis. Deletion of aroA from the P. aeruginosa genome has previously been shown to attenuate the pathogen. Each gene was successfully deleted using a homologous recombination strategy with the pEX100T-Not1 plasmid. The in-frame, marker-less deletion of these five gene sequences was verified by Sanger sequencing and by whole genome resequencing (FIG. 1 and FIG. 8). This engineered strain was designated as PGN5. The whole genome sequence of PGN5 has been deposited to NCBI Genbank with an accession number of CP032541. All five in-frame gene deletions were detected and validated to be the deletion as designed using PCR (FIG. 7).

To verify gene deletion and attenuation of the PGN5 strain, the presence of the products of the deleted genes was measured and was either undetectable, or significantly reduced in the PGN5 strain. To test for the toxA gene deletion in PGN5, a Western blot analysis was performed for the presence of Exotoxin A in the culture medium. Exotoxin A secretion was detected in wild-type PAO1 control, but not in the PGN5 strain (FIG. 2A). To confirm the loss of plcH, hemolysis was assessed on blood agar. The hemolytic assay was carried out by streaking PAO1, PGN5, P. aeruginosa mucoid strain VE2, and a negative control, Escherichia coli strain BL21 on blood agar plates. A clear zone was observed surrounding PAO1 and VE2 cell growth, indicating complete (β-) hemolysis (FIG. 2B). In contrast, the blood agar remained red and opaque surrounding PGN5 and BL21 growth, indicating negligible or no hemolytic activity in these strains (FIG. 2B). To assess for deletion of phzM, the amount of pyocyanin secreted by PAO1 and PGN5 was extracted and measured. The amount of pyocyanin detected was significantly reduced in PGN5 (FIG. 2C). In fact, the difference in pigment production between PAO1 and PGN5 was immediately apparent on agar plates (FIG. 3A-3B). To test for wapR gene deletion, an LPS extraction was performed, followed by silver-stained SDS-PAGE and Western blot on the following strains: PAO1, PGN4 (PGN5 without aroA deletion), VE2, and PAO1wbpL, which serves as a negative control due to a deletion in the O-antigen ligase gene, and thus produces no O-antigen. The presence of O-antigen was detected in PGN4, but the level of LPS banding was significantly reduced compared to the LPS banding profile observed in PAO1 and VE2 (FIG. 2D). Lastly, to test for aroA deletion, ELISA was performed to detect the presence of 3-phosphoshikimate 1-carboxyvinyltransferase in cell lysates prepared from PAO1 and PGN5. The ELISA results showed that the amount of 3-phosphoshikimate 1-carboxyvinyltransferase was significantly reduced in PGN5, compared to that in PAO1 (FIG. 2E). Additionally, the deletion of aroA resulted in slower growth in the PGN5 strain, a growth defect that was restored with the addition of 1 mg/mL of aromatic amino acids (W, Y, F) to the culture medium (data not shown).

US11873477B2. Bacterial cultures and methods for production of alginate (2024-01-16). Marshall University Research Corporation [US]. Inventors: Hongwei D. Yu [US], Meagan E. Valentine [US], Richard M. Niles [US], Thomas Ryan Withers [US], Brandon D. Kirby [US].
Full text: Click here
Patent 2024
1-Carboxyvinyltransferase, 3-Phosphoshikimate Agar Alginate Anabolism Aromatic Amino Acids Biological Assay BLOOD Cardiac Arrest Chromosomes Culture Media Deletion Mutation Enzyme-Linked Immunosorbent Assay Enzymes Escherichia coli Exotoxins Gene Deletion Genes Genetic Markers Genome Hemolysis Homologous Recombination Inflammation Ligase Lipopolysaccharides Methyltransferase O Antigens Oxidation-Reduction Pathogenicity Peptide Elongation Factor 2 Phenazines Phospholipase C Pigmentation Plasma Membrane Plasmids Protein Biosynthesis Pseudomonas aeruginosa Pyocyanine Reading Frames SDS-PAGE secretion SERPINA3 protein, human Silver Strains Surface-Active Agents Tissue, Membrane Toxins, Biological Virulence Factors Western Blot Western Blotting
2
Exosome-mediated Ubiquitin Ligase Delivery
Not available on PMC !

Example 13

The binding of CIBN and CRY2 in cells expressing CIBN-EGFP-CD9 and Ubiquitin ligase-mCherry-Cry2 at 488 nm wavelength blue light, and the loading of Ubiquitin ligases within the exosome is evaluated.

For the massive production of Ubiquitin ligase-loaded exosomes, cells stably expressing CIBN-EGFP-CD9 gene and Ubiquitin ligase-mCherry-CRY2 gene are established, and exosomes are isolated and purified by Tangential Flow Filtration (TFF) method from culture supernatant.

Functional analysis of Ubiquitin ligase-loaded exosomes is performed in target cells:

Target cells are treated with the Ubiquitin ligase-loaded exosomes to show the functional activity.

Animal models are administered with the Ubiquitin ligase-loaded exosomes by i.p. or i.v. to show therapeutic effect.

US11872193B2. Compositions containing protein loaded exosome and methods for preparing and delivering the same (2024-01-16). ILIAS BIOLOGICS INC. [KR]. Inventors: Chulhee Choi [KR], Nambin Yim [KR], Won Do Heo [KR], Seung-Wook Ryu [KR], Hojun Choi [KR], Kyungsun Choi [KR].
Full text: Click here
Patent 2024
Animal Model Cells Exosomes Filtration Genes Ligase Light Therapeutic Effect Ubiquitin
3
Cloning and Mutagenesis of ABCA4 Minigene
Cited 3 times
pIC-neo.Rho3-5.MCS63 (link) was generated by replacing the USH2A sequences of pCI-neo.Rho.USH2A-PE40-wt by a custom MCS containing the following restriction enzyme recognition sites: XhoI, EcoRI, MluI, EcoRV, XbaI, SalI, and Cfr9I designed to aid in downstream cloning steps. The custom MCS was generated by annealing DNA oligonucleotides 5′-CTCGAGAATTCACGCGTGGTGATATCACCTCTAGAGTCGAC-3′ and 5′-CCCGGGTCGACTCTAGAGGTGATATCACCACGCGTGAATTCT-3′. The resulting fragment was used in a ligation mixture together with the backbone plasmid, digested with XhoI and Cfr9I (Thermo Fisher Scientific, Waltham, MA, USA).
To generate a ABCA4 c.5461-10T>C minigene, the pCI vector backbone and a synthetic dsDNA sequence (gBlock; Integrated DNA Technologies, Coralville, IA, USA) containing the ABCA4 minigene genomic region with exon 39 and parts of adjacent introns (1:94,477 466–94,476 525, GRCh37) (Figure S1A) and the c.5461-10T>C mutation were digested using the EcoRI (New England Biolabs, Ipswich, MA, USA) and SalI (Thermo Fisher Scientific). The digested vector was loaded on 1% agarose gel, isolated and purified using the Nucleospin Gel and PCR Clean-up kit according to the manufacturer’s instructions (MACHEREY-NAGEL, Düren, Germany). The digested gBlock was purified directly using the same kit. Digested fragments were ligated overnight at 16°C with T4 ligase (Thermo Fisher Scientific) following the manufacturer’s protocol. The ligation reaction was used to transform DH5α-competent cells (Thermo Fisher Scientific) according to manufacturer’s protocol.
To generate an ABCA4 wild-type midigene (construct with >1 exons and surrounding introns), genomic DNA from HeLa cells (ATCC, Manassas, VA, USA) was extracted with the DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany). The ABCA4 genomic region between intron 37 and intron 41 (1:94,482 094–94,473 896, GRCh37) (Figure 2A) was amplified with primers (Integrated DNA Technologies) containing recognition sites for EcoRI and SalI, using the Phusion High-Fidelity DNA Polymerase kit (Thermo Fisher Scientific) according to the manufacturer’s protocol. The wild-type PCR product and the digested pCI vector backbone were ligated and transformed into GT115 competent cells (InvivoGen, San Diego, CA, USA). To introduce the ABCA4 c.5461-10T>C mutation, the wild-type plasmid and a gBlock (Integrated DNA Technologies) from intron 37 to intron 41 containing the c.5461-10T>C mutation were digested with BoxI and BsiWI (Thermo Fisher Scientific) and subsequently ligated and transformed into GT115-competent cells.
Kaltak M., de Bruijn P., Piccolo D., Lee S.E., Dulla K., Hoogenboezem T., Beumer W., Webster A.R., Collin R.W., Cheetham M.E., Platenburg G, & Swildens J. (2023). Antisense oligonucleotide therapy corrects splicing in the common Stargardt disease type 1-causing variant ABCA4 c.5461-10T>C. Molecular Therapy. Nucleic Acids, 31, 674-688.
Full text: Click here
Publication 2023
BLOOD Cells Cloning Vectors Deoxyribonuclease EcoRI DNA, Double-Stranded DNA-Directed DNA Polymerase DNA Restriction Enzymes Exons Genome HeLa Cells Introns Ligase Ligation Mutation Oligonucleotide Primers Oligonucleotides Plasmids Sepharose Tissues Usher Syndrome, Type IIA Vertebral Column
4
Proximity Ligation Assay for VDAC1-IP3R3
PLA was performed using Duolink In Situ Red Started Kit Mouse/Rabbit (Duolink In Situ Detection Reagents Red, Sigma-Aldrich, DUO92008; Duolink In Situ PLA Probe Anti-Mouse MINUS, Sigma-Aldrich, DUO92004; Duolink In Situ PLA Probe Anti-Rabbit PLUS, Sigma-Aldrich, DUO92004; Duolink In Situ Mounting Medium with DAPI, Sigma-Aldrich, DUO82040) accordingly to the manufacturer’s instructions. Briefly, after fixation with 4% PFA and permeabilization with 0.1% Triton, HeLa cells were incubated with primary antibody, VDAC1 (rabbit; ab15895) and IP3R3 (mouse; BD Bioscience 610312), in blocking solution (PBS + 0.1% Triton X-100 + 4% BSA) ON. Secondary antibodies PLUS and MINUS (anti-rabbit and anti-mouse IgG antibodies conjugated with oligonucleotides) were incubated 1:5 in blocking solution for 1 h at 37°C. The ligation solution (ligation buffer 1:5, ligase 1:40 in MQ) was then incubated for 30 min at 37°C. The amplification solution (amplification buffer 1:5, polymerase 1:40 in MQ) was incubated for 1 h 40 min at 37°C. After incubation, slides were mounted with Duolink In Situ Mounting Medium with DAPI. As a negative control, we incubated VDAC1 alone and with both PLUS and MINUS secondary antibodies.
Sassano M.L., van Vliet A.R., Vervoort E., Van Eygen S., Van den Haute C., Pavie B., Roels J., Swinnen J.V., Spinazzi M., Moens L., Casteels K., Meyts I., Pinton P., Marchi S., Rochin L., Giordano F., Felipe-Abrio B, & Agostinis P. (2023). PERK recruits E-Syt1 at ER–mitochondria contacts for mitochondrial lipid transport and respiration. The Journal of Cell Biology, 222(3), e202206008.
Full text: Click here
Publication 2023
anti-IgG Antibodies Buffers DAPI HeLa Cells Immunoglobulins Ligase Ligation Mice, House Oligonucleotides Rabbits Triton X-100 VDAC1 protein, human
5
Staple RNA Ligation Procedure
The linear staple RNA was mixed with splint RNA at a ratio of 1:1.5 and then added 1 × T4 RNA ligase buffer. The solution was incubated at 95 °C for 5 min, then slowly cooled down to room temperature. After low-speed centrifugation, T4 RNA ligase was added to the mixture to incubate at 37 °C for 4 h, followed by heating at 65 °C for 15 min to inactivate the ligase.
Hu M., Feng C., Yuan Q., Liu C., Ge B., Sun F, & Zhu X. (2023). Lantern-shaped flexible RNA origami for Smad4 mRNA delivery and growth suppression of colorectal cancer. Nature Communications, 14, 1307.
Full text: Click here
Publication 2023
Buffers Centrifugation Ligase RNA Ligase (ATP) Splints Staple, Surgical

Top products related to «Ligase»

1
T4 ligase by New England Biolabs
Sourced in United States, Germany, United Kingdom, China, Israel
T4 ligase is an enzyme that catalyzes the formation of phosphodiester bonds between adjacent 3' hydroxyl and 5' phosphate termini in DNA or RNA. It is commonly used in molecular biology protocols such as DNA cloning and library construction.
2
T4 ligase by Thermo Fisher Scientific
Sourced in United States, Germany, Lithuania, China
T4 ligase is an enzyme used in molecular biology and genetic engineering. It catalyzes the formation of phosphodiester bonds between adjacent 3'-hydroxyl and 5'-phosphate ends in double-stranded DNA, RNA, or a DNA-RNA hybrid. This enzyme is commonly used in DNA cloning and other DNA manipulation procedures.
3
Quick ligase by New England Biolabs
Sourced in United States
Quick Ligase is a DNA ligase enzyme that catalyzes the formation of phosphodiester bonds between adjacent 3'-hydroxyl and 5'-phosphate termini in duplex DNA or RNA. It is designed for rapid and efficient DNA ligation reactions.
4
T4 ligase by Takara Bio
Sourced in Japan, China, United States, Germany
T4 ligase is a DNA-joining enzyme that catalyzes the formation of phosphodiester bonds between adjacent 3' hydroxyl and 5' phosphate termini in duplex DNA or RNA. It is commonly used in molecular biology protocols for the ligation of DNA fragments.
5
T4 dna ligase by New England Biolabs
Sourced in United States, China, United Kingdom, Germany, Japan, France, Canada, Morocco, Switzerland, Australia
T4 DNA ligase is an enzyme that catalyzes the formation of phosphodiester bonds between adjacent 3'-hydroxyl and 5'-phosphate termini in DNA. It is commonly used in molecular biology for the joining of DNA fragments.
6
T4 ligase by Promega
Sourced in United States, United Kingdom
T4 ligase is an enzyme that catalyzes the formation of phosphodiester bonds between adjacent 3' hydroxyl and 5' phosphate termini in DNA molecules. It is commonly used in molecular biology applications to join DNA fragments together.
7
T4 polynucleotide kinase by New England Biolabs
Sourced in United States, Germany, United Kingdom, China, Morocco, Japan
T4 polynucleotide kinase is an enzyme that catalyzes the transfer of the gamma-phosphate from ATP to the 5' hydroxyl terminus of DNA, RNA, or oligonucleotides. This enzyme is commonly used in molecular biology for labeling nucleic acids with radioactive or fluorescent tags.
8
Restriction enzyme by New England Biolabs
Sourced in United States, China, United Kingdom, Germany, Japan, Canada, Morocco, France, Australia
Restriction enzymes are specialized proteins that recognize and cleave specific DNA sequences, known as restriction sites, within a DNA molecule. These enzymes are essential tools in molecular biology and genetic engineering, enabling the manipulation and analysis of DNA sequences.
9
Qiaquick gel extraction kit by Qiagen
Sourced in Germany, United States, Netherlands, United Kingdom, Japan, Canada, France, Spain, China, Italy, India, Switzerland, Austria, Lithuania, Sweden, Australia
The QIAquick Gel Extraction Kit is a product designed for the purification of DNA fragments from agarose gels. It efficiently extracts and purifies DNA from gel slices after electrophoresis.
10
Blunt ta ligase master mix by New England Biolabs
Sourced in United States, United Kingdom
Blunt/TA Ligase Master Mix is a pre-mixed solution for efficient and reliable ligation of blunt-ended or TA-tailed DNA fragments. The mix contains T4 DNA ligase, buffers, and other necessary components for the ligation reaction, providing a convenient and streamlined approach for DNA ligation.

More about "Ligase"