> Chemicals & Drugs > Amino Acid > Liothyronine

Lipase →

Liothyronine

Q: What are the different variations or types of Liothyronine?

There are no significant variations or types of liothyronine. It is a single, well-defined synthetic form of the T3 thyroid hormone. The only differences would be in the manufacturing process, dosage forms (e.g. tablets, capsules), and brand names under which it is sold.

Q: What are the specific applications of Liothyronine?

Liothyronine is primarily used to treat hypothyroidism, a condition where the thyroid gland does not produce enough thyroid hormones. It can also be used to treat other thyroid disorders, such as thyroid cancer, and to support thyroid function in certain medical conditions. Liothyronine may be prescribed on its own or in combination with other thyroid medications.

Q: What are some common usage challenges with Liothyronine?

The main challenge with liothyronine is the need for careful dosage monitoring. Since it is more potent than levothyroxine, the dosage must be precisely adjusted to maintain the right thyroid hormone levels. Too much liothyronine can lead to serious side effects like heart palpitations, anxiety, and bone loss. Patients taking liothyronine will require regular blood tests to ensure the dosage remains optimal.

Q: How can PubCompare.ai help with Liothyronine research?

PubCompare.ai can assist with Liothyronine research in several ways. First, it allows you to screen protocol literatore more efficiently by leveraging AI to pinpoint critical insights. This helps researchers identify the most effective protocols related to Liothyronine for their specific research goals. The platform's AI-driven analysis can also highlight key differences in protocol effectiveness, enabling you to choose the best option for reproducibility and accuracy. This can be especially helpful when working with a potent compound like Liothyronine where dosage and protocol optimization are cruitial.

Liothyronine is a synthetic form of the thyroid hormone triiodothyronine (T3).
It is used to treat hypothyroidism and other thyroid disorders.
Liothyronine is more potent and acts more quickly than the natural thyroid hormone levothyroxine (T4).
It is important to carefully monitor dosage and blood levels when using liothyronine, as it can have serious side effects if not properly managed.
Researchers can use PubCompare.ai to optimize their liothyronine studies, locate relevant protocols, and identify the best products and procedures to streamline their research process.

Most cited protocols related to «Liothyronine»

Adipocyte Differentiation by BMPs

Cited 43 times

To induce adipocyte differentiation by BMPs in the absence of induction cocktails, both WT brown preadipocytes and 3T3-L1 white preadipocytes were grown in regular growth medium supplemented with combination of rhBMPs (3.3 to 8.3 nM), insulin (20 nM) and T3 (1 nM) or vehicle as indicated in the text and figure legends for 7–13 days. To stimulate thermogenic program, differentiated cells were incubated with 500 µM dibutyrul cyclic AMP for 4 hrs. Cells were grown in growth medium without hormonal supplements for 18 hrs prior to cAMP stimulation.
C3H10T1/2 cells were grown in the presence and absence of 8.3 nM rhBMP-7 for 3 days to reach confluence (day 3). These cells were then induced to adipocyte differentiation using protocols described below for additional 7 days (day 10). Adipocyte differentiation was done by treating confluent cells for 48 hours in medium supplemented with 20 nM insulin and 1 nM triiodothyronine (T3), 0.5 mM isobutylmethylxanthine (IBMX), 5 µM dexamethasone, and 0.125 mM indomethacin. Cells were placed back to growth medium supplemented with insulin and T3, which was then changed every second day. After four to five more days in this medium, cells exhibited a fully differentiated phenotype with massive lipid accumulation.

Tseng Y.H., Kokkotou E., Schulz T.J., Huang T.L., Winnay J.N., Taniguchi C.M., Tran T.T., Suzuki R., Espinoza D.O., Yamamoto Y., Ahrens M.J., Dudley A.T., Norris A.W., Kulkarni R.N, & Kahn C.R. (2008). New role of bone morphogenetic protein 7 in brown adipogenesis and energy expenditure. Nature, 454(7207), 1000-1004.

Publication 2008

3T3-L1 Cells Adipocytes Bone Morphogenetic Proteins Cells Cyclic AMP Dexamethasone Indomethacin Insulin Liothyronine Lipid A Phenotype Thermogenesis

Cardiac Differentiation of NKX2-5 and MYBPC3 hiPSCs

Cited 13 times

H3 NKX2-5^eGFP/w hESCs or M1 NKX2-5^eGFP/w hESCs as previously generated (Elliott et al., 2011 (link)) were maintained on mouse embryonic fibroblasts and passaged using TrypLE select (Life Technologies). The generation of transgene-free hiPSCs from skin fibroblasts of one healthy male donor (LUMC0004iCtrl [Con1]) and three patients each with a c.2373dupG mutation in MYBPC3 (LUMC0033iMyBPC [HCM1], LUMC0034iMyBPC [HCM2], and LUMC0035iMyBPC [HCM3]) was previously reported (Dambrot et al., 2014 (link)). A second transgene-free control hiPSC line (LUMC0047iCtrl [Con2]) generated from another healthy male donor was included in this study. hiPSCs were maintained on Matrigel (growth factor reduced; Corning 354230) in mTeSR1 medium (Stem Cell Technologies) and passaged with 1 mg/ml Dispase (Life Technologies). NKX2-5^eGFP/w hiPSCs (R.P.D. and C.L.M., unpublished data) were maintained in Essential 8 medium (Life Technologies) and differentiated as previously described (van den Berg et al., 2015 ).
Cardiac differentiation was induced from monolayer cultures on Matrigel in a serum-free medium (BSA, polyvinyl alcohol, essential lipids [BPEL]) as described in the Supplemental Information. Contracting cultures were dissociated on day 13 and replated on Matrigel-coated 24-well plates. The following experimental factors were added on day 16, refreshed on day 20, and measured on day 21: 100 ng/ml Long R3 IGF-1 (in the main text: IGF-1), 1 μM SAG (Millipore), 1 μM dexamethasone, 100 nM triiodothyronine hormone, 10 μM phenylephrine, 1 μM isoproterenol, and 1-1000 nM norepinephrine. Unless otherwise stated, all factors were obtained from Sigma-Aldrich.
The composition of the defined cardiomyocyte medium used in the MYBPC3 shRNA experiment can be found in the Supplemental Information.

Birket M.J., Ribeiro M.C., Kosmidis G., Ward D., Leitoguinho A.R., van de Pol V., Dambrot C., Devalla H.D., Davis R.P., Mastroberardino P.G., Atsma D.E., Passier R, & Mummery C.L. (2015). Contractile Defect Caused by Mutation in MYBPC3 Revealed under Conditions Optimized for Human PSC-Cardiomyocyte Function. Cell Reports, 13(4), 733-745.

Full text: Click here

Publication 2015

Dexamethasone dispase Embryo Fibroblasts Growth Factor Heart Hormones Human Embryonic Stem Cells Human Induced Pluripotent Stem Cells IGF1 protein, human Isoproterenol Liothyronine Lipids Males matrigel Mice, Laboratory Mutation Myocytes, Cardiac Norepinephrine Patients Phenylephrine Polyvinyl Alcohol Serum Short Hairpin RNA Skin Stem Cells Tissue Donors Transgenes

Cognitive Profiles in Alzheimer's Spectrum

Cited 13 times

A total of 2470 participants were recruited, including 1151 cognitively normal controls (NC), 898 patients with amnestic mild cognitive impairment (aMCI), and 421 patients with mild Alzheimer disease (AD).
We recruited the controls using cluster sampling in Jingansi Community Shanghai, China. The inclusion criteria for NC were: age between 50 and 90; no memory complaints verified by an informant; cognitively normal, based on the absence of significant impairment in cognitive functions or activities of daily living (ADL); Clinical Dementia Rating (CDR) = 0; and Hamilton depression rating scale (HAMD) scored ≤ 12 on the 17-item scale in past 2 weeks. They had adequate visual and auditory acuity to allow cognitive testing. Participants with any significant neurologic disease and psychiatric disorders/psychotic features were excluded.
All the patients with aMCI and AD were recruited from the Memory Clinic, Huashan Hospital, from Jun 2004 to Oct 2011.They finished the laboratory tests and cranial CT/MRI scan, and had no clinically significant abnormalities in vitamin B12, folic acid, thyroid function (free triiodothyronine-FT3, free tetraiodothyronine-FT4, thyroid stimulating hormone-TSH), rapid plasma regain (RPR), or treponema pallidum particle agglutination (TPPA).
The aMCI patients were diagnosed according to the following criteria19]: (1) cognitive complaints verified by an informant; (2) cognitive impairment lasting more than 3 months; (3) Mini-mental state examination-Chinese version (C-MMSE)[25] (link) ≥ cut-off score for adjusted education; (4) Abnormal objective memory impairment documented by scoring below the age and education adjusted cutoff on an episodic memory test (Auditory Verbal Learning Test); (5) preserved basic ADL/minimal impairment in complex instrumental functions; (6) etiology unknown; (7) normal sense of hearing and sight; (8) has not met diagnostic criteria of dementia based on the National Institute of Neurological and Communicative Disorders and Stroke and the Alzheimer's Disease and Related Disorders Association (NINCDS-ADRDA).
The AD patients (n = 421) met the following criteria: (1) diagnosed as probable AD according to the NINCDS-ADRDA; (2) no obvious medical, neurological or psychiatric diseases or psychological dysfunction including anxiety and depression within the previous one month; (3) no visual or auditory deficit.

Zhao Q., Guo Q., Li F., Zhou Y., Wang B, & Hong Z. (2013). The Shape Trail Test: Application of a New Variant of the Trail Making Test. PLoS ONE, 8(2), e57333.

Full text: Click here

Publication 2013

Agglutination Alzheimer's Disease Anxiety Auditory Perception Chinese Cognition Cognitive Impairments, Mild Congenital Abnormality Cranium Dementia Disorders, Cognitive Folic Acid Hearing Tests Liothyronine Memory Memory, Episodic Memory Deficits Mental Disorders Mini Mental State Examination Nervous System Disorder Patients Plasma Thyroid Gland Thyrotropin Treponema pallidum Vision Vitamin B12 X-Ray Computed Tomography

Multilineage Differentiation of MSCs

Cited 8 times

Differentiation of MSCs was induced by culture under specific conditions for 21 days. For adipogenesis, MSCs were plated at 10⁴ cells/cm² in complete Dulbecco's modified Eagle's medium (DMEM)-F12 (Invitrogen) with 16 µM biotin, 18 µM panthotenic acid, 100 µM ascorbic acid, 5 µg/ml insulin, 0.03 µM dexamethasone, 1 µg/ml transferring, 2 ng/ml triiodothyronine (T3) and 100 nM rosiglitazone (Sigma-Aldrich, Saint-Quentin Fallavier, France). Formation of lipid droplets was visualized by Oil red O staining on cells fixed by 3% glutaraldehyde for 1 h. For osteogenesis and chondrogenesis, inductive conditions were already reported [46] (link). Chondrogenesis was assessed by RT-qPCR and immunohistochemistry on paraffin sections of pellets using a 1/50 dilution of anti-aggrecan antibody (Chemicon, Millipore, Molsheim) and the "Ultravision detection system anti-polyvalent HRP/DAB" kit (Lab Vision, Francheville, France). Sections were counterstained with Mayer's hematoxylin (Lab Vision) for 3 min and mounted with Eukitt (Sigma-Aldrich). Osteogenic differentiation of MSCs was assessed by RT-qPCR and extracellular matrix mineralization detected as already described [46] (link).

Bouffi C., Bony C., Courties G., Jorgensen C, & Noël D. (2010). IL-6-Dependent PGE2 Secretion by Mesenchymal Stem Cells Inhibits Local Inflammation in Experimental Arthritis. PLoS ONE, 5(12), e14247.

Full text: Click here

Publication 2010

Acids Adipogenesis Aggrecans Antibodies, Anti-Idiotypic Ascorbic Acid Biotin Cells Chondrogenesis Dexamethasone Extracellular Matrix Glutaral Hematoxylin Immunohistochemistry Insulin Liothyronine Lipogenesis Osteogenesis Paraffin Pellets, Drug Physiologic Calcification Rosiglitazone Technique, Dilution Vision

Thyroid Function and Cardiometabolic Risk

Cited 7 times

The Ethical Committee of the Polish Mother’s Memorial Hospital – Research Institute, Poland, approved all the procedures, applied in the present study, and fully informed, written consent was obtained from all patients (No. 34/2016).
Characteristics of patients enrolled into the study, as well as all indispensable procedures, were described in details elsewhere [14 (link)]. From ninety nine (99) euthyroid female inpatients with thyroid tests in reference ranges (TSH 0.27–4.2 mIU/l; free thyroxine (FT4) 0.93–1.7 ng/dl; free triiodothyronine (FT3) 2.6–4.4 pg/ml), which were considered in the previous analysis [14 (link)], ninety five (95) patients aged 18–48 years, were considered in the present statistical analysis, which did not change the basic results significantly.
The patients were divided into two groups of seventy (70) patients with low normal TSH (< 2.5 mIU/l) (Controls), and twenty five (25) patients (26.3% of the whole sample examined) with high normal TSH (≥2.5 mIU/l), which were well matched at baseline in terms of age and body mass index (BMI) (Table 1).
Table 1

Mean (±SEM) values of clinical/laboratory parameters in patients with TSH < 2.5 mIU/l and in patients with TSH ≥ 2.5 mIU/l. Statistical evaluation was performed by an unpaired Student’s t-test

Clinical/laboratory parameters	TSH < 2.5 mIU/ln = 70	TSH ≥ 2.5 mIU/ln = 25	p
Age [years]	30.95 ± 1.01	28.36 ± 1.43	0.175
Body mass [kg]	71.64 ± 2.20	74.13 ± 4.47	0.586
Height [m]	1.66 ± 0.006	1.64 ± 0.013	0.107
BMI [kg/m²]	25.85 ± 0.78	27.42 ± 1.42	0.327
Waist circumference [cm]	82.04 ± 1.83	85.04 ± 3.66	0.429
Hip circumference [cm]	103.26 ± 1.51	104.76 ± 2.87	0.625
WHR	0.79 ± 0.008	0.81 ± 0.02	0.365
FT4 [ng/dl]	1.23 ± 0.02	1.22 ± 0.03	0.765
FT3 [pg/ml]	2.91 ± 0.06	3.09 + ±0.07	0.101
TPOAb [IU/ml]	86.02 ± 18.74	31.27 ± 14.58	0.097
TgAb [IU/ml]	82.16 ± 16.81	77.91 ± 29.56	0.898
TSHRAb [IU/l]	0.45 ± 0.035	0.37 ± 0.03	0.185
Cholesterol [mg/dl]	176.96 ± 3.85	179.36 ± 6.28	0.748
HDLC [mg/dl]	57.06 ± 1.62	53.84 ± 2.90	0.319
LDLC [mg/dl]	96.41 ± 3.21	101.84 ± 5.79	0.398
HDLC/Cholesterol	0.33 ± 0.01	0.31 ± 0.02	0.281
TGs [mg/dl]	112.03 ± 7.98	113.40 ± 15.63	0.933
Glucose [mg/dl]	83.01 ± 0.83	84.20 ± 1.54	0.479
CRP [mg/dl]	0.76 ± 0.05	0.96 ± 0.16	0.093
Iron [μg/dl]	114.07 ± 4.82	102.76 ± 8.37	0.237
Lipid peroxidation [MDA + 4-HDA (nmol/ml)]	2.53 ± 0.09	2.96 ± 0.16	0.020
MBL [ng/ml]	1240.26 ± 63.95	984.93 ± 85.18	0.034

Nineteen patients were previously diagnosed to be hypothyroid, therefore they were treated with L-thyroxine (25–150 μg daily).

Karbownik-Lewinska M., Stepniak J., Marcinkowska M., Krygier A, & Lewinski A. (2020). High normal TSH is associated with lower mannan-binding lectin in women of childbearing age. BMC Endocrine Disorders, 20, 1.

Full text: Click here

Publication 2020

Clinical Laboratory Services Hypothyroidism Index, Body Mass Inpatient Liothyronine Mothers Patients Student Thyroid Function Tests Thyroxine Woman

Most recents protocols related to «Liothyronine»

Metabolic and Thyroid Dysfunction Evaluation

Blood samples were collected in the morning after an overnight fast before participants received any medical treatment. Serum levels of free triiodothyronine (FT3), free thyroxine (FT4), thyroid stimulating hormone (TSH), antithyroglobulin (TgAb), thyroid peroxidase antibody (TPOAb), TC, TG, high-density lipoprotein (HDL-C), low-density lipoprotein (LDL-C), and glucose were assessed. Lipid markers (TC, TG, HDL-C, LDL-C) and glucose were measured on a Cobas E610 (Roche, Basel, Switzerland). Thyroid hormones were assayed on a Roche C6000 Electrochemiluminescence Immunoassay Analyzer (Roche Diagnostics, Indianapolis, IN, USA). Measurements were conducted in the laboratory of the First Hospital, Shanxi Medical University. The nurses measured the patients’ weight, height, and blood pressure. We calculated body mass index (BMI) according to the following formula: BMI = Weight (kg)/Height (m) ².
According to previous studies in the Chinese population (38 (link), 39 (link)), metabolic disturbances and thyroid dysfunction were defined as follows: (1) overweight or obesity: BMI≥24; (2) hyperglycemia: glucose≥6.1mmol/L; (3) hypertension: SBP≥140 mmHg and/or DBP≥90mmHg; (4) hypertriglyceridemia: TG≥2.3 mmol/L; (5) low HDL: HDL-C ≤ 1.0 mmol/L; (6) hypercholesterolemia: TC≥6.2 mmol/L or LDL-C≥4.1 mmol/L; (7)abnormal TgAb: TgAb≥115 IU/L; (8) abnormal TPOAb: TPOAb ≥34 IU/L; (9) subclinical hypothyroidism (SCH): TSH >4.2 mIU/L with normal fT4 concentration (10–23 pmol/L); (10) hyperthyroidism: TSH<0.27 mIU/L and FT4 >23 pmol/L, and (11) hypothyroidism: TSH >4.2 mIU/L with low FT4 concentration (<10 pmol/L).

Peng P., Wang Q., Lang X., Liu T, & Zhang X.Y. (2023). Clinical symptoms, thyroid dysfunction, and metabolic disturbances in first-episode drug-naïve major depressive disorder patients with suicide attempts: A network perspective. Frontiers in Endocrinology, 14, 1136806.

Full text: Click here

Publication 2023

anti-thyroglobulin antibody BLOOD Blood Pressure Chinese Diagnosis Glucose High Blood Pressures high density lipoprotein-1 High Density Lipoproteins Hypercholesterolemia Hyperglycemia Hyperthyroidism Hypertriglyceridemia Hypothyroidism Immunoassay Index, Body Mass LDL-1 Liothyronine Lipids Low-Density Lipoproteins Nurses Obesity Patients Serum Thyroid Gland Thyroid Hormones thyroid microsomal antibodies Thyrotropin Thyroxine

Schistosoma mansoni lifecycle maintenance

The “Lobato Paraense” snail facility at the René Rachou Institute—FIOCRUZ provided cercariae of S. mansoni (LE strain). The parasite cycle is maintained throughout passages between hamsters (Mesocricetus auratus) and snails (Biomphalaria glabrata).
As previously described, cercariae were mechanically transformed into schistosomula (Milligan and Jolly, 2011 (link)). Schistosomula were cultured in GMEM supplemented with 0.2 μM triiodothyronine; 0.1% glucose; 0.1% lactalbumin; 20 mM HEPES; 0.5% MEM vitamin solution; 5% Schneider’s Insect Medium; and 0.5 μM hypoxanthine, 1 μM hydrocortisone, 1% penicillin/streptomycin, and 2% heat-inactivated FBS.
Hamsters (M. auratus) were infected with cercariae and subjected to perfusion (Pellegrino and Siqueira, 1956 (link)) after 45 days for obtaining adult worms. Males and females were washed, separated manually, and cultured in Roswell Park Memorial Institute 1640 (RPMI 1640) medium supplemented with 2% penicillin/streptomycin and 10% heat-inactivated FBS.

Coelho F.S., Gava S.G., Andrade L.F., Geraldo J.A., Tavares N.C., Lunkes F.M., Neves R.H., Machado-Silva J.R., Pierce R.J., Oliveira G, & Mourão M.M. (2023). Schistosoma mansoni coactivator associated arginine methyltransferase 1 (SmCARM1) effect on parasite reproduction. Frontiers in Microbiology, 14, 1079855.

Full text: Click here

Publication 2023

2-(beta-(4-hydroxyphenyl)ethylaminomethyl)tetralone Adult Australorbis glabratus Cercaria Culture Media Females Glucose Hamsters Helminths HEPES Hydrocortisone Hypoxanthine Insecta Lactalbumin Liothyronine Males Mesocricetus auratus neuronectin Parasites Penicillins Perfusion Snails Strains Streptomycin Vitamins

Parasite Culture Reagents and Primers

The following reagents were used for parasite culture, Glasgow Minimum Essential Medium (GMEM), triiodothyronine, lactalbumin, HEPES, MEM vitamin solution, Schneider’s Insect Medium, hypoxanthine, and hydrocortisone were purchased from Sigma-Aldrich. Penicillin/streptomycin, RPMI 1640 medium, and Fetal Bovine Serum (FBS) were from Gibco; glucose from VETEC; TRIzol Reagent from Invitrogen.
All primers were purchased from IDT, Smcarm1-dsRNA_F: taatacgactcactatagggCATGGCATGGATCTAACTGC, Smcarm1-dsRNA_R: taatacgactcactatagggTGTTGTTGTTGCTGTTGTGC, Smcarm1-qPCR_F: TGCTGTTGAAGCATCTAATATGG, Smcarm1-qPCR_R: ATAATGACATCCACTGGTTCG; SmcoxI (Smp_900000) SmcoxI-qPCR_F: TACGGTTGGTGGTGTCACAG, SmcoxI-qPCR_R: ACGGCCATCACCATACTAGC; GFP-dsRNA_F: taatacgactcactatagggTCTTCAAGTCCGCCATG, GFP-dsRNA_R: taatacgactcactatagggTGCTCAGGTAGTGGTTGTC. The sequences in lowercase correspond to the T7 promoter sequence added to the 5′-end in primers designed for dsRNA synthesis.

Full text: Click here

Publication 2023

Anabolism Fetal Bovine Serum Glucose HEPES Hydrocortisone Hypoxanthine Insecta Lactalbumin Liothyronine Oligonucleotide Primers Parasites Penicillins RNA, Double-Stranded Streptomycin trizol Vitamins

Thyroid Function and Metabolic Biomarkers in Diabetes

Data analyzed in this study were applied and abstracted from the scientific research sharing platform (Yidu Cloud Research Collaboration Platform) of Beijing Hospital of Traditional Chinese Medicine affiliated to Capital Medical University, and all study participants were given standardized questionnaires for demographics and medical histories. Diabetes mellitus was defined as fasting plasma glucose ≥ 7.0 mmol/L, or 2-h plasma glucose ≥ 11.1mmol/l during an OGTT, or hemoglobin A1c (HbA1c) ≥ 6.5%, or random plasma sugar ≥ 11.1mmol/l, or the acts of taking hypoglycemic drugs or receiving parenteral insulin therapy [15 ]. Hypertension was defined as systolic blood pressure (SBP) ≥ 140 mmHg or diastolic blood pressure (DBP) ≥ 90 mmHg or receiving antihypertensive medication [16 ]. Body mass index (BMI) was calculated as weight in kilograms divided by height in meters squared. Laboratory tests were performed for serum samples obtained by venipuncture after fasting for 8 h in patients prior to clinical treatment. Concentrations of serum thyroid hormone were measured by chemiluminescence, including triiodothyronine (T3), thyroxine (T4), FT3, free thyroxine (FT4) and TSH. The corresponding reference ranges used for these hormones were 0.60–1.81 ng/ml, 4.50–10.90 ug/dL, 2.30–4.20 pg/mL and 0.89–1.76 ng/dL, and 0.51–6.27 uIU/mL. Creatinine concentrations were determined by the enzymatic method, and urine microalbumin was determined by the immunoturbidimetric method. Serum triglycerides (TG), total cholesterol (TC), high density lipoprotein cholesterol (HDL-C), and low density lipoprotein cholesterol (LDL-C) concentrations were measured with an automated biochemical analyzer. HbA1c was determined by high performance liquid chromatography. All tests were measured twice before reporting and performed by trained staff at the laboratory of the Beijing Hospital of Traditional Chinese Medicine, Capital Medical University.

Liu M.C., Li J.L., Wang Y.F., Meng Y., Cai Z., Shen C., Wang M.D., Zhao W.J, & Niu W.Q. (2023). Association between thyroid hormones and diabetic kidney disease in Chinese adults. BMC Endocrine Disorders, 23, 56.

Full text: Click here

Publication 2023

Antihypertensive Agents Carbohydrates Chemiluminescence Cholesterol Cholesterol, beta-Lipoprotein Creatinine Diabetes Mellitus Enzymes Glucose Hemoglobin A, Glycosylated High-Performance Liquid Chromatographies High Blood Pressures High Density Lipoprotein Cholesterol Hormones Hypoglycemic Agents Immunoturbidimetry Index, Body Mass Insulin Liothyronine Oral Glucose Tolerance Test Parenteral Nutrition Patients Phlebotomy Plasma Pressure, Diastolic SERPINA3 protein, human Serum Systolic Pressure Thyroid Hormones Thyroxine Triglycerides Urine

Maternal Thyroid Function and Neonatal Birth Weight

This was a prospective cohort study. Pregnant women who received regular perinatal healthcare in the Outpatient Department of the Women’s Hospital School of Medicine Zhejiang University and delivered in the hospital between June 2017 and April 2019 were recruited. A total of 844 pregnant women with complete demographic and obstetric data were included for analysis. This study was approved by the Ethics Committee of Women’s Hospital School of Medicine Zhejiang University.
All pregnant women were enrolled during the first trimester, all of whom had measured thyroid-stimulating hormone (TSH), FT4, free triiodothyronine (FT3), and total thyroxine (TT4) concentration in the second trimester, and neonatal birth weight data were available. Women with multiple pregnancies, accompanied with pregnancy complications such as abortion, GDM, and hypertensive disorders, using medication known to interfere thyroid hormones, or had a history of thyroid diseases were excluded.
Maternal clinical characteristics—including age, height, pre-pregnancy and prenatal weight and body mass index (BMI), gravity, parity, mode of delivery, educational level, and neonatal birth weight—were obtained from hospital information system and child care system.
The blood samples were collected after overnight fasting, and samples were centrifuged within 6 h. The concentrations of TSH, FT4, FT3, and TT4 were determined according to the measurement instructions.

Yang M., Sun M., Jiang C., Wu Q., Jiang Y., Xu J, & Luo Q. (2023). Thyroid hormones and carnitine in the second trimester negatively affect neonate birth weight: A prospective cohort study. Frontiers in Endocrinology, 14, 1080969.

Full text: Click here

Publication 2023

Birth Weight BLOOD Ethics Committees, Clinical Gravity High Blood Pressures Index, Body Mass Induced Abortions Infant, Newborn Liothyronine Mothers Obstetric Delivery Outpatients Pharmaceutical Preparations Pregnancy Pregnancy Complications Pregnant Women Thyroid Diseases Thyroid Hormones Thyrotropin Thyroxine Woman

Top products related to «Liothyronine»

Triiodothyronine by Merck Group

Sourced in United States, Germany, United Kingdom, France, Macao, China, Italy

Triiodothyronine is a laboratory instrument used to measure the levels of the thyroid hormone triiodothyronine in biological samples. It is a key component in the assessment of thyroid function and disorders.

Insulin by Merck Group

Sourced in United States, Germany, United Kingdom, China, France, Canada, Italy, Sao Tome and Principe, Japan, Switzerland, Macao, Israel, Australia, Spain, Austria, Sweden, Poland, Denmark, New Zealand, Belgium, Portugal, Ireland, Netherlands, Brazil, Colombia, India, Morocco, Argentina

Insulin is a lab equipment product designed to measure and analyze insulin levels. It provides accurate and reliable results for research and diagnostic purposes.

Dexamethasone (dex) by Merck Group

Sourced in United States, Germany, United Kingdom, China, Japan, Italy, Sao Tome and Principe, Macao, France, Australia, Switzerland, Canada, Denmark, Spain, Israel, Belgium, Ireland, Morocco, Brazil, Netherlands, Sweden, New Zealand, Austria, Czechia, Senegal, Poland, India, Portugal

Dexamethasone is a synthetic glucocorticoid medication used in a variety of medical applications. It is primarily used as an anti-inflammatory and immunosuppressant agent.

Hydrocortisone by Merck Group

Sourced in United States, Germany, United Kingdom, France, China, Italy, Canada, Macao, Japan, Israel, Switzerland, Australia, Sao Tome and Principe, Spain, Austria, Portugal, Belgium, Denmark, Sweden, Argentina, Brazil, Poland, New Zealand

Hydrocortisone is a laboratory-grade reagent used in various research and analytical applications. It is a synthetic corticosteroid compound with anti-inflammatory and immunosuppressant properties. Hydrocortisone is commonly utilized as a standard or reference material in analytical procedures, such as assays and chromatographic techniques, to quantify and identify related compounds.

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

Triiodothyronine t3 by Merck Group

Sourced in United States, Italy

Triiodothyronine (T3) is a type of lab equipment used for the measurement and analysis of thyroid hormone levels. It is a key component in the assessment of thyroid function.

Penicillin streptomycin by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia

Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.

Transferrin by Merck Group

Sourced in United States, Germany, France, United Kingdom, Japan, China, Austria, Macao, Israel, Italy, Switzerland, Canada, Sao Tome and Principe, Australia, Poland, Sweden, Argentina

Transferrin is a laboratory product used as a critical component in cell culture media. It is a glycoprotein that plays a key role in the transport and delivery of iron to cells. Transferrin functions to bind and carry iron ions, facilitating their uptake and utilization by cells in vitro.

Epidermal growth factor (egf) by Merck Group

Sourced in United States, Germany, United Kingdom, China, Italy, Canada, Japan, Spain, France, Macao, Israel, Australia, Denmark, Sao Tome and Principe, Morocco, Austria, Portugal, Belgium, Poland, Switzerland

EGF is a laboratory equipment product manufactured by Merck Group. It is a protein that plays a key role in cell growth and differentiation processes. EGF primarily functions as a growth factor, stimulating cell division and proliferation in various cell types.

Dmem f12 by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, China, France, Japan, Canada, Australia, Italy, Switzerland, Belgium, New Zealand, Spain, Denmark, Israel, Macao, Ireland, Netherlands, Austria, Hungary, Holy See (Vatican City State), Sweden, Brazil, Argentina, India, Poland, Morocco, Czechia

DMEM/F12 is a cell culture medium developed by Thermo Fisher Scientific. It is a balanced salt solution that provides nutrients and growth factors essential for the cultivation of a variety of cell types, including adherent and suspension cells. The medium is formulated to support the proliferation and maintenance of cells in vitro.

What is Liothyronine and how is it used?

What are the different variations or types of Liothyronine?

What are the specific applications of Liothyronine?

What are some common usage challenges with Liothyronine?

The main challenge with liothyronine is the need for careful dosage monitoring. Since it is more potent than levothyroxine, the dosage must be precisely adjusted to maintain the right thyroid hormone levels. Too much liothyronine can lead to serious side effects like heart palpitations, anxiety, and bone loss. Patients taking liothyronine will require regular blood tests to ensure the dosage remains optimal.

How can PubCompare.ai help with Liothyronine research?

PubCompare.ai can assist with Liothyronine research in several ways. First, it allows you to screen protocol literatore more efficiently by leveraging AI to pinpoint critical insights. This helps researchers identify the most effective protocols related to Liothyronine for their specific research goals. The platform's AI-driven analysis can also highlight key differences in protocol effectiveness, enabling you to choose the best option for reproducibility and accuracy. This can be especially helpful when working with a potent compound like Liothyronine where dosage and protocol optimization are cruitial.

More about "Liothyronine"

Liothyronine, also known as T3 or triiodothyronine, is a synthetic version of the thyroid hormone triiodothyronine.
It is commonly used to treat hypothyroidism and other thyroid disorders.
Compared to the natural thyroid hormone levothyroxine (T4), liothyronine is more potent and works more quickly.
Liothyronine plays a crucial role in regulating metabolism, growth, and development.
It is essential for proper brain function, heart health, and energy production.
Researchers often use liothyronine in combination with other compounds like insulin, dexamethasone, and hydrocortisone to study its effects on cellular processes.
When using liothyronine, it is important to carefully monitor dosage and blood levels, as improper management can lead to serious side effects.
Researchers can utilize tools like PubCompare.ai to optimize their liothyronine studies, locate relevant protocols from literature and patents, and identify the best products and procedures to streamline their research.
PubCompare.ai's AI-driven comparisons and insights can help researchers unlock new discoveries and improve the reproducibility and accuracy of their liothyronine studies.
By leveraging this tool, researchers can access a wealth of information on liothyronine, including its interactions with related compounds like triiodothyronine (T3), penicillin/streptomycin, transferrin, and EGF in cell culture media like DMEM/F12 with FBS.